First detection of the protozoan parasite Bonamia exitiosa (Haplosporidia) infecting flat oyster Ostrea edulis grown in European waters

Available online at www.sciencedirect.com

Aquaculture 274 (2008) 201 – 207 www.elsevier.com/locate/aqua-online

First detection of the protozoan parasite Bonamia exitiosa (Haplosporidia) infecting flat oyster Ostrea edulis grown in European waters ☆ Elvira Abollo ⁎, Andrea Ramilo, Sandra M. Casas, Pilar Comesaña, Asunción Cao, M. Jesús Carballal, Antonio Villalba Centro de Investigacións Mariñas, Consellería de Pesca e Asuntos Marítimos, Xunta de Galicia, Apartado 13, 36620 Vilanova de Arousa, Spain Received 9 October 2007; received in revised form 22 November 2007; accepted 23 November 2007

Abstract The haplosporidian Bonamia exitiosa was found infecting the European flat oyster Ostrea edulis in the Galician coast (NW Spain), which represents the first report of this parasite along European waters. Histopathology and molecular characterization of the small subunit ribosomal DNA gene were performed to identify this species. Examination of histological sections showed two microcell types, the smaller one corresponding to Bonamia ostreae and the larger one to B. exitiosa. Phylogenetic analysis places the sequence herein reported in a clade with Bonamia species of the Southern hemisphere, namely B. exitiosa, B. roughleyi and Bonamia sp. from North Carolina and Chile. Subsequent PCR-RFLPs analysis showed a highly-endemiotopic infection by B. exitiosa, demonstrating the success of this haplosporidian to infect the European flat oyster in the Galician marine ecosystem even in concurrent infections with B. ostreae. © 2007 Elsevier B.V. All rights reserved. Keywords: Bonamia; Ostrea edulis; Haplosporidian; Phylogenetics; Small subunit ribosomal DNA; Bivalve mollusc

1. Introduction Haplosporidian microcells belonging to the genus Bonamia infect the haemocytes of different oyster species around the world. Currently this genus is comprised of four species that have been recognized through molecular analyses: Bonamia ostreae, which infects the flat oyster Ostrea edulis in Europe, the United States, Canada and Moroccco (Pichot et al., 1980; Bucke et al., 1984; Elston et al., 1986; Montes and Melendez, 1987; Friedman et al., 1989; Mcardle et al., 1991; Friedman and Perkins, 1994; OIE, 2005; Marty et al., 2006); B. exitiosa, which infects Ostrea chilensis in New Zealand (Hine et al., 2001; Berthe and Hine, 2003) and Ostrea angasi in Australia (Corbeil et al., 2006); B. roughleyi, which parasitizes Saccrostrea glomerata in Southeast Australia (Cochennec-Laureau et al., 2003); and B. perspora, ☆

Nucleotide sequence data reported in this paper are available in the GenBank under the Accession No EU016528. ⁎ Corresponding author. Tel.: +34 986 500 155; fax: +34 986 506 788. E-mail address: [email protected] (E. Abollo). 0044-8486/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2007.11.037

which infects Ostreola equestris in North Carolina (Carnegie et al., 2006). Bonamia-like organisms have been also described parasitizing T. chilensis in Chile (Kern 1993; Campalans et al., 2000), Ostrea puelchana in Argentina (Kroeck and Montes, 2005) and Crassostrea ariakensis in North Carolina (Burreson et al., 2004). Bonamiosis, caused by B. ostreae and B. exitiosa, is responsible for extensive oyster mortalities in the Northern and Southern Hemisphere, respectively. The introduction and spread of B. ostreae in Europe are believed to have occurred through the movements of infected oyster seed from California to France and Spain (Elston et al., 1986; Cigarría and Elston, 1997). In the late 1970s and early 1980s, mass mortalities attributed to B. ostreae caused declines in oyster production in Europe and favoured the development of different management strategies to counteract the threat of bonamiosis (Pichot et al., 1980, van Banning, 1982; Bannister and Key, 1982; Polanco et al., 1984; Friedman et al., 1989; Mcardle et al., 1991; Barber and Davis, 1994; Friedman and Perkins, 1994; Marty et al., 2006). In Galicia, the oyster industry survived through the

