- Email: [email protected]
Fibrillin-1 insufficiency alters periodontal wound healing failure in a mouse model of Marfan syndrome
Archives of Oral Biology 90 (2018) 53–60
Contents lists available at ScienceDirect
Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio
Fibrillin-1 insufficiency alters periodontal wound healing failure in a mouse model of Marfan syndrome
T
Keisuke Handaa, Syouta Abeb, V. Venkata Suresha, Yoshiyasu Fujiedab, Masaki Ishikawaa, Ai Orimotoa, Yoko Kobayashia, Satoru Yamadac, Satoko Yamabac, Shinya Murakamic, ⁎ Masahiro Saitoa, a
Division of Operative Dentistry, Department of Restorative Dentistry, Tohoku University Graduate School of Dentistry, Sendai, Miyagi, Japan Faculty of Industrial Science and Technology, Tokyo University of Science, Katsushika, Japan c Department of Periodontology and Oral Pathology, Osaka University Graduate School of Dentistry, Suita, Osaka, Japan b
A R T I C LE I N FO
A B S T R A C T
Keywords: Fibrillin-1 Marfan syndrome Periodontal disease Ligature-induced periodontal disease mouse model (LI)
Objective: Marfan syndrome (MFS) is a systemic connective tissue disorder caused by insufficient fibrillin-1 (FBN-1), a major component of microfibrils that controls the elasticity and integrity of connective tissues. FBN-1 insufficiency in MFS leads to structural weakness, which causes various tissue disorders, including cardiovascular and periodontal disease. However, the role of FBN-1 insufficiency in the destruction and regeneration of connective tissue has not yet been clarified. To investigate the role of FBN-1 insufficiency in tissue destruction and regeneration. Design: We used a ligature-induced (LI) periodontal disease model in fbn-1-deficient mice (fbn-1c1039G/+ mice) with MFS and investigated the regeneration level of periodontal tissue and as an inflamatic marker, the expression of the matrix metalloproteinase (mmp)-9 and tumor necrosis factor (tnf)-α. Results: Interestingly, fbn-1c1039G/+ mice exhibited slowed wound healing compared with wild type mice, but periodontal tissue destruction did not differ between these mice. Moreover, fbn-1c1039G/+ mice exhibited delayed bone healing in association with continuous mmp-9 and tnf-α expression. Furthermore, inflammatory cells were obvious even after the removal of ligatures. Conclusion: These data suggest that fibrillin-1 insufficiency in fbn-1c1039G/+ mice interfered with wound healing in connective tissue damaged by inflammatory diseases such as periodontal disease.
1. Introduction Marfan syndrome (MFS) is an autosomal dominant disorder of connective tissue that affects approximately 1 in 5000 people (Judge & Dietz, 2005). MFS is caused by missense mutations of FIBRILLIN-1 (FBN-1) (Dietz et al., 1991), a component of extracellular microfibrils, leading to a systemic disorder of connective tissues, including aortic aneurysms and dissection, ocular lens dislocation, emphysema, bone overgrowth and severe periodontal disease (Judge & Dietz, 2005; Straub, Grahame, Scully, & Tonetti, 2002). FBN-1 is a 350-kDa glycoprotein (Sakai, Keene, & Engvall, 1986) that consists of three functional FBN-1-1 genes (FBN-1, -2, and -3) and exhibits superimposable modular structures consisting of 46/47 epidermal growth factor (EGF)-like domains (Kielty, Sherratt, & Shuttleworth, 2002). FBN-1 is a major insoluble extracellular matrix component in connective tissue microfibrils
and limits tissue elasticity via fibrillin-1 microfibril formation (Noda et al., 2013). Fibrillin-rich microfibrils contribute to the extracellular regulation of endogenous transforming growth factor-β (TGF-β) activity by providing a structural platform, i.e., latent TGF-β-binding proteins (LTBPs) (Ramirez & Sakai, 2010). FBN-1 haploinsufficiency impairs tissue integrity and dysregulates TGF-β activation and signaling, resulting in the up-regulation of tissue destruction-related genes such as mmp-9 (Chung et al., 2007; Neptune et al., 2003). Anti-TGF-β therapy is being studied as a general therapy to delay or prevent tissue destruction in MFS patients. Treatment with losartan, an angiotensin II type I receptor blocker that can attenuate TGF-β signaling, in a mouse model of MFS prevented aortic root growth by suppressing elastic fiber fragmentation. Losartan treatment also decreased the rate of aortic root dilation in children with MFS (Brooke et al., 2008). The activation of IL-6-STAT3 signaling has also been shown to
⁎ Corresponding author at: Tohoku University, Graduate School of Dentistry, Division of Operative Dentistry, Department of Restorative Dentistry, 4-1 Seiryo-machi, Aoba-ku, 9808575 Sendai, Japan. E-mail address: [email protected] (M. Saito).
https://doi.org/10.1016/j.archoralbio.2018.02.017 Received 26 July 2017; Received in revised form 26 February 2018; Accepted 27 February 2018 0003-9969/ © 2018 Published by Elsevier Ltd.
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
contribute to aneurysmal dilation in the mgR/mgR hypomorphic fibrillin-deficient mouse model via increased mmp-9 activity, which results in collagen fibril degradation (Ju et al., 2014). These findings suggested that long-term disease progression in MFS is caused by a pathogenic immune response that interferes with tissue remodeling and repair after injury. Administration of β-adrenergic receptor or angiotensin II receptor blocker type 1 antagonist and precise surgical treatment are important for the treatment of MFS (Milewicz, Dietz, & Miller, 2005; Shores, Berger, Murphy, & Pyeritz, 1994), but wound healing in destroyed connective tissue and damaged tissue is not improved. Thus, clarifying the role of FBN-1 insufficiency in the inflammatory destruction and regeneration of connective tissue is important (Saito & Tsuji, 2012). In untreated patients, periodontal disease results in soft tissue destruction and progressive bone destruction, which lead to tooth mobility and subsequent tooth loss (Kinney, Ramseier, & Giannobile, 2007; Suda, Moriyama, & Ganburged, 2013). Periodontal disease is caused by a bacterial infection that activates the innate immune response via Tolllike receptors, resulting in the up-regulation of innate immunity cytokines such as tnf-α, IL-1, and IL-6 to ultimately result in progressive tissue destruction (Garlet, 2010). MFS has been shown to increase the susceptibility to severe periodontal disease in association with periodontal ligament dysfunction due to microfibril insufficiency, suggesting that FBN-1 microfibril formation plays a central role in periodontal ligament formation (Shiga et al., 2008; Straub et al., 2002). Notably, the elastic fibers of the periodontal ligament, known as oxytalan fibers, primarily consist of FBN-1 microfibrils and do not contain significant amounts of elastin. Therefore, the periodontal ligament is likely more susceptible than other connective tissues to breakdown in the MFS mouse model. Thus, periodontal disease is a useful model to assess the effect of MFS on inflammatory tissue destruction. In this study, inflammatory tissue destruction and wound healing were investigated in a periodontal disease model, fbn-1C1039G/+ mice, to elucidate the effect of FBN-1 insufficiency on the progression of periodontal disease.
Alveolar bone loss was analyzed by measuring the distance from the lingual cemento-enamel junction (CEJ) of the second molar to the lingual-mesial root to the lingual alveolar bone crest (ABC) parallel to the sagittal plane. The distance from the CEJ to the ABC (ABC-CEJ) was used to quantify bone resorption.
2. Materials and methods
2.6. Gene expression
2.1. Animals
RNA was isolated using Isogen (Nippon Gene, Tokyo, Japan), and cDNA was synthesized from 1 μg of RNA using 5 × RT Master Mix (TOYOBO, Osaka, JAPAN). Real-time PCR was performed using KOD SYBR qPCR Mix (TOYOBO) according to the manufacturer’s protocol. The following cycling conditions were used: 40 cycles of 95 °C for 15 s and 60 °C for 45 s. The expression of the target gene was normalized to that of the internal standard gene β-actin. The specific primer pairs used were as follows: fbn-1 (forward, 5′AAGGGGTTAATGTCATGATGT CAC-3′ reverse, 5′-CCACACAAGAACATAAAACCAAGG-3′), β-actin (forward, 5′-TCACAGGATGCAGAAGGAGA-3′ reverse, 5′-GCTGGAAGG TGGACAGTGAG -3′), collagen I (colI) (forward, 5′-ACGCCATCAAGGT CTACTGC-3′ reverse, 5′-GAATCCATCGGTCATGCTCT-3′), type 12 collagen (col XII) (forward, 5′-CTATTGTGGTGCCAGGGAAT-3′ reverse, 5′CCTT-GGTCCACTTCTTGGAA-3′), and mmp-9 (forward, 5′-TGAATCA GCTGGCTTTTGTG-3′ reverse, 5′-ACCTTCCAGTAGGGGCAACT-3′).