202

E. Abollo et al. / Aquaculture 274 (2008) 201–207

importation of oysters close to the minimum market size from other European countries, which are grown by hanging from culture rafts for a short period and then marketed, to avoid the high mortalities associated with longer culture periods. Mass mortalities caused by B. exitiosa are also a recurrent feature of Foveaux Strait oyster population dynamics in New Zealand (Doonan et al., 1994; Cranfield et al., 2005). An epizootic event caused by B. exitiosa was confirmed in the late 1985 with evidence of continued mortality up until March 1995. The fishery was closed to allow the population to recover in 1993, with a consequent negative impact on the local economy. In this period, the oyster population was reduced to less than 10% of that present before the epizootic outbreak (Doonan et al., 1994). Between 2000 and 2006, another outbreak was confirmed, with mortality values around 72% of recruited oysters by 2005 (Anonymous, 2006). Although the oyster population is considered as well adjusted to co-exist with the disease, the environmental stress attributed to the modification of oyster habitat by fishing has been implicated in disease outbreaks (Cranfield et al., 1999). At present, methods for the eradication of bonamiosis are not available (Bower, 2007), thus requiring strict sanitary controls during importation activities. The Office International des Epizooties (OIE) has included B. ostreae and B. exitiosa in the list of notifiable diseases in order to avoid the spread of the bonamiosis. However, histological and molecular analyses have led to detection of B. exitiosa naturally infecting the European flat oyster O. edulis in Galician (NW Spain) coastal waters. This study reports B. exitiosa in Europe for the first time and, furthermore, in a previously unidentified host. 2. Material and methods 2.1. Oyster deployment and sampling Several batches of oysters deployed in an area of the Ría de Arousa (Galicia, NW Spain) were used for diagnosis of bonamiosis and identification of the involved parasite species. These batches were not screened for Bonamia species prior to relaying in the field. The first (A) batch of market-sized (N60 mm) oysters was imported from an unspecified European country, and was set in trays that were hung from a raft in November 2004. In July 2005, 125 oysters were collected and transferred to the laboratory. Haemolymph was withdrawn from each oyster to evaluate bonamiosis intensity through examination of a haemolymph cell monolayer (HCM) obtained by cytocentrifugation (da Silva and Villalba, 2004). Briefly, haemolymph from each oyster was withdrawn from the adductor muscle using a 21-gauge needle attached to a 1 ml syringe. Haemolymph was transferred into 1.5 ml tube; materials and samples were maintained in crushed ice until used. HCM were prepared by cytocentrifugation (92 ×g, 5 min, 4 °C) of 150 µl of haemolymph onto a slide, which were fixed and stained with a Hemacolor kit (Merck). The percentage of haemocytes infected by microcells in the HCMs was estimated with light microscopy. Eight oysters showing 5–25% infected haemocytes were used as a source of Bonamia cells in an attempt to culture the parasite The oysters were opened and removed from their shells. Heart and fragments of gills (approximately 5 mm3) were excised using sterile scissors under a laminar-flow hood and added to 50-ml test tubes with 30 ml of 35-ppt artificial seawater (ASW). Oyster tissues were rinsed 10 times in 30 ml of ASW, and decontaminated with two 30-min incubations in an antibiotic solution (AS) consisting of (per litre) 400,000 U penicillin G, 400 mg streptomycin sulphate, 200 mg gentamycin, 400 mg kanamycin A, 0.2 mg neomycin, 200 mg polymyxin B and 400 mg erithromycin in sterile ASW. Tissues were rinsed again ten times in 30 ml of ASW and cut in half with a sterile razor blade. Each tissue fragment was placed directly in one well of a sterile 24-

well plate containing 1 ml of JL-ODRP-2A medium (Casas et al., 2002). All plates were incubated in a humidified chamber at 28 °C. After incubation for 30 days samples were taken from the wells and processed through cytocentrifugation (92 ×g, 5 min at 20 °C). The resulting cell monolayers were scanned by light microscopy to assess occurrence and proliferation of Bonamia cells. The content of the plates in which Bonamia cells and haplosporidian-like plasmodial stages were detected was then used for molecular analyses to identify the proliferating microcells. In September 2005, a batch (B) of oyster seed (1–2 cm in height) that had been produced in the hatchery facilities of the Centro de Investigacións Mariñas, using oysters derived from Galician stocks as broodstock, was transferred to a culture raft. Samples were taken in September 2006 and June 2007 and processed for histological examination and PCR-RFLP analysis (see below) to diagnose bonamiosis and to identify the involved parasite species. In addition, four (C, D, E, F) market-sized oyster batches coming from unspecified European countries were set in trays and hung from culture rafts in December 2005, February 2006, May 2006 and December 2006, respectively. These batches were expected to be exposed to bonamiosis; samples were taken at different times (Table 2) and processed by histological techniques and PCR-RFLP to diagnose bonamiosis and to identify the involved parasite species.

2.2. Histological processing A sagital section (5 mm) of each oyster containing gill, visceral mass and mantle lobes was fixed in Davison's solution, dehydrated in an ethanol series and embedded in paraffin. Histological sections (5 μm) were stained with Harris' hematoxylin and eosin (Howard and Smith, 1983) and observed under a light microscope (1000× magnification) for diagnosis.

2.3. Genomic DNA extraction and PCR amplification DNA extractions were performed employing the DNAzol reagent® (Invitrogen Life Technologies™) according to the manufacturer's instructions and quantified on a SmartSpec™ Plus Spectrophotometer (BioRad). In order to establish the specific identification of haplosporidian-like plasmodial stages detected in the culture plates, PCRs using generic haplosporidian HAP primers were performed (Renault et al., 2000) (Table 1). PCR reactions were performed in a total volume of 25 μl containing 1 μl of genomic DNA (200 ng), PCR buffer at 1× concentration, 1.5 mM MgCl2, 0.2 mM nucleotides (Roche Applied Science), 0.3 μM primers and 0.025 U/μl Taq DNA polymerase (Roche Applied Science). A positive control for Haplosporidium armoricanum and a negative control (no DNA) were included in all PCR reactions. PCR products were separated on 2% agarose (in 1× Tris-acetic EDTA buffer) gels, stained with ethidium bromide and scanned in a GelDoc XR documentation system (BioRad).

Table 1 Primer sequences used in this study Primer HAP-F1 HAP-F2 HAP-R1 HAP-R2 HAP-R3

Sequence 5′–3′

GTT CTT TCW TGA TTC TAT GMA GCC RTC TAA CTA GCT S CTC AWK CTT CCA TCT GCT G GAT GAA YAA TTG CAA TCA YCT AKR HRT TCC TWG TTC AAG AYG A Bonamia CF CGG GGG CAT AAT TCA GGA AC Bonamia CR CCA TCT GCT GGA GAC ACA G 16S-A AACCTGGTTGATCCTGCCAGT 16S-B GAT CCT TCC GCA GGT TCA CCT AC BON-745R CTA ATG CAT TCA GGC GCG AG BON-1310F GAG ACC CCA CCC ATC TAA C BOG-F CGC TGG TCC TGA TCC TTT AC BOG-R ATG CTG CAC CCC GCT AAC

Reference Renault et Renault et Renault et Renault et Renault et

al. (2000) al. (2000) al. (2000) al. (2000) al. (2000)

Carnegie et al. (2000) Carnegie et al. (2000) Medlin et al. (1988) Medlin et al. (1988) Carnegie et al. (2006) Carnegie et al. (2006) This study This study

E. Abollo et al. / Aquaculture 274 (2008) 201–207

203

performed using the Tajima–Nei model, using the CNI heuristic option with a search level of 2, and bootstrap values were calculated over 1000 replicates.

2.7. PCR-RFLPs

Fig. 1. Haplosporidian-like plasmodia in a cell monolayer produced by cytocentrifugation of a sample from an in vitro cell culture derived from heart fragments of oysters Ostrea edulis infected by Bonamia-like microcells. Bar = 10 μm.

2.4. DNA cloning and sequencing PCR products were ligated into cloning vector pCR2.1 at 14 °C overnight and transformed into E. coli One Shot Top 10F′ Chemically Competent (Invitrogen Life Technologies™). Transformed cells were screened by PCR using the vector's M13 forward (5′ GTA AAA CGA CGG CCA G 3′) and reverse (5′ CAG GAA ACA GCT ATG AC 3′) primers. The positive clones were cleaned for sequencing using the commercial Rapid PCR Purification system (Marligen Biosciences, Inc.) according to the manufacturer's instructions. The sequencing reaction was performed on an ABI PRISM™ 3100 (Applied Biosystems) using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) as supplied by the manufacturer. All amplified fragments were sequenced with M13 commercial primers and the chromatograms were analysed using ChromasPro version 1.32 Technelysium Pty LtdA. All sequences generated were searched for similarity using BLAST (Basic Local Alignment Search Tool) through web servers of the National Center for Biotechnology Information (USA).

PCR-RFLP was performed to identify the Bonamia spp. infecting the oysters in the samples from batches B, C, D, E and F. Generic primers for Bonamia named BOG-F and BOG-R (Table 1), which amplify a fragment (about 665 bp) of the 18S rDNA gene, were designed using the Bonamia spp. sequences deposited in the GenBank and the program Primer3 (http://frodo.wi. mit.edu/cgi-bin/primer3/primer3_www.cgi) (Rozen and Skaletsky, 2000). PCR reactions were performed as described previously, and were carried out in a TGradient thermocycler (Biometra). The cycling protocol was 94 °C for 2 min, 35 cycles of 94 °C for 45 s, 60 °C for 1 min and 72 °C for 1 min, followed by 72 °C for 7 min. In order to identify Bonamia species a restriction fragment length polymorphism (RFLP) assay was designed using the utilities of the ChromasPro version 1.32 Technelysium Pty LtdA. The RFLP assay was performed only with those positive PCR products that rendered an optimal concentration of DNA (≥185 ng μl− 1). All restriction reactions were carried out in a final volume of 15 μl containing 2400 ng of DNA, 1.5 μl of enzyme buffer and 0.5 μl (6 U) of SalI restriction enzyme (Takara Bio Inc.). The digestions were performed for 3 h at 37 °C, which was followed by 20 min at 65 °C to inactivate the enzyme. To visualize the restriction patterns, digested samples (15 μl) mixed with 1 μl loading buffer were subjected to electrophoresis through 2% agarose gels stained with ethidium bromide and run at 60 V for 2 h. A 100 bp ladder (Invitrogen Life Technologies™) was included as molecular weight marker. Although, one unit of enzyme is defined as the amount of SalI required to digest completely 1 μg of DNA in 50 μl of the reaction mixture at 37 °C for 1 h, the DNA was incubated with excess amount of this enzyme (one unit for 400 ng) for 3 h to ensure the complete digestion of the PCR products. Moreover, some PCR products identified as mixed infections were cloned and sequenced to make certain the veracity of the RFLP results.