2.4. Histological and histochemical analysis Harvested tissues were fixed with 4% paraformaldehyde and decalcified with 20% formic acid and 10% citric acid for 3 days. Then, 5 μm sections were stained with hematoxylin and eosin. For the immunohistochemical analysis, the sections underwent antigen retrieval with 0.1% pepsin in 0.01 N hydrochloric acid before being incubated with primary antibodies at 4 °C overnight and secondary antibodies at RT for 1 h. The following primary antibodies were used: rabbit antiFibrillin-1 (gifted by Nakamura Tomoyuki, Kansai Medical University, Japan), goat anti-Collagen I (SouthernBiotech, Birmingham, AL, USA), rat anti-Ly6G (Abcam, Cambridge, UK), goat anti-MMP-9 (R&D, Minneapolis, MN, USA) and rabbit anti-TNF alpha (Abcam). The following secondary antibodies were used: Alexa Fluor 555 donkey antirabbit IgG (Life Technologies, Grand Island, NY, USA), donkey anti-rat IgG (Life Technologies) and donkey anti-goat IgG (Life Technologies). After antibody incubation, the nuclei were stained with Hoechst (Life Technologies). The samples were observed under a confocal laser scanning microscope (LSM510; Carl Zeiss, Oberkochen, Germany), and the fluorescence intensity was quantified by ImageJ. 2.5. Cell culture A dental mesenchymal cell line (m3cl-60) was maintained in a 1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s nutrient F12 medium (DMEM/F12; Sigma, St. Louis, MO, USA) containing 10% fetal bovine serum (Life Technologies), 31 μg/ml of penicillin, 50 μg/ml of streptomycin, 10 μg/ml of insulin and 10 μg/ml of transferrin (Sigma).
C57BL/6NCrSlc mice were purchased from Sankyo Labo Service Corporation (Tokyo, Japan), and fbn-1C1039G/+ mice were generously provided by Dr. Harry C. Dietz (Johns Hopkins University School of Medicine, USA). All experimental protocols were approved by Tohoku University and Tokyo University of Science Animal Care and Committee. 2.2. Experimental periodontal disease model The ligature-induced (LI) periodontal disease mouse model was generated by inserting silk ligatures (5–0) (Johnson and Johnson, New Brunswick, NJ, USA) into the lower and upper second molars of 6-weekold C57BL/6NcrSlC mice (WT) and fbn-1C1039G/+ mice (C1039G/+) under Nembutal-induced deep anesthesia. This process activated inflammatory responses against the increased presence of microbial biofilm and destruction of alveolar bone (Jin et al., 2007). Non-ligated molars served as controls (W/O). To investigate wound healing in the periodontal disease model, the mandibles were scanned using μCT (Morita, Kyoto, Japan).
3. Results 3.1. Spatiotemporal changes of LI We hypothesized that this LI model recapitulated not only the tissue destruction process but also the wound healing process (Eskan et al., 2012) 14 days after the placement of the ligature in WT (Fig. 1A). To analyze spatiotemporal changes in alveolar bone loss and regeneration in mandibles, periodontal disease model mice were scanned by μCT. The resultant μCT images showed that model mice exhibited progressive bone resorption after 3–14 days of ligation compared with control mice. By contrast, periodontal disease model mice exhibited
2.3. Quantification of alveolar bone loss For a quantitative three-dimensional (3-D) analysis of alveolar bone loss, the mandibles and maxillae were scanned using CT (Hitachi Aloka Medical). The 3-D views were constructed with the AVIZO imaging software program (Visualization Sciences Group, Burlington MA, USA). 54
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 1. Time course of ligature-induced periodontal disease mouse model (LI). A) Schematic of the experimental design. A ligature was placed to induce periodontal tissue destruction, and the ligatures were removed to observe wound healing. B) Representative μCT images of wild type mice (WT) with bone loss due to ligatures around mandibular molars; control WT mice (w/o; upper panel of B) and ligatured WT mice (ligature; lower panel). White arrows indicate bone loss. C) Tissues from WT mice with LI periodontal disease and control mice were stained with HE. The non-ligature WT mice group is shown in the upper panel (W/O), and the ligature WT mice group is shown in the middle panel. Immunohistochemical staining with anti-Ly6G antibody identified neutrophils (arrows) in the interradicular regions of the first mandibular molars of the ligature group (lower panel). Scale bar, 50 μm. D) ABC-CEJ distance in WT mice with ligature (Ligature) or without ligature (W/O) was assessed using an image analysis system (D). Box plots present the average (*P < 0.05, n = 4–8).
compared with days 3 and 7 after ligation (Fig. 1C lower panel). A quantitative analysis of alveolar bone resorption showed that the ABCCEJ length was ca. 150 μm on the day of ligature, which was similar to the values observed in control mice. However, 14 days after the ligature, the ABC-CEJ length increased to ca. 450 μm, and this length recovered to normal values 14 days after the removal of the ligature (Fig. 1D). These data indicate that tissue destruction occurred 3–14 days after the ligature was placed and that periodontal wound healing occurred 14 days after the removal of the ligature. Therefore, the LI model recapitulated the periodontal tissue destruction and wound healing associated with MFS.
bone regeneration 14 days after the removal of the ligature (Fig. 1B). A histological analysis of periodontal tissues was performed to assess ligature-induced periodontal tissue destruction and wound healing. The control mice showed ordered periodontal ligaments with a regular architecture and unchanged periodontal tissue structure at all time points. The periodontal tissues of ligatured mice showed irregularly oriented periodontal ligaments from days 3 to 14 and expanded capillary vessels associated with the infiltration of inflammatory cells on days 7 and 14. Fourteen days after the removal of the ligature, the periodontal ligament exhibited gradual wound healing and improvement in the expansion of capillary vessels (Fig. 1C, upper and lower panel). To reveal inflammatory cell infiltration, sections were stained with Ly6G, a marker of neutrophils. The infiltration of Ly6G-positive neutrophils increased in periodontal tissue at 3–7 days of ligation. However, this infiltration decreased 14 days after the removal of the ligature
55
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 2. Expression of FBN-1 during periodontal tissue destruction and wound healing in mice with LI periodontal disease. Immunohistochemical staining for mmp-9, tnf-α, fbn-1 and col I in WT mice with ligature (Ligature) or without ligature (W/O) at the indicated time points is shown. Scale bar, 50 μm.
3.2. Spatiotemporal expression of fibrillin-1 during tissue destruction and wound healing of LI
fibrils and microfibrils.
To investigate the involvement of FBN-1 in periodontal disease, we analyzed the spatiotemporal expression of this protein and compared the levels of inflammatory markers (mmp-9 and tnf-α) and colI in the aforementioned periodontal disease model. From 3 to 7 days after placing the ligature, markers of inflammation, such as mmp-9 and tnfα, were up-regulated in the upper alveolar region, the gingiva and the periodontal ligament compared with the control mice. Conversely, 14 days after the removal of the ligature, the expression levels of mmp9 and tnf-α recovered to control levels (Fig. 2). These data indicate that ligating periodontal tissue induced acute inflammatory tissue destruction and that the removal of the ligature reduced the inflammatory response. During the initial stage of tissue destruction, the expression of FBN-1 was strongly up-regulated in the periodontal ligament but recovered to normal levels as wound healing progressed. By contrast, colI, which is involved in the remodeling of the periodontal ligament, was down-regulated in this ligament during the tissue destruction process but recovered to normal levels after 28 days of wound healing (Fig. 2). These results suggested that FBN-1 expression was induced from the initial stage of tissue destruction until the initial stage of wound healing and that the reorganization of colI is associated with wound healing in periodontal tissue. In summary, LI model mice experienced inflammatory tissue destruction from days 3 to 7, and the removal of the ligature resulted in wound healing, which was associated with the reorganization of the extracellular matrix network, including collagen
3.3. Effects of MFS on the progression and regeneration of periodontal tissue We next investigated the effect of LI periodontal disease on MFS. To this end, we used C1039G/+ mice, which were generated by knocking in the FBN-1 mutation found in MFS patients (Habashi et al., 2006). Fourteen days after ligature, the ABC-CEJ lengths in C1039G/+ mice and WT mice did not differ (Fig. 3A). Moreover, a histological analysis showed the destruction of periodontal ligament architecture and expanded capillary vessels in C1039G/+ mice and WT mice (Fig. 3B). These data suggest that fbn-1 insufficiency did not affect the progression of periodontal tissue destruction. We next investigated the effect of C1039G/+ mice on periodontal wound healing. To this end, the ABCCEJ length was measured 14 days after the removal of the ligature. The ABC-CEJ length was longer in C1039G/+ mice than in WT mice, indicating that bone regeneration was delayed in C1039G/+ mice (Fig. 3C). HE staining of periodontal tissue from C1039G/+ mice 14 days after the removal of the ligature showed an increase in expanded capillary vessels compared with WT mice (Fig. 3D). The expression levels of tnf-α, mmp-9, fbn-1 and colI were examined 14 days after the removal of the ligature to investigate the effect of the fbn-1 mutation on inflammation and wound healing. Specifically, tnf-α and mmp-9 were up-regulated in the gingiva and periodontal ligament of C1039G/+ mice compared with WT mice. The expression of fbn-1 in the periodontal ligament did not differ between C1039G/+ mice and WT mice. By contrast, the expression of colI was reduced in 56
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 3. Delayed wound healing due to periodontitis in MFS mice. ABC-CEJ distance (A) and HE staining (B) of MFS mice (C1039G/+) or WT mice (+/+) (n = 4–8) 14 days after the placement of the ligature. ABC-CEJ distance (C) and HE staining (D) of MFS mice (C1039G/+) or WT mice (+/+) (n = 4–8) 14 days after the removal of the ligature. Box plots present the average (*P < 0.05, n = 3–5). Closed circles and boxes indicate C1039G/+ or WT mice, respectively. Scale bar, 50 μm.