3. Results 3.1. Light microscopy

2.5. Small subunit rDNA amplification Three pairs of primers were used to amplify overlapping fragments of 18S rDNA according to Carnegie et al. (2006): 16S-A + BON-745R, CF + CR and BON-1310F + 16S-B (Table 1). Each PCR product was ligated, the competent cells were transformed, and ten clones for each PCR product were sequenced, as described previously. To discriminate among Bonamia species, all sequences generated were BLAST searched for similarity, and then were aligned using the Clustal W algorithm (Thompson et al., 1994) to produce the entire SSU rDNA fragment.

Oysters from batch A showed a low prevalence of bonamiosis (14%) when haemolymph monolayers were examined, and the percentage of infected haemocytes was 13.7 ± 16.2%. Examination of the culture plates containing gill and heart fragments of Bonamia-infected oysters from batch A showed that the tissue fragments disaggregated after 5 days and the number of cells in the wells increased. Cytocentrifugation of culture samples showed Bonamia-like uninucleated cells,

2.6. Phylogenetic analysis Subsequently, the consensus sequence obtained was aligned with other 20 haplosporidian sequences which are available on GenBank: B. ostreae (AF262995), B. perspora (DQ356000), B. roughleyi (AF508801), B. exitiosa from Australia (DQ312295), B. exitiosa from New Zealand (AF337563), Bonamia sp. from North Carolina (AY542903) and Chile (AY860060), Haplosporidium costale (AF387122), H. edule (DQ458793), H. pickfordi (AY452724), H. lusitanicum (AY449713), H. lousiana (U47851), Haplosporidium sp. from O. edulis (AY781176), Minchinia tapetis (AY449710), M. chitonis (AY449711), M. teredinis (U20319), Minchinia sp. from Cyrenoida floridana (AY449712), Urosporidium crescens (U47852), Urosporidium sp. from Stictodora lari (AY449714), and the haplosporidian from Pandalus platyceros (AY449715). Alignment was accomplished using the Clustal W algorithm in MEGA version 3.1 software (Kumar et al., 2004), with settings at defaults: gap opening/gap extension penalties = 15/6.66 for both pairwise and multiple alignments, and with transitions weighted at 0.5. Maximum parsimony analysis was conducted using the close neighbour interchange (CNI) heuristic option with initial trees by random addition of 1000 replicates, a search level of 1 and bootstrap values calculated over 100 replicates. Minimum evolution analysis was

Fig. 2. Light micrograph of a histological section of an oyster Ostrea edulis infected by Bonamia ostreae (arrows). Bar = 10 μm.

204

E. Abollo et al. / Aquaculture 274 (2008) 201–207

sponding to both microcell types were observed in heavily infected oysters. After examining 419 oysters, 67 hosted the smaller microcell type exclusively, 23 hosted the larger type exclusively, and 13 oysters showed both microcell types. 3.2. Molecular identification

Fig. 3. Light micrograph of a histological section of an oyster Ostrea edulis infected by Bonamia exitiosa (arrows). Bar = 10 μm.

haplosporidian-like plasmodial stages 4–15 μm in size (Fig. 1), some remaining haemocytes and tissue debris. Uninucleated Bonamia-like microcells were also observed in the histological sections of some oysters in the samples from batches B, C, D, E, and F. Two different types of microcells were observed: the smaller one (mean diameter = 1.6 μm; SE = 0.04 μm; range: 1–2.5 μm; N = 55) showed a peripheral nucleus and scant cytoplasm (Fig. 2), whereas the larger one (mean diameter = 2.8 μm; SE = 0.07 μm; range: 2–5 μm; N = 73) showed a central nucleus, sometimes subcentral but rarely peripheral, and cytoplasm larger than that of the previous type (Fig. 3). Both microcell types were seen in the connective tissue of different organs (gills, labial palps, mantle lobes and visceral mass) mostly within haemocytes, although sometimes they were observed outside host cells. Both microcell types appeared associated with heavy haemocytic infiltration. Binucleated cells representing division stages and corre-

Positive PCR results were observed for template obtained from culture samples using the primers HAP-F1/R1 and HAP-F1/R2. After cloning and sequencing of the PCR products, the sequences were subjected to BLAST analysis to find the most similar sequences in the GenBank database. Three sequences were 99–100% similar to the SSU rDNA gene sequence of B. ostreae and seven sequences showed similarity values of 99% with B. exitiosa from Australia (DQ312295). PCRs with primers 16S-A + BON-745R, CF + CR, and BON-1310F + 16S-B gave successfully amplified products, which were cloned, sequenced and searched for similarity in GenBank using BLAST. After assembling all of the sequence data, a SSU rDNA gene consensus sequence of 1796 bp was obtained for the B. exitiosa-like isolate. Eight polymorphic sites with either an A or G at positions 377, 510, 858, 1217, 1247, 1536 and 1753 were observed, and a single polymorphic site C/T at position 973 was detected. Nucleotide sequence data reported in this paper are available in the GenBank under the Accession No EU016528. GenBank Blast search showed closest identity with B. exitiosa from Australia and North Carolina with identity values of 99%; while lower nucleotide identity values of 95% and 94% were observed with B. ostreae and B. perspora, respectively, indicating a more distant evolutionary relationship. Final SSU rDNA gene sequence alignment used in the phylogenetic analysis consisted of 1012 bp including gaps and missing data. Of these sites, 389 (38.4%) were conserved, 609 (60.2%) were variable, 373 (36.9%) were parsimony informative and 225 (22.2%) were singleton. The trees constructed with maximum parsimony (MP) (Fig. 4) and minimum evolution (ME) methods (not shown) revealed the same topology and supported the monophyly of the genera Bonamia with bootstrap values of 100%. The sequence obtained was placed together with the group of Bonamia species from

Fig. 4. Maximum parsimony analysis showing the taxonomic position of Bonamia exitiosa infecting Ostrea edulis from the Galician coast in relation to other haplosporidians. Numbers at branch nodes indicate bootstrap confidence values in percent.

E. Abollo et al. / Aquaculture 274 (2008) 201–207

205

Table 2 Identification of Bonamia spp. in each oyster batch by PCR-RFLPs Oyster batch

Deploying date

Sample date

N

B

Sept 2005

C D

Dec 2005 Feb 2006

E

May 2006

F

Dec 2006

Sep 2006 June 2007 May 2006 Oct 2006 Nov 2006 Nov 2006 June 2007 Mar 2007 Apr 2007 May 2007 June 2007

45 45 45 49 50 10 25 25 25 25 25

PCR positive

P

23 30 18 28 26 1 25 14 12 21 20

51 ± 14.6 66 ± 13.7 40 ± 14.3 57 ± 13.8 52 ± 13.8 10 ± 18.6 100 56 ± 19.4 48 ± 19.5 84 ± 14.3 80 ± 15.6

No. of oysters infected by B. ostreae

B. exitiosa

Mixed infection

1 0 12 1 0 1 4 10 11 12 3

6 3 0 17 10 0 8 0 0 1 6

3 0 0 4 1 0 3 0 0 1 9

N, sample size; P, prevalence of Bonamia spp. in the whole sampling (% ± 95% CI). Note that some oysters could not be processed for RFLP analysis.

the Southern hemisphere with strong bootstrap values of 100% and 97% for MP and ME analysis, respectively. B. ostreae and B. perspora were also grouped with high bootstrap values (98% for MP and 94% for ME analysis). 3.3. PCR-RFLP To determine the prevalence of infection by each Bonamia species, PCR-RFLP assays were performed. Prevalence values for Bonamia spp. ranged from 10% to 100% (Table 2). A total of 188 oysters were PCR positive for Bonamia spp. Of them, 127 PCR products were digested with SalI, which produced three different restriction patterns (Fig. 5): a pattern with two fragments of approximately 319 and 350 bp, which corresponds to the restriction profile of B. exitiosa; a second pattern with a fragment of approximately 650 bp which corresponds to the restriction profile of B. ostreae; and a third pattern with 3 fragments of 319 and 350 bp, plus a band of 650 bp, which corresponds to the restriction profile of B. exitiosa and B. ostreae (co-infections). Of the 127 analysed oysters, 55 (43.3%) were infected by B. ostreae, 51 (40.2%) by B. exitiosa and 21 (16.5%) were co-infected by both species (Table 2). When considering the oysters that were found infected by microcells with histology and were processed by PCR-RFLP, every oyster infected by only the smaller microcell type corresponded to B. ostreae infection, every oyster infected by only the

Fig. 5. RFLP profiles obtained after digestion of SSU rDNA fragment with the SalI enzyme. Lanes: 1, B. ostreae; 2, B. exitiosa; 3, co-infection; M, 100 bp molecular marker.

larger microcell type corresponded to B. exitiosa infection, and the oysters infected by both microcell types corresponded to mixed infection.