infiltration and reduced type I collagen fibril reorganization compared with WT mice. These data suggest that an abnormal immune response that includes persistent tnf-α signaling slowed periodontal wound healing in C1039G/+ mice. In periodontal tissue, the activation of tnf-α is known to stimulate the degradation of connective tissue matrix by inducing the release of mmps (Judge et al., 2004). In addition, an increase in mmp-1 and a reduction in TIMP-1 in gingival crevicular fluid were identified in subjects with periodontitis compared to healthy subjects, and these changes were improved after treatment (Popat, Bhavsar, & Popat, 2014). Recent findings revealed that the local administration of Del-1, an inhibitor of neutrophil adhesion, inhibited inhibit IL-17 production and bone loss in a periodontal disease model (Eskan et al., 2012). Moreover, the inhibition of Sost, a Wnt inhibitor that reduced bone loss by decreasing ECM production in osteocytes, is critical to promote periodontal tissue regeneration (Bonnet et al., 2009). In addition, periodontal bone loss occurred through the inhibition of bone formation owing to the effect of inflammatory cytokines and the role of osteoblast lineage cells in periodontal bone resorption (Pacios et al., 2012). These data suggest that the inhibition of cytokine activity and production of ECMs are critical for preventing periodontal disease. In this study, we suggested that imperfect wound healing occurred in LI in the MFS mouse model, although no effect of tissue destruction was observed compared with WT mice. Since fibrillin-1 and fibrillin-2 have been shown to support osteoblast maturation and bone formation by
the periodontal ligament of C1039G/+ mice (Fig. 4A). A quantitative analysis of immunofluorescence showed that the mmp-9 and tnf-α expression levels were higher in C1039G/+ mice than in WT mice (Fig. 4B). By contrast, fbn-1 expression was similar in mutant and WT mice, whereas the expression of COLI was lower in mutant mice than in WT mice (Fig. 4C). These results suggested that inflammatory tissue destruction persisted in the periodontal tissue of C1039G/+ mice after the removal of the ligature, which delayed wound healing and resulted in the reorganization of the ECM network. To investigate the mechanisms underlying this delayed wound healing, m3Cl-60 dental mesenchymal cells were treated with tnf-α, and the expression levels of mmp-9, differentiation markers of the periodontal ligament such as colXII and colI, and fbn-1 were quantified by real-time PCR. Treatment with tnf-α up-regulated the expression of mmp-9 but down-regulated the levels of colXII. By contrast, tnf-α did not affect the expression of colI (Fig. 4D). Fbn-1 expression was down-regulated by stimulation with tnf-α. 4. Discussion In the present study, LI periodontal disease was shown to be suitable for investigations of inflammatory tissue destruction and wound healing (Eskan et al., 2012). Specifically, C1039G/+ mice with LI periodontal disease exhibited delayed wound healing associated with the sustained expression of tnf-α and mmp-9, inflammatory cell 57
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 4. The inflammatory state induced by the ligature persisted in MFS mice. A) Immunohistochemical staining for mmp-9, tnf-α, fbn-1 and colI in control (+/+) and ligature mice (C1039G/+) 14 days after the removal of the ligature. Scale bar, 50 μm. B) Quantitative analysis of fluorescence intensity for mmp-9 and tnf-α staining. The mean value of the WT group was defined as 100%. C) Quantitative analysis of fluorescence intensity for fbn-1 and colI staining. The mean value of the WT group was defined as 100%. D) Quantitative PCR analysis of mmp-9, col XII, col I and fbn-1 mRNA expression in dental mesenchymal cell lines treated with Tnf-α (10 ng/ml) or PBS as a control. Each sample was assessed in triplicate. (*P < 0.05). The mean value for the control was defined as 1.
destruction in a mouse model of MFS, suggesting that the pathological activation of TGF-β is involved in the onset of periodontal disease (Suda et al., 2013). The osteogenic differentiation of MFS-derived iPS cells was also inhibited by the activation of TGF-β signaling (Quarto, Li, Renda, & Longaker, 2012). Based on these results, TGF-β has been suggested to be responsible for the failure of connective tissue to regenerate in a mouse model of MFS. Nevertheless, a recent study uncovered a more complex mechanism by which TGF-β signaling
controlling local TGF-β and BMP bioavailability (Nistala, 2010), the impairment of osteoblast function due to fibrillin-1 insufficiency may be the cause of delayed wound healing in MFS model mice. Previous studies reported abnormal skeletal muscle in C1039G/+ mice and individuals with MFS, and the administration of angiotensin II receptor blockers (ARB), which down-regulate TGF-β signaling and normalize muscle architecture, repair and function in vivo (Cohn et al., 2007). Treatment with ARB also improved periodontal tissue 58
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
and Tokyo University of Science Animal Care and Committee.
promotes aneurysm formation in a mouse model of MFS. Specifically, the activation of the MAP kinase cascade, including p38 and ERK1/2, or blocking the TGF-β type II receptor in smooth muscle cells accelerated aneurysm formation in a mouse model of MFS (Holm et al., 2011; Li et al., 2014; Quarto et al., 2012; Yoshimura et al., 2005). Furthermore, the rate of aortic root dilatation in MFS patients did not significantly differ between groups treated with losartan and atenolol, a beta blocker agent (Lacro et al., 2014). These reports suggest that not only TGF-β signaling but also other factors activate the signaling pathway in MFS, and connective tissue disorder is observed. Similarly, TGF-β signaling is also involved in the progression of periodontal disease in MFS model mice (Suda et al., 2013). In the present study, we showed that periodontal tissue destruction in the MFS model was similar to that in WT mice, but MFS model mice exhibit lower wound healing ability than do WT mice due to the sustained expression of tnf-α and mmp-9. Based on these findings, we propose that wound-healing ability was reduced in the MFS model, and this might be involved in the continuous destruction of connective tissue disease, including periodontal disease. Previous findings suggested that MFS mice are susceptible to P. gingivalis infection, which up-regulates tnf-α and IL-17 production, subsequently increasing bone resorption (Suda et al., 2013). TNF-α plays a critical role in tissue destruction and is expressed by neutrophils, which reflect early-stage inflammation in various diseases. TNF-α induces osteoclast formation directly by a TRAF3-dependent mechanism (Yao, Xing, & Boyce, 2009) and indirectly through stimulation of RANKL expression by osteoblastic, synovial, and immune cells. In periodontitis, the mouse ligature model showed strong TNF-α expression in the initial stage. Enhanced TNF-α expression in the periodontal tissue may contribute to increased levels of serum TNF-α (Ekuni et al., 2010). TNF-α is produced by numerous immune and nonimmune cells, including macrophages, B cells, and periodontal ligament cells. The high production of cytokines may in turn induce the expression of MMP-9 (Kothari et al., 2014), leading to the degradation of extracellular matrix components and subsequent destruction of periodontal tissues (Yamaguchi & Kasai, 2005). C-Jun n-terminal kinase, which is activated by tnf-α, has been shown to promote abnormal ECM metabolism, characterized by elevated mmp production and a reduction in ECM proteins such as collagen (Yoshimura et al., 2005). On the other hand, in diabetes, inflammation and osteoclastogenesis are prolonged in periodontitis and, via TNF, limit the normal repair process by negatively modulating factors that regulate bone (Pacios et al., 2012). This phenomenon could accelerate connective tissue destruction in various connective tissue diseases, including aortic aneurysm and dissection, suggesting that similar events occurred in the C1039G/+ mice with LI periodontal disease. In the present study, we showed that tnf-α inhibited the expression of collagen XII and fbn-1 but induced the expression of mmp-9. The reasons underlying the lack of fbn-1 expression after the removal of the ligature were not investigated, but this lack of expression may be due to the maintenance of an inflammatory response because fbn-1 expression was markedly up-regulated during the early stage of periodontal disease in this model. Previous findings and the results of this study indicated that in addition to the activation of TGF-β signaling, tnf-α signaling may contribute to slowed wound healing in the periodontal tissue of MFS mice. In conclusion, MFS mice with LI periodontal disease experience delayed wound healing, which was attributed to tnf-α stimulation. Thus, inhibiting tnf-α signaling to impair wound healing may serve as a novel therapy for the treatment of periodontal disease in MFS patients.
Acknowledgments We thank Drs. Harry Dietz, Tomoyuki Nakamura, Masamitsu Oshima, and Takashi Tsuji for their valuable advice and discussions during this work. This work was supported by JSPS KAKENHI Grant-inAid for Scientific Research(C) Number JP15K11104. References Bonnet, N., Standley, K. N., Bianchi, E. N., Stadelmann, V., Foti, M., Conway, S. J., et al. (2009). The matricellular protein periostin is required for sost inhibition and the anabolic response to mechanical loading and physical activity. Journal of Biological Chemistry, 284(51), 35939–35950. Brooke, B. S., Habashi, J. P., Judge, D. P., Patel, N., Loeys, B., & Dietz, H. C. (2008). Angiotensin II blockade and aortic-root dilation in Marfan’s syndrome? The New England Journal of Medicine, 358(26), 2787–2795. Chung, A. W., Au Yeung, K., Sandor, G. G., Judge, D. P., Dietz, H. C., & van Breemen, C. (2007). Loss of elastic fiber integrity and reduction of vascular smooth muscle contraction resulting from the upregulated activities of matrix metalloproteinase-2 and -9 in the thoracic aortic aneurysm in Marfan syndrome. Circulation Research, 101, 512–522. Cohn, R. D., Erp, C., Habashi, J. P., Soleimani, A. A., Klein, E. C., Lisi, E. T., et al. (2007). Angiotensin II type 1 receptor blockade attenuates TGF-beta-induced failure of muscle regeneration in multiple myopathic states? Nature Medicine, 13(2), 204–210. Dietz, H. C., Cutting, C. R., Pyeritz, R. E., Msalen, C. L., Sakai, L. Y., Corson, G. M., et al. (1991). Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene. Nature, 352, 337–339. Ekuni, D., Tomofuji, T., Irie, K., Kasuyama, K., Umakoshi, M., Azuma, T., et al. (2010). Effects of periodontitis on aortic insulin resistance in an obese rat model? Laboratory Investigation, 90(3), 348–359. Eskan, M. A., Jotwani, R., Abe, T., Chmelar, J., Lim, J., Liang, S., et al. (2012). The leukocyte integrin antagonist Del-1 inhibits IL-17-mediated inflammatory bone loss. Nature Immunology, 13(5), 465–473. Garlet, G. P. (2010). Destructive and protective roles of cytokines in periodontitis: A reappraisal from host defense and tissue destruction viewpoints. Journal of Dental Research, 89(12), 1349–1363. Habashi, J. P., Judge, D. P., Holm, T. M., Cohn, R. D., Loeys, B. L., Cooper, T. K., et al. (2006). Losartan, an AT1 antagonist, prevents aortic aneurysm in a mouse model of Marfan syndrome. Science, 312(5770), 117–121. Holm, T. M., Habashi, J. P., Doyle, J. J., Bedja, D., Chen, Y., Erp, C., et al. (2011). Noncanonical TGFβ signaling contributes to aortic aneurysm progression in Marfan syndrome mice. Science, 332(6027), 358–361. Jin, Q., Cirelli, J. A., Park, C. H., Sugai, J. V., Taba, M., Jr., & Kostenuik, P. J. (2007). RANKL inhibition through osteoprotegerin blocks bone loss in experimental periodontitis. Journal of Periodontology, 78(7), 1300–1308. Ju, X., Ijaz, T., Sun, H., LeJeune, W., Vargas, G., Shilagard, T., et al. (2014). IL-6 regulates extracellular matrix remodeling associated with aortic dilation in a fibrillin-1 hypomorphic mgR/mgR mouse model of severe Marfan syndrome? Journal of the American Heart Association, 3(1), 1–13. Judge, D. P., & Dietz, H. C. (2005). Marfan’s syndrome. Lancet, 366, 1965–1976. Judge, D. P., Biery, N. J., Keene, D. R., Geubtner, J., Myers, L., Huso, D. L., et al. (2004). Evidence for a critical contribution of haploinsufficiency in the complex pathogenesis of Marfan syndrome. Journal of Clinical Investigation, 114(2), 172–181 11. Kielty, C. M., Sherratt, M. J., & Shuttleworth, C. A. (2002). Elastic fibres. Journal of Cell Science, 115, 2817–2828. Kinney, J. S., Ramseier, C. A., & Giannobile, W. V. (2007). Oral fluid-based biomarkers of alveolar bone loss in periodontitis. Annals of the New York Academy of Sciences, 1098, 230–251. Kothari, P., Pestana, R., Mesraoua, R., Elchaki, R., Khan, K. M. F., Dannenberg, A. J., et al. (2014). IL-6-mediated induction of matrix metalloproteinase-9 is modulated by JAKdependent IL-10 expression in macropgagesIL-10 expression in macrophages. Journal of Immunology, 192(1), 349–357. Lacro, R. V., Dietz, H. C., Sleeper, L. A., Yetman, A. T., Bradley, T. J., Colan, S. D., et al. (2014). Atenolol versus losartan in children and young adults with Marfan’s syndrome. The New England Journal of Medicine, 371(22), 2061–2071. Li, W., Li, Q., Jiao, Y., Qin, L., Ali, R., Zhou, J., et al. (2014). Tgfbr2 disruption in postnatal smooth muscle impairs aortic wall homeostasis. Journal of Clinical Investigation, 124(2), 755–767. Milewicz, D. M., Dietz, H. C., & Miller, D. C. (2005). Treatment of aortic disease in patients with Marfan syndrome. Circulation, 111(11), e150–e157. Neptune, E. R., Frischmeyer, P. A., Arking, D. E., Myers, L., Bunton, T. E., Gayraud, B., et al. (2003). Dysregulation of TGF-beta activation contributes to pathogenesis in Marfan syndrome. Nature Genetics, 33, 407–411. Nistala, H. (2010). Fibrillin-1 and -2 differentially modulate endogenous TGF-β and BMP bioavailability during bone formation. The Journal of Cell Biology, 190(6), 1107–1121. Noda, K., Dabovic, B., Takagi, K., Inoue, T., Horiguchi, M., Hirai, M., et al. (2013). Latent TGF-β binding protein 4 promotes elastic fiber assembly by interacting with fibulin-5. Proceedings of the National Academy of Sciences of the United States of America, 110(8), 2852–2857.
Conflict of interests There are no conflicts of interest. Ethical approval All experimental protocols were approved by Tohoku University 59
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Characteristic phenotype of immortalized periodontal cells isolated from a Marfan syndrome type I patient. Cell and Tissue Research, 331(2), 461–472. Shores, J., Berger, K. R., Murphy, E. A., & Pyeritz, R. E. (1994). Progression of aortic dilatation and the benefit of long-term beta-adrenergic blockade in Marfan’s syndrome? The New England Journal of Medicine, 330(19), 1335–1341. Straub, A. M., Grahame, R., Scully, C., & Tonetti, M. S. (2002). Severe periodontitis in Marfan’s syndrome: A case report? Journal of Periodontology, 73(7), 823–826. Suda, N., Moriyama, K., & Ganburged, G. (2013). Effect of angiotensin II receptor blocker on experimental periodontitis in a mouse model of Marfan syndrome? Infection and Immunity, 81(1), 182–188. Yamaguchi, M., & Kasai, K. (2005). Inflammation in periodontal tissues in response to mechanical forces. Archivum Immunologiae et Therapiae Experimentalis, 53(5), 388–398. Yao, Z., Xing, L., & Boyce, B. F. (2009). NF-kappaB p100 limits TNF-induced bone resorption in mice by a TRAF3-dependent mechanism? Journal of Clinical Investigation, 119(10), 3024–3034. Yoshimura, K., Aoki, H., Ikeda, Y., Fujii, K., Akiyama, N., Furutani, A., et al. (2005). Regression of abdominal aortic aneurysm by inhibition of c-Jun N-terminal kinase. Nature Medicine, 11(12), 1330–1338.
Pacios, S., Kang, J., Galicia, J., Gluck, K., Patel, H., Ovaydi-Mandel, A., et al. (2012). Diabetes aggravates periodontitis by limiting repair through enhanced inflammation? FASEB Journal, 26(4), 1423–1430. Popat, R. P., Bhavsar, N. V., & Popat, P. R. (2014). Gingival crevicular fluid levels of Matrix Metalloproteinase-1 (mmp-1) and Tissue Inhibitor of Metalloproteinase-1 (TIMP-1) in periodontal health and disease. Singapore Dental Journal, 35, 59–64. Quarto, N., Li, S., Renda, A., & Longaker, M. T. (2012). Exogenous activation of BMP-2 signaling overcomes TGFβ-mediated inhibition of osteogenesis in Marfan embryonic stem cells and Marfan patient-specific induced pluripotent stem cells. Stem Cells, 30(12), 2709–2719. Ramirez, F., & Sakai, L. Y. (2010). Biogenesis and function of fibrillin assemblies. Cell and Tissue Research, 339(1), 71–82. Saito, M., & Tsuji, T. (2012). Extracellular matrix administration as a potential therapeutic strategy for periodontal ligament regeneration? Expert Opinion on Biological Therapy, 12(3), 299–309. Sakai, L. Y., Keene, D. R., & Engvall, E. (1986). Fibrillin, a new 350-kD glycoprotein, is a component of extracellular microfibrils. The Journal of Cell Biology, 103(6 Pt 1), 2499–2509. Shiga, M., Saito, M., Hattori, M., Torii, C., Kosaki, K., Kiyono, T., et al. (2008).