4. Discussion B. ostreae was the only species of this genus reported infecting the European flat oyster O. edulis before this study, which reports that a Bonamia species different from B. ostreae was repeatedly found infecting O. edulis grown in Galician waters. Two microcell types, a smaller one corresponding to B. ostreae and a larger one corresponding to B. exitiosa, were identified using histology and PCR-RFLP. Previous studies support size differences between those two Bonamia spp.: uninucleated cells of B. ostreae have been usually described as 2–3 μm in diameter (Katkansky et al., 1969; Balouet et al., 1983; Elston et al., 1986; Bucke 1988; Friedman et al., 1989); Hine et al. (2001) reported a mean diameter of 2.4 ± 0.5 μm for B. ostreae and 3.0 ± 0.3 μm for B. exitiosa. Eccentric nuclei have been identified as characteristic of uninucleated B. ostreae cells (Bucke 1988, Friedman et al., 1989) whereas central nuclei were characteristic of B. exitiosa (Hine et al., 2001). An ultrastructural study is planned to improve the morphological characterisation of the two microcell types occurring in Galician oysters. Moreover, molecular analysis demonstrated the occurrence of B. ostreae and B. exitiosa cells in the samples taken from culture plates containing haplosporidianlike plasmodial stages and uninucleated microcells. Previously, Comps (1983) reported the occurrence of uninucleated, binucleated and tetranucleated cells in his B. ostreae in vitro culture assays. Brehélin et al. (1982) had also reported the occurrence of B. ostreae plasmodia (up to 6 μm in diameter and with up to 5 nuclei in an ultrathin section) in moribund oysters O. edulis; the authors suggested that the plasmodia could correspond to an explosive proliferation of the parasite preceding host death. According to Hine et al. (2001) binucleated cells were frequent in B. exitiosa but tetranucleated plasmodia were rare. Plasmodia with up to 4 nuclei were also rare in B. roughleyi (Cochennec-Laureau et al., 2003). Recently, Carnegie et al. (2006) reported that multinucleated plasmodia of B. perspora were abundant in O. equestris. Our comparative molecular analysis included sequences for 20 species including the four Bonamia species recognised as

206

E. Abollo et al. / Aquaculture 274 (2008) 201–207

valid and those described as Bonamia-like organisms for which SSU rDNA sequences were available in GenBank. Phylogenetically, the Bonamia species reported in this study as new to Galician coastal waters was most closely related to Bonamia species of the Southern hemisphere with high bootstrap values (100%). Inside this group the Bonamia species from Galicia was located in a branch with B. exitiosa from Australia and Bonamia sp. from North Carolina with a 90% bootstrap value. The Australian B. exitiosa sequence is identical to the North Carolina Bonamia sp., which suggests that both microcells could belong to the same species. B. exitiosa from New Zealand was most closely related to B. roughleyi and Bonamia sp. from Chile. Based on close similarity to southern hemispheric Bonamia species, and the conclusion by the OIE Reference Laboratory for Bonamia parasites that the various unidentified Bonamia species found in locations as disparate as Australia, Chile, Argentina, and the United States are all B. exitiosa (López-Flores et al., 2007), we presume that the B. exitiosa-like Bonamia species observed in Galicia is in fact B. exitiosa itself. PCR-RFLP results showed that 56.7% of the analysed oysters (including co-infection values) were infected by B. exitiosa. In the two oyster batches (E and F) in which the B. exitiosa RFLP pattern was not found in the first sampling, its prevalence increased later, which suggests that the infection started in Galician waters. Furthermore, oysters from batch B were produced in a Galician hatchery, further suggesting that the infection was acquired in Galician waters. High prevalence values show that B. exitiosa is a component species (P N 10%; Bush et al., 1997) well-adapted to the Galician marine ecosystem and to O. edulis as host species. Bishop et al. (2006) explained the introduction of Bonamia sp. in North Carolina through ballast waters and outer hulls of ships. This hypothesis could be feasible for Galicia, although. B. exitiosa could also have been inadvertently introduced through (1) the illegal importation of oysters from areas endemic for B. exitiosa; or (2) the legal importation of oysters from hypothetical European countries where B. exitiosa could occur but has not yet been detected. We must emphasize the importance of diagnostic methods for detection and specific identification of pathogens, with the aim to prevent the introduction of allopatric species. Although the OIE recommends that Bonamia diagnosis must be carried out by examination of heart imprints and histological sections, some limitations of these diagnostic methods have been shown by O'Neill et al. (1998), Culloty et al. (2003), da Silva and Villalba (2004), Balseiro et al. (2006) and Marty et al. (2006), which suggest the need for a critical review of diagnostic methods. Sensitive molecular detection methods, such as immunoassays (Boulo et al., 1989; Rogier et al., 1991; Cochennec et al., 1992) and PCR-based assays (Carnegie et al., 2000; Cochennec et al., 2000; Carnegie and Cochennec-Laureau, 2004; Corbeil et al., 2006; Marty et al., 2006), have provided useful tools to overcome the limitations for the diagnosis of Bonamia. As mentioned above, some morphological characteristics allow distinction between B. ostreae and B. exitiosa when histological sections are examined by trained staff. However in geographic areas, such as Galicia, where the bonamiosis of the flat oyster has been always attributed to B. ostreae (Montes and Lamas, 1992; Polanco et al.,

1984), the occurrence of a new Bonamia species could be unnoticed using official diagnostic methods. Other protozoan parasites of oysters, which were apparently introduced with infected aquaculture stocks, have been responsible for mass mortalities. Haplosporidium nelsoni (agent of MSX disease), which could have been introduced following the importation of Pacific oyster Crassostrea gigas (Burreson et al., 2000), caused mass mortalities of the native oyster Crassostrea virginica in Delaware and Chesapeake Bays (Andrews, 1980; Barber, 1997). There is also some evidence that the introduction of Perkinsus marinus (agent of Dermo disease) in the mid-Atlantic US and New England is a result of repeated shipments of oysters from enzootic southern waters of the USA (Ford, 1996). As stated above, Galician oyster farming is based on importation of oysters from different European countries to sell them after a short period of on-growing. At this point, epizootiological studies to identify affected areas and to evaluate the impact of B. exitiosa through the Galician coast and to check its occurrence in other European countries should be performed. Acknowledgements The authors are grateful to Ma Isabel Meléndez and Elena Penas for the technical assistance. This work was supported by Xunta de Galicia, under the projects PGIDIT05RMA50101PR and PGIDIT-CIMA06/01. Thanks are also due to the Ministerio de Educación y Ciencia for financial support to E.A. under the Programme Ramon y Cajal. References Andrews, J.D., 1980. A review of introductions of exotic oysters and biological planning for new importations. Mar. Fish. Rev. 42, 1–11. Anonymous, 2006. Dredge oyster (OYU5) — Foveaux Strait. Fisheries working group report to NZ Ministry of Fisheries. http://services.fish.govt.nz/ fishresourcespublic/Plenary2006 /OYU_5_06.pdf2006. Balouet, G., Poder, M., Cahour, A., 1983. Haemocytic parasitosis: morphology and pathology of lesions in the French flat oyster, Ostrea edulis L. Aquaculture 34, 1–14. Balseiro, P., Conchas, R.F., Montes, J., Gómez-León, J., Novoa, B., Figueras, A., 2006. Comparison of diagnosis techniques for the protozoan parasite Bonamia ostreae in flat oyster Ostrea edulis. Aquaculture 261, 1135–1143. Bannister, C.A., Key, D., 1982. Bonamia a new threat to the native oyster fishery. Fish. Nat. MAFF Direct. Fish. Res. 71, 7. Barber, B.J., 1997. Impacts of bivalve introductions on marine ecosystems: a review. Bull. Nat. Res. Inst. Aquaculture Suppl. 3, 141–153. Barber, B.J., Davis, C., 1994. Prevalence of Bonamia ostreae in Ostrea edulis populations in Maine. J. Shellfish Res. 13, 298. Berthe, F., Hine, P., 2003. Bonamia exitiosa Hine et al., 2001 is proposed instead of B. exitiosus as the valid name of Bonamia sp infecting flat oysters Ostrea chilensis in New Zealand. Dis. Aquat. Org. 57, 181. Bishop, M., Carnegie, R., Stokes, N., Peterson, C., Burreson, E., 2006. Complications of a non-native oyster introduction: facilitation of a local parasite. Mar. Ecol., Prog. Ser. 325, 145–152. Boulo, V., Mialhe, E., Rogier, H., Paolucci, F., Grizel, H., 1989. Immunodiagnosis of Bonamia ostreae (Ascetospora) infection of Ostrea edulis L and subcellular identification of epitopes by monoclonal-antibodies. J. Fish Dis. 12, 257–262. Bower, S.M., 2007. Synopsis of Infectious Diseases and Parasites of Commercially Exploited Shellfish: Bonamia ostreae of Oysters. http://www-sci.pac.dfo-mpo. gc.ca/shelldis/pages/bonostoy_e.htm2007.