60
Contents lists available at ScienceDirect
Archives of Oral Biology journal homepage: www.elsevier.com/locate/archoralbio
Fibrillin-1 insufficiency alters periodontal wound healing failure in a mouse model of Marfan syndrome
T
Keisuke Handaa, Syouta Abeb, V. Venkata Suresha, Yoshiyasu Fujiedab, Masaki Ishikawaa, Ai Orimotoa, Yoko Kobayashia, Satoru Yamadac, Satoko Yamabac, Shinya Murakamic, ⁎ Masahiro Saitoa, a
Division of Operative Dentistry, Department of Restorative Dentistry, Tohoku University Graduate School of Dentistry, Sendai, Miyagi, Japan Faculty of Industrial Science and Technology, Tokyo University of Science, Katsushika, Japan c Department of Periodontology and Oral Pathology, Osaka University Graduate School of Dentistry, Suita, Osaka, Japan b
A R T I C LE I N FO
A B S T R A C T
Keywords: Fibrillin-1 Marfan syndrome Periodontal disease Ligature-induced periodontal disease mouse model (LI)
Objective: Marfan syndrome (MFS) is a systemic connective tissue disorder caused by insufficient fibrillin-1 (FBN-1), a major component of microfibrils that controls the elasticity and integrity of connective tissues. FBN-1 insufficiency in MFS leads to structural weakness, which causes various tissue disorders, including cardiovascular and periodontal disease. However, the role of FBN-1 insufficiency in the destruction and regeneration of connective tissue has not yet been clarified. To investigate the role of FBN-1 insufficiency in tissue destruction and regeneration. Design: We used a ligature-induced (LI) periodontal disease model in fbn-1-deficient mice (fbn-1c1039G/+ mice) with MFS and investigated the regeneration level of periodontal tissue and as an inflamatic marker, the expression of the matrix metalloproteinase (mmp)-9 and tumor necrosis factor (tnf)-α. Results: Interestingly, fbn-1c1039G/+ mice exhibited slowed wound healing compared with wild type mice, but periodontal tissue destruction did not differ between these mice. Moreover, fbn-1c1039G/+ mice exhibited delayed bone healing in association with continuous mmp-9 and tnf-α expression. Furthermore, inflammatory cells were obvious even after the removal of ligatures. Conclusion: These data suggest that fibrillin-1 insufficiency in fbn-1c1039G/+ mice interfered with wound healing in connective tissue damaged by inflammatory diseases such as periodontal disease.
1. Introduction Marfan syndrome (MFS) is an autosomal dominant disorder of connective tissue that affects approximately 1 in 5000 people (Judge & Dietz, 2005). MFS is caused by missense mutations of FIBRILLIN-1 (FBN-1) (Dietz et al., 1991), a component of extracellular microfibrils, leading to a systemic disorder of connective tissues, including aortic aneurysms and dissection, ocular lens dislocation, emphysema, bone overgrowth and severe periodontal disease (Judge & Dietz, 2005; Straub, Grahame, Scully, & Tonetti, 2002). FBN-1 is a 350-kDa glycoprotein (Sakai, Keene, & Engvall, 1986) that consists of three functional FBN-1-1 genes (FBN-1, -2, and -3) and exhibits superimposable modular structures consisting of 46/47 epidermal growth factor (EGF)-like domains (Kielty, Sherratt, & Shuttleworth, 2002). FBN-1 is a major insoluble extracellular matrix component in connective tissue microfibrils
and limits tissue elasticity via fibrillin-1 microfibril formation (Noda et al., 2013). Fibrillin-rich microfibrils contribute to the extracellular regulation of endogenous transforming growth factor-β (TGF-β) activity by providing a structural platform, i.e., latent TGF-β-binding proteins (LTBPs) (Ramirez & Sakai, 2010). FBN-1 haploinsufficiency impairs tissue integrity and dysregulates TGF-β activation and signaling, resulting in the up-regulation of tissue destruction-related genes such as mmp-9 (Chung et al., 2007; Neptune et al., 2003). Anti-TGF-β therapy is being studied as a general therapy to delay or prevent tissue destruction in MFS patients. Treatment with losartan, an angiotensin II type I receptor blocker that can attenuate TGF-β signaling, in a mouse model of MFS prevented aortic root growth by suppressing elastic fiber fragmentation. Losartan treatment also decreased the rate of aortic root dilation in children with MFS (Brooke et al., 2008). The activation of IL-6-STAT3 signaling has also been shown to
⁎ Corresponding author at: Tohoku University, Graduate School of Dentistry, Division of Operative Dentistry, Department of Restorative Dentistry, 4-1 Seiryo-machi, Aoba-ku, 9808575 Sendai, Japan. E-mail address: [email protected] (M. Saito).
https://doi.org/10.1016/j.archoralbio.2018.02.017 Received 26 July 2017; Received in revised form 26 February 2018; Accepted 27 February 2018 0003-9969/ © 2018 Published by Elsevier Ltd.
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
contribute to aneurysmal dilation in the mgR/mgR hypomorphic fibrillin-deficient mouse model via increased mmp-9 activity, which results in collagen fibril degradation (Ju et al., 2014). These findings suggested that long-term disease progression in MFS is caused by a pathogenic immune response that interferes with tissue remodeling and repair after injury. Administration of β-adrenergic receptor or angiotensin II receptor blocker type 1 antagonist and precise surgical treatment are important for the treatment of MFS (Milewicz, Dietz, & Miller, 2005; Shores, Berger, Murphy, & Pyeritz, 1994), but wound healing in destroyed connective tissue and damaged tissue is not improved. Thus, clarifying the role of FBN-1 insufficiency in the inflammatory destruction and regeneration of connective tissue is important (Saito & Tsuji, 2012). In untreated patients, periodontal disease results in soft tissue destruction and progressive bone destruction, which lead to tooth mobility and subsequent tooth loss (Kinney, Ramseier, & Giannobile, 2007; Suda, Moriyama, & Ganburged, 2013). Periodontal disease is caused by a bacterial infection that activates the innate immune response via Tolllike receptors, resulting in the up-regulation of innate immunity cytokines such as tnf-α, IL-1, and IL-6 to ultimately result in progressive tissue destruction (Garlet, 2010). MFS has been shown to increase the susceptibility to severe periodontal disease in association with periodontal ligament dysfunction due to microfibril insufficiency, suggesting that FBN-1 microfibril formation plays a central role in periodontal ligament formation (Shiga et al., 2008; Straub et al., 2002). Notably, the elastic fibers of the periodontal ligament, known as oxytalan fibers, primarily consist of FBN-1 microfibrils and do not contain significant amounts of elastin. Therefore, the periodontal ligament is likely more susceptible than other connective tissues to breakdown in the MFS mouse model. Thus, periodontal disease is a useful model to assess the effect of MFS on inflammatory tissue destruction. In this study, inflammatory tissue destruction and wound healing were investigated in a periodontal disease model, fbn-1C1039G/+ mice, to elucidate the effect of FBN-1 insufficiency on the progression of periodontal disease.
Alveolar bone loss was analyzed by measuring the distance from the lingual cemento-enamel junction (CEJ) of the second molar to the lingual-mesial root to the lingual alveolar bone crest (ABC) parallel to the sagittal plane. The distance from the CEJ to the ABC (ABC-CEJ) was used to quantify bone resorption.
2. Materials and methods
2.6. Gene expression
2.1. Animals
RNA was isolated using Isogen (Nippon Gene, Tokyo, Japan), and cDNA was synthesized from 1 μg of RNA using 5 × RT Master Mix (TOYOBO, Osaka, JAPAN). Real-time PCR was performed using KOD SYBR qPCR Mix (TOYOBO) according to the manufacturer’s protocol. The following cycling conditions were used: 40 cycles of 95 °C for 15 s and 60 °C for 45 s. The expression of the target gene was normalized to that of the internal standard gene β-actin. The specific primer pairs used were as follows: fbn-1 (forward, 5′AAGGGGTTAATGTCATGATGT CAC-3′ reverse, 5′-CCACACAAGAACATAAAACCAAGG-3′), β-actin (forward, 5′-TCACAGGATGCAGAAGGAGA-3′ reverse, 5′-GCTGGAAGG TGGACAGTGAG -3′), collagen I (colI) (forward, 5′-ACGCCATCAAGGT CTACTGC-3′ reverse, 5′-GAATCCATCGGTCATGCTCT-3′), type 12 collagen (col XII) (forward, 5′-CTATTGTGGTGCCAGGGAAT-3′ reverse, 5′CCTT-GGTCCACTTCTTGGAA-3′), and mmp-9 (forward, 5′-TGAATCA GCTGGCTTTTGTG-3′ reverse, 5′-ACCTTCCAGTAGGGGCAACT-3′).
2.4. Histological and histochemical analysis Harvested tissues were fixed with 4% paraformaldehyde and decalcified with 20% formic acid and 10% citric acid for 3 days. Then, 5 μm sections were stained with hematoxylin and eosin. For the immunohistochemical analysis, the sections underwent antigen retrieval with 0.1% pepsin in 0.01 N hydrochloric acid before being incubated with primary antibodies at 4 °C overnight and secondary antibodies at RT for 1 h. The following primary antibodies were used: rabbit antiFibrillin-1 (gifted by Nakamura Tomoyuki, Kansai Medical University, Japan), goat anti-Collagen I (SouthernBiotech, Birmingham, AL, USA), rat anti-Ly6G (Abcam, Cambridge, UK), goat anti-MMP-9 (R&D, Minneapolis, MN, USA) and rabbit anti-TNF alpha (Abcam). The following secondary antibodies were used: Alexa Fluor 555 donkey antirabbit IgG (Life Technologies, Grand Island, NY, USA), donkey anti-rat IgG (Life Technologies) and donkey anti-goat IgG (Life Technologies). After antibody incubation, the nuclei were stained with Hoechst (Life Technologies). The samples were observed under a confocal laser scanning microscope (LSM510; Carl Zeiss, Oberkochen, Germany), and the fluorescence intensity was quantified by ImageJ. 2.5. Cell culture A dental mesenchymal cell line (m3cl-60) was maintained in a 1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s nutrient F12 medium (DMEM/F12; Sigma, St. Louis, MO, USA) containing 10% fetal bovine serum (Life Technologies), 31 μg/ml of penicillin, 50 μg/ml of streptomycin, 10 μg/ml of insulin and 10 μg/ml of transferrin (Sigma).
C57BL/6NCrSlc mice were purchased from Sankyo Labo Service Corporation (Tokyo, Japan), and fbn-1C1039G/+ mice were generously provided by Dr. Harry C. Dietz (Johns Hopkins University School of Medicine, USA). All experimental protocols were approved by Tohoku University and Tokyo University of Science Animal Care and Committee. 2.2. Experimental periodontal disease model The ligature-induced (LI) periodontal disease mouse model was generated by inserting silk ligatures (5–0) (Johnson and Johnson, New Brunswick, NJ, USA) into the lower and upper second molars of 6-weekold C57BL/6NcrSlC mice (WT) and fbn-1C1039G/+ mice (C1039G/+) under Nembutal-induced deep anesthesia. This process activated inflammatory responses against the increased presence of microbial biofilm and destruction of alveolar bone (Jin et al., 2007). Non-ligated molars served as controls (W/O). To investigate wound healing in the periodontal disease model, the mandibles were scanned using μCT (Morita, Kyoto, Japan).
3. Results 3.1. Spatiotemporal changes of LI We hypothesized that this LI model recapitulated not only the tissue destruction process but also the wound healing process (Eskan et al., 2012) 14 days after the placement of the ligature in WT (Fig. 1A). To analyze spatiotemporal changes in alveolar bone loss and regeneration in mandibles, periodontal disease model mice were scanned by μCT. The resultant μCT images showed that model mice exhibited progressive bone resorption after 3–14 days of ligation compared with control mice. By contrast, periodontal disease model mice exhibited
2.3. Quantification of alveolar bone loss For a quantitative three-dimensional (3-D) analysis of alveolar bone loss, the mandibles and maxillae were scanned using CT (Hitachi Aloka Medical). The 3-D views were constructed with the AVIZO imaging software program (Visualization Sciences Group, Burlington MA, USA). 54
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 1. Time course of ligature-induced periodontal disease mouse model (LI). A) Schematic of the experimental design. A ligature was placed to induce periodontal tissue destruction, and the ligatures were removed to observe wound healing. B) Representative μCT images of wild type mice (WT) with bone loss due to ligatures around mandibular molars; control WT mice (w/o; upper panel of B) and ligatured WT mice (ligature; lower panel). White arrows indicate bone loss. C) Tissues from WT mice with LI periodontal disease and control mice were stained with HE. The non-ligature WT mice group is shown in the upper panel (W/O), and the ligature WT mice group is shown in the middle panel. Immunohistochemical staining with anti-Ly6G antibody identified neutrophils (arrows) in the interradicular regions of the first mandibular molars of the ligature group (lower panel). Scale bar, 50 μm. D) ABC-CEJ distance in WT mice with ligature (Ligature) or without ligature (W/O) was assessed using an image analysis system (D). Box plots present the average (*P < 0.05, n = 4–8).
compared with days 3 and 7 after ligation (Fig. 1C lower panel). A quantitative analysis of alveolar bone resorption showed that the ABCCEJ length was ca. 150 μm on the day of ligature, which was similar to the values observed in control mice. However, 14 days after the ligature, the ABC-CEJ length increased to ca. 450 μm, and this length recovered to normal values 14 days after the removal of the ligature (Fig. 1D). These data indicate that tissue destruction occurred 3–14 days after the ligature was placed and that periodontal wound healing occurred 14 days after the removal of the ligature. Therefore, the LI model recapitulated the periodontal tissue destruction and wound healing associated with MFS.
bone regeneration 14 days after the removal of the ligature (Fig. 1B). A histological analysis of periodontal tissues was performed to assess ligature-induced periodontal tissue destruction and wound healing. The control mice showed ordered periodontal ligaments with a regular architecture and unchanged periodontal tissue structure at all time points. The periodontal tissues of ligatured mice showed irregularly oriented periodontal ligaments from days 3 to 14 and expanded capillary vessels associated with the infiltration of inflammatory cells on days 7 and 14. Fourteen days after the removal of the ligature, the periodontal ligament exhibited gradual wound healing and improvement in the expansion of capillary vessels (Fig. 1C, upper and lower panel). To reveal inflammatory cell infiltration, sections were stained with Ly6G, a marker of neutrophils. The infiltration of Ly6G-positive neutrophils increased in periodontal tissue at 3–7 days of ligation. However, this infiltration decreased 14 days after the removal of the ligature
55
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 2. Expression of FBN-1 during periodontal tissue destruction and wound healing in mice with LI periodontal disease. Immunohistochemical staining for mmp-9, tnf-α, fbn-1 and col I in WT mice with ligature (Ligature) or without ligature (W/O) at the indicated time points is shown. Scale bar, 50 μm.
3.2. Spatiotemporal expression of fibrillin-1 during tissue destruction and wound healing of LI
fibrils and microfibrils.
To investigate the involvement of FBN-1 in periodontal disease, we analyzed the spatiotemporal expression of this protein and compared the levels of inflammatory markers (mmp-9 and tnf-α) and colI in the aforementioned periodontal disease model. From 3 to 7 days after placing the ligature, markers of inflammation, such as mmp-9 and tnfα, were up-regulated in the upper alveolar region, the gingiva and the periodontal ligament compared with the control mice. Conversely, 14 days after the removal of the ligature, the expression levels of mmp9 and tnf-α recovered to control levels (Fig. 2). These data indicate that ligating periodontal tissue induced acute inflammatory tissue destruction and that the removal of the ligature reduced the inflammatory response. During the initial stage of tissue destruction, the expression of FBN-1 was strongly up-regulated in the periodontal ligament but recovered to normal levels as wound healing progressed. By contrast, colI, which is involved in the remodeling of the periodontal ligament, was down-regulated in this ligament during the tissue destruction process but recovered to normal levels after 28 days of wound healing (Fig. 2). These results suggested that FBN-1 expression was induced from the initial stage of tissue destruction until the initial stage of wound healing and that the reorganization of colI is associated with wound healing in periodontal tissue. In summary, LI model mice experienced inflammatory tissue destruction from days 3 to 7, and the removal of the ligature resulted in wound healing, which was associated with the reorganization of the extracellular matrix network, including collagen
3.3. Effects of MFS on the progression and regeneration of periodontal tissue We next investigated the effect of LI periodontal disease on MFS. To this end, we used C1039G/+ mice, which were generated by knocking in the FBN-1 mutation found in MFS patients (Habashi et al., 2006). Fourteen days after ligature, the ABC-CEJ lengths in C1039G/+ mice and WT mice did not differ (Fig. 3A). Moreover, a histological analysis showed the destruction of periodontal ligament architecture and expanded capillary vessels in C1039G/+ mice and WT mice (Fig. 3B). These data suggest that fbn-1 insufficiency did not affect the progression of periodontal tissue destruction. We next investigated the effect of C1039G/+ mice on periodontal wound healing. To this end, the ABCCEJ length was measured 14 days after the removal of the ligature. The ABC-CEJ length was longer in C1039G/+ mice than in WT mice, indicating that bone regeneration was delayed in C1039G/+ mice (Fig. 3C). HE staining of periodontal tissue from C1039G/+ mice 14 days after the removal of the ligature showed an increase in expanded capillary vessels compared with WT mice (Fig. 3D). The expression levels of tnf-α, mmp-9, fbn-1 and colI were examined 14 days after the removal of the ligature to investigate the effect of the fbn-1 mutation on inflammation and wound healing. Specifically, tnf-α and mmp-9 were up-regulated in the gingiva and periodontal ligament of C1039G/+ mice compared with WT mice. The expression of fbn-1 in the periodontal ligament did not differ between C1039G/+ mice and WT mice. By contrast, the expression of colI was reduced in 56
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 3. Delayed wound healing due to periodontitis in MFS mice. ABC-CEJ distance (A) and HE staining (B) of MFS mice (C1039G/+) or WT mice (+/+) (n = 4–8) 14 days after the placement of the ligature. ABC-CEJ distance (C) and HE staining (D) of MFS mice (C1039G/+) or WT mice (+/+) (n = 4–8) 14 days after the removal of the ligature. Box plots present the average (*P < 0.05, n = 3–5). Closed circles and boxes indicate C1039G/+ or WT mice, respectively. Scale bar, 50 μm.
infiltration and reduced type I collagen fibril reorganization compared with WT mice. These data suggest that an abnormal immune response that includes persistent tnf-α signaling slowed periodontal wound healing in C1039G/+ mice. In periodontal tissue, the activation of tnf-α is known to stimulate the degradation of connective tissue matrix by inducing the release of mmps (Judge et al., 2004). In addition, an increase in mmp-1 and a reduction in TIMP-1 in gingival crevicular fluid were identified in subjects with periodontitis compared to healthy subjects, and these changes were improved after treatment (Popat, Bhavsar, & Popat, 2014). Recent findings revealed that the local administration of Del-1, an inhibitor of neutrophil adhesion, inhibited inhibit IL-17 production and bone loss in a periodontal disease model (Eskan et al., 2012). Moreover, the inhibition of Sost, a Wnt inhibitor that reduced bone loss by decreasing ECM production in osteocytes, is critical to promote periodontal tissue regeneration (Bonnet et al., 2009). In addition, periodontal bone loss occurred through the inhibition of bone formation owing to the effect of inflammatory cytokines and the role of osteoblast lineage cells in periodontal bone resorption (Pacios et al., 2012). These data suggest that the inhibition of cytokine activity and production of ECMs are critical for preventing periodontal disease. In this study, we suggested that imperfect wound healing occurred in LI in the MFS mouse model, although no effect of tissue destruction was observed compared with WT mice. Since fibrillin-1 and fibrillin-2 have been shown to support osteoblast maturation and bone formation by
the periodontal ligament of C1039G/+ mice (Fig. 4A). A quantitative analysis of immunofluorescence showed that the mmp-9 and tnf-α expression levels were higher in C1039G/+ mice than in WT mice (Fig. 4B). By contrast, fbn-1 expression was similar in mutant and WT mice, whereas the expression of COLI was lower in mutant mice than in WT mice (Fig. 4C). These results suggested that inflammatory tissue destruction persisted in the periodontal tissue of C1039G/+ mice after the removal of the ligature, which delayed wound healing and resulted in the reorganization of the ECM network. To investigate the mechanisms underlying this delayed wound healing, m3Cl-60 dental mesenchymal cells were treated with tnf-α, and the expression levels of mmp-9, differentiation markers of the periodontal ligament such as colXII and colI, and fbn-1 were quantified by real-time PCR. Treatment with tnf-α up-regulated the expression of mmp-9 but down-regulated the levels of colXII. By contrast, tnf-α did not affect the expression of colI (Fig. 4D). Fbn-1 expression was down-regulated by stimulation with tnf-α. 4. Discussion In the present study, LI periodontal disease was shown to be suitable for investigations of inflammatory tissue destruction and wound healing (Eskan et al., 2012). Specifically, C1039G/+ mice with LI periodontal disease exhibited delayed wound healing associated with the sustained expression of tnf-α and mmp-9, inflammatory cell 57
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Fig. 4. The inflammatory state induced by the ligature persisted in MFS mice. A) Immunohistochemical staining for mmp-9, tnf-α, fbn-1 and colI in control (+/+) and ligature mice (C1039G/+) 14 days after the removal of the ligature. Scale bar, 50 μm. B) Quantitative analysis of fluorescence intensity for mmp-9 and tnf-α staining. The mean value of the WT group was defined as 100%. C) Quantitative analysis of fluorescence intensity for fbn-1 and colI staining. The mean value of the WT group was defined as 100%. D) Quantitative PCR analysis of mmp-9, col XII, col I and fbn-1 mRNA expression in dental mesenchymal cell lines treated with Tnf-α (10 ng/ml) or PBS as a control. Each sample was assessed in triplicate. (*P < 0.05). The mean value for the control was defined as 1.
destruction in a mouse model of MFS, suggesting that the pathological activation of TGF-β is involved in the onset of periodontal disease (Suda et al., 2013). The osteogenic differentiation of MFS-derived iPS cells was also inhibited by the activation of TGF-β signaling (Quarto, Li, Renda, & Longaker, 2012). Based on these results, TGF-β has been suggested to be responsible for the failure of connective tissue to regenerate in a mouse model of MFS. Nevertheless, a recent study uncovered a more complex mechanism by which TGF-β signaling
controlling local TGF-β and BMP bioavailability (Nistala, 2010), the impairment of osteoblast function due to fibrillin-1 insufficiency may be the cause of delayed wound healing in MFS model mice. Previous studies reported abnormal skeletal muscle in C1039G/+ mice and individuals with MFS, and the administration of angiotensin II receptor blockers (ARB), which down-regulate TGF-β signaling and normalize muscle architecture, repair and function in vivo (Cohn et al., 2007). Treatment with ARB also improved periodontal tissue 58
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
and Tokyo University of Science Animal Care and Committee.
promotes aneurysm formation in a mouse model of MFS. Specifically, the activation of the MAP kinase cascade, including p38 and ERK1/2, or blocking the TGF-β type II receptor in smooth muscle cells accelerated aneurysm formation in a mouse model of MFS (Holm et al., 2011; Li et al., 2014; Quarto et al., 2012; Yoshimura et al., 2005). Furthermore, the rate of aortic root dilatation in MFS patients did not significantly differ between groups treated with losartan and atenolol, a beta blocker agent (Lacro et al., 2014). These reports suggest that not only TGF-β signaling but also other factors activate the signaling pathway in MFS, and connective tissue disorder is observed. Similarly, TGF-β signaling is also involved in the progression of periodontal disease in MFS model mice (Suda et al., 2013). In the present study, we showed that periodontal tissue destruction in the MFS model was similar to that in WT mice, but MFS model mice exhibit lower wound healing ability than do WT mice due to the sustained expression of tnf-α and mmp-9. Based on these findings, we propose that wound-healing ability was reduced in the MFS model, and this might be involved in the continuous destruction of connective tissue disease, including periodontal disease. Previous findings suggested that MFS mice are susceptible to P. gingivalis infection, which up-regulates tnf-α and IL-17 production, subsequently increasing bone resorption (Suda et al., 2013). TNF-α plays a critical role in tissue destruction and is expressed by neutrophils, which reflect early-stage inflammation in various diseases. TNF-α induces osteoclast formation directly by a TRAF3-dependent mechanism (Yao, Xing, & Boyce, 2009) and indirectly through stimulation of RANKL expression by osteoblastic, synovial, and immune cells. In periodontitis, the mouse ligature model showed strong TNF-α expression in the initial stage. Enhanced TNF-α expression in the periodontal tissue may contribute to increased levels of serum TNF-α (Ekuni et al., 2010). TNF-α is produced by numerous immune and nonimmune cells, including macrophages, B cells, and periodontal ligament cells. The high production of cytokines may in turn induce the expression of MMP-9 (Kothari et al., 2014), leading to the degradation of extracellular matrix components and subsequent destruction of periodontal tissues (Yamaguchi & Kasai, 2005). C-Jun n-terminal kinase, which is activated by tnf-α, has been shown to promote abnormal ECM metabolism, characterized by elevated mmp production and a reduction in ECM proteins such as collagen (Yoshimura et al., 2005). On the other hand, in diabetes, inflammation and osteoclastogenesis are prolonged in periodontitis and, via TNF, limit the normal repair process by negatively modulating factors that regulate bone (Pacios et al., 2012). This phenomenon could accelerate connective tissue destruction in various connective tissue diseases, including aortic aneurysm and dissection, suggesting that similar events occurred in the C1039G/+ mice with LI periodontal disease. In the present study, we showed that tnf-α inhibited the expression of collagen XII and fbn-1 but induced the expression of mmp-9. The reasons underlying the lack of fbn-1 expression after the removal of the ligature were not investigated, but this lack of expression may be due to the maintenance of an inflammatory response because fbn-1 expression was markedly up-regulated during the early stage of periodontal disease in this model. Previous findings and the results of this study indicated that in addition to the activation of TGF-β signaling, tnf-α signaling may contribute to slowed wound healing in the periodontal tissue of MFS mice. In conclusion, MFS mice with LI periodontal disease experience delayed wound healing, which was attributed to tnf-α stimulation. Thus, inhibiting tnf-α signaling to impair wound healing may serve as a novel therapy for the treatment of periodontal disease in MFS patients.
Acknowledgments We thank Drs. Harry Dietz, Tomoyuki Nakamura, Masamitsu Oshima, and Takashi Tsuji for their valuable advice and discussions during this work. This work was supported by JSPS KAKENHI Grant-inAid for Scientific Research(C) Number JP15K11104. References Bonnet, N., Standley, K. N., Bianchi, E. N., Stadelmann, V., Foti, M., Conway, S. J., et al. (2009). The matricellular protein periostin is required for sost inhibition and the anabolic response to mechanical loading and physical activity. Journal of Biological Chemistry, 284(51), 35939–35950. Brooke, B. S., Habashi, J. P., Judge, D. P., Patel, N., Loeys, B., & Dietz, H. C. (2008). Angiotensin II blockade and aortic-root dilation in Marfan’s syndrome? The New England Journal of Medicine, 358(26), 2787–2795. Chung, A. W., Au Yeung, K., Sandor, G. G., Judge, D. P., Dietz, H. C., & van Breemen, C. (2007). Loss of elastic fiber integrity and reduction of vascular smooth muscle contraction resulting from the upregulated activities of matrix metalloproteinase-2 and -9 in the thoracic aortic aneurysm in Marfan syndrome. Circulation Research, 101, 512–522. Cohn, R. D., Erp, C., Habashi, J. P., Soleimani, A. A., Klein, E. C., Lisi, E. T., et al. (2007). Angiotensin II type 1 receptor blockade attenuates TGF-beta-induced failure of muscle regeneration in multiple myopathic states? Nature Medicine, 13(2), 204–210. Dietz, H. C., Cutting, C. R., Pyeritz, R. E., Msalen, C. L., Sakai, L. Y., Corson, G. M., et al. (1991). Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene. Nature, 352, 337–339. Ekuni, D., Tomofuji, T., Irie, K., Kasuyama, K., Umakoshi, M., Azuma, T., et al. (2010). Effects of periodontitis on aortic insulin resistance in an obese rat model? Laboratory Investigation, 90(3), 348–359. Eskan, M. A., Jotwani, R., Abe, T., Chmelar, J., Lim, J., Liang, S., et al. (2012). The leukocyte integrin antagonist Del-1 inhibits IL-17-mediated inflammatory bone loss. Nature Immunology, 13(5), 465–473. Garlet, G. P. (2010). Destructive and protective roles of cytokines in periodontitis: A reappraisal from host defense and tissue destruction viewpoints. Journal of Dental Research, 89(12), 1349–1363. Habashi, J. P., Judge, D. P., Holm, T. M., Cohn, R. D., Loeys, B. L., Cooper, T. K., et al. (2006). Losartan, an AT1 antagonist, prevents aortic aneurysm in a mouse model of Marfan syndrome. Science, 312(5770), 117–121. Holm, T. M., Habashi, J. P., Doyle, J. J., Bedja, D., Chen, Y., Erp, C., et al. (2011). Noncanonical TGFβ signaling contributes to aortic aneurysm progression in Marfan syndrome mice. Science, 332(6027), 358–361. Jin, Q., Cirelli, J. A., Park, C. H., Sugai, J. V., Taba, M., Jr., & Kostenuik, P. J. (2007). RANKL inhibition through osteoprotegerin blocks bone loss in experimental periodontitis. Journal of Periodontology, 78(7), 1300–1308. Ju, X., Ijaz, T., Sun, H., LeJeune, W., Vargas, G., Shilagard, T., et al. (2014). IL-6 regulates extracellular matrix remodeling associated with aortic dilation in a fibrillin-1 hypomorphic mgR/mgR mouse model of severe Marfan syndrome? Journal of the American Heart Association, 3(1), 1–13. Judge, D. P., & Dietz, H. C. (2005). Marfan’s syndrome. Lancet, 366, 1965–1976. Judge, D. P., Biery, N. J., Keene, D. R., Geubtner, J., Myers, L., Huso, D. L., et al. (2004). Evidence for a critical contribution of haploinsufficiency in the complex pathogenesis of Marfan syndrome. Journal of Clinical Investigation, 114(2), 172–181 11. Kielty, C. M., Sherratt, M. J., & Shuttleworth, C. A. (2002). Elastic fibres. Journal of Cell Science, 115, 2817–2828. Kinney, J. S., Ramseier, C. A., & Giannobile, W. V. (2007). Oral fluid-based biomarkers of alveolar bone loss in periodontitis. Annals of the New York Academy of Sciences, 1098, 230–251. Kothari, P., Pestana, R., Mesraoua, R., Elchaki, R., Khan, K. M. F., Dannenberg, A. J., et al. (2014). IL-6-mediated induction of matrix metalloproteinase-9 is modulated by JAKdependent IL-10 expression in macropgagesIL-10 expression in macrophages. Journal of Immunology, 192(1), 349–357. Lacro, R. V., Dietz, H. C., Sleeper, L. A., Yetman, A. T., Bradley, T. J., Colan, S. D., et al. (2014). Atenolol versus losartan in children and young adults with Marfan’s syndrome. The New England Journal of Medicine, 371(22), 2061–2071. Li, W., Li, Q., Jiao, Y., Qin, L., Ali, R., Zhou, J., et al. (2014). Tgfbr2 disruption in postnatal smooth muscle impairs aortic wall homeostasis. Journal of Clinical Investigation, 124(2), 755–767. Milewicz, D. M., Dietz, H. C., & Miller, D. C. (2005). Treatment of aortic disease in patients with Marfan syndrome. Circulation, 111(11), e150–e157. Neptune, E. R., Frischmeyer, P. A., Arking, D. E., Myers, L., Bunton, T. E., Gayraud, B., et al. (2003). Dysregulation of TGF-beta activation contributes to pathogenesis in Marfan syndrome. Nature Genetics, 33, 407–411. Nistala, H. (2010). Fibrillin-1 and -2 differentially modulate endogenous TGF-β and BMP bioavailability during bone formation. The Journal of Cell Biology, 190(6), 1107–1121. Noda, K., Dabovic, B., Takagi, K., Inoue, T., Horiguchi, M., Hirai, M., et al. (2013). Latent TGF-β binding protein 4 promotes elastic fiber assembly by interacting with fibulin-5. Proceedings of the National Academy of Sciences of the United States of America, 110(8), 2852–2857.
Conflict of interests There are no conflicts of interest. Ethical approval All experimental protocols were approved by Tohoku University 59
Archives of Oral Biology 90 (2018) 53–60
K. Handa et al.
Characteristic phenotype of immortalized periodontal cells isolated from a Marfan syndrome type I patient. Cell and Tissue Research, 331(2), 461–472. Shores, J., Berger, K. R., Murphy, E. A., & Pyeritz, R. E. (1994). Progression of aortic dilatation and the benefit of long-term beta-adrenergic blockade in Marfan’s syndrome? The New England Journal of Medicine, 330(19), 1335–1341. Straub, A. M., Grahame, R., Scully, C., & Tonetti, M. S. (2002). Severe periodontitis in Marfan’s syndrome: A case report? Journal of Periodontology, 73(7), 823–826. Suda, N., Moriyama, K., & Ganburged, G. (2013). Effect of angiotensin II receptor blocker on experimental periodontitis in a mouse model of Marfan syndrome? Infection and Immunity, 81(1), 182–188. Yamaguchi, M., & Kasai, K. (2005). Inflammation in periodontal tissues in response to mechanical forces. Archivum Immunologiae et Therapiae Experimentalis, 53(5), 388–398. Yao, Z., Xing, L., & Boyce, B. F. (2009). NF-kappaB p100 limits TNF-induced bone resorption in mice by a TRAF3-dependent mechanism? Journal of Clinical Investigation, 119(10), 3024–3034. Yoshimura, K., Aoki, H., Ikeda, Y., Fujii, K., Akiyama, N., Furutani, A., et al. (2005). Regression of abdominal aortic aneurysm by inhibition of c-Jun N-terminal kinase. Nature Medicine, 11(12), 1330–1338.
Pacios, S., Kang, J., Galicia, J., Gluck, K., Patel, H., Ovaydi-Mandel, A., et al. (2012). Diabetes aggravates periodontitis by limiting repair through enhanced inflammation? FASEB Journal, 26(4), 1423–1430. Popat, R. P., Bhavsar, N. V., & Popat, P. R. (2014). Gingival crevicular fluid levels of Matrix Metalloproteinase-1 (mmp-1) and Tissue Inhibitor of Metalloproteinase-1 (TIMP-1) in periodontal health and disease. Singapore Dental Journal, 35, 59–64. Quarto, N., Li, S., Renda, A., & Longaker, M. T. (2012). Exogenous activation of BMP-2 signaling overcomes TGFβ-mediated inhibition of osteogenesis in Marfan embryonic stem cells and Marfan patient-specific induced pluripotent stem cells. Stem Cells, 30(12), 2709–2719. Ramirez, F., & Sakai, L. Y. (2010). Biogenesis and function of fibrillin assemblies. Cell and Tissue Research, 339(1), 71–82. Saito, M., & Tsuji, T. (2012). Extracellular matrix administration as a potential therapeutic strategy for periodontal ligament regeneration? Expert Opinion on Biological Therapy, 12(3), 299–309. Sakai, L. Y., Keene, D. R., & Engvall, E. (1986). Fibrillin, a new 350-kD glycoprotein, is a component of extracellular microfibrils. The Journal of Cell Biology, 103(6 Pt 1), 2499–2509. Shiga, M., Saito, M., Hattori, M., Torii, C., Kosaki, K., Kiyono, T., et al. (2008).
60