E. Abollo et al. / Aquaculture 274 (2008) 201–207 Brehélin, M., Bonami, J.-R., Cousserans, F., Vivarés, C.P., 1982. Existence de formes plasmodiales vraies chez Bonamia ostreae parasite de l'huître plate Ostrea edulis. C. R. Acad. Sc. Paris, Ser III 295, 45–48. Bucke, D., 1988. Pathology of bonamiasis. Parasitol. Today 4, 174–176. Bucke, D., Hepper, B., Key, D., Bannister, R.C.A., 1984. A report on Bonamia ostreae in Ostrea edulis in the UK. ICES CM K9, 1–7. Burreson, E.M., Stokes, N.A., Friedman, C.S., 2000. Increased virulence in an introduced pathogen: Haplosporidium nelsoni (MSX) in the eastern oyster Crassostrea virginica. J. Aquat. Anim. Health 12, 1–8. Burreson, E., Stokes, N., Carnegie, R., Bishop, M., 2004. Bonamia sp. (Haplosporidia) found in nonnative oysters Crassostrea ariakensis in Bogue Sound, North Carolina. J. Aquat. Anim. Health 16, 1–9. Bush, A.O., Lafferty, K.D., Lotz, J.L., Shostak, A.W., 1997. Parasitology meets ecology on its own terms: Margolis et al. revisited. J. Parasitol. 83, 575–583. Campalans, M., Rojas, P., González, M., 2000. Haemocytic parasitosis in the farmed oyster Tiostrea chilensis. Bull. Eur. Assoc. Fish Pathol. 20, 31–33. Carnegie, R., Cochennec-Laureau, N., 2004. Microcell parasites of oysters: recent insights and future trends. Aquat. Living Resour. 17, 519–528. Carnegie, R., Barber, B., Culloty, S., Figueras, A., Distel, D., 2000. Development of a PCR assay for detection of the oyster pathogen Bonamia ostreae and support for its inclusion in the Haplosporidia. Dis. Aquat. Org. 42, 199–206. Carnegie, R., Burreson, E., Hine, P., Stokes, N., Audemard, C., Bishop, M., Peterson, C., 2006. Bonamia perspora n. sp (Haplosporidia), a parasite of the oyster Ostreola equestris, is the first Bonamia species known to produce spores. J. Eukaryot. Microbiol. 53, 232–245. Casas, S.M., La Peyre, J.F., Reece, K.S., Azevedo, C., Villalba, A., 2002. Continuous in vitro culture of the carpet shell clam Tapes decussatus protozoan parasite Perkinsus atlanticus. Dis. Aquat. Org. 52, 217–231. Cigarría, J., Elston, R., 1997. Independent introduction of Bonamia ostreae, a parasite of Ostrea edulis, to Spain. Dis. Aquat. Org. 29, 157–158. Cochennec, N., Hervio, D., Panatier, B., Boulo, V., Mialhe, E., Rogier, H., Grizel, H., Paolucci, F., 1992. A direct monoclonal-antibody sandwich immunoassay for detection of Bonamia ostreae (Ascetospora) in hemolymph samples of the flat oyster Ostrea edulis (Mollusca, Bivalvia). Dis. Aquat. Org. 12, 129–134. Cochennec, N., Le Roux, F., Berthe, F., Gerard, A., 2000. Detection of Bonamia ostreae based on small subunit ribosomal probe. J. Invertebr. Pathol. 76, 26–32. Cochennec-Laureau, N., Reece, K., Berthe, F., Hine, P., 2003. Mikrocytos roughleyi taxonomic affiliation leads to the genus Bonamia (Haplosporidia). Dis. Aquat. Org. 54, 209–217. Comps, M., 1983. Culture in vitro de Bonamia ostreae parasite hémocytaire de l'huître plate Ostrea edulis L. C. R. Acad. Sc. Paris, Ser III 296, 931–933. Corbeil, S., Arzul, I., Robert, M., Berthe, F., Besnard-Cochennec, N., Crane, M., 2006. Molecular characterisation of an Australian isolate of Bonamia exitiosa. Dis. Aquat. Org. 71, 81–85. Cranfield, H., Michael, K., Doonan, I., 1999. Changes in the distribution of epifaunal reefs and oysters during 130 years of dredging for oysters in Foveaux Strait, southern New Zealand. Aquat. Conserv.- Mar. Freshw. Ecosyst. 9, 461–483. Cranfield, H., Dunn, A., Doonan, I., Michael, K., 2005. Bonamia exitiosa epizootic in Ostrea chilensis from Foveaux Strait, southern New Zealand between 1986 and 1992. ICES J. Mar. Sci. 62, 3–13. Culloty, S., Cronin, M., Mulcahy, M., 2003. Possible limitations of diagnostic methods recommended for the detection of the protistan, Bonamia ostreae in the European flat oyster, Ostrea edulis. Bull. Eur. Assoc. Fish Pathol. 199, 67–71. da Silva, P., Villalba, A., 2004. Comparison of light microscopic techniques for the diagnosis of the infection of the European flat oyster Ostrea edulis by the protozoan Bonamia ostreae. J. Invertebr. Pathol. 85, 97–104. Doonan, I., Cranfield, H., Michael, K., 1994. Catastrophic reduction of the oyster, Tiostrea chilensis (Bivalvia, Ostreidae), in Foveaux Strait, New Zealand, due to infestation by the protistan Bonamia sp. N.Z. J. Mar. Freshw. Res. 28, 335–344. Elston, R.A., Farley, C.A., Kent, M.L., 1986. Occurrence and significance of bonamiasis in European flat oysters Ostrea edulis in North America. Dis. Aquat. Org. 2, 49–54. Ford, S., 1996. Range extension by the oyster parasite Perkinsus marinus into the Northeastern United States: response to climate change? J. Shellfish Res. 15, 45–56.

207

Friedman, C., Perkins, F.O., 1994. Range extension of Bonamia ostreae to Maine, USA. J. Invertebr. Pathol. 64, 179–181. Friedman, C.S., McDowell, T., Groff, J.M., Hollibaugh, J.T., 0Manzer, D., Hedrick, R.P., 1989. Presence of Bonamia ostreae among populations of the European flat oyster, Ostrea edulis Linné, in California, USA. J. Shellfish Res. 8, 133–137. Hine, P.M., Cochennec-Laureau, N., Berthe, F., 2001. Bonamia exitiosus n. sp (Haplosporidia) infecting flat oysters Ostrea chilensis in New Zealand. Dis. Aquat. Org. 47, 63–72. Howard, D.W., Smith, C.S., 1983. Histological techniques for bivalve mollusks. NOAA Technical Memorandum NMFS-F/NEC-25. Woods Hole, MA. Katkansky, S.C., Dahlstrom, W.A., Warner, R.W., 1969. Observations on survival and growth of the European flat oyster, Ostrea edulis, in California. Calif. Fish Game 55, 69–74. Kern, F.G., 1993. Shellfish health inspections of Chilean and Australian oysters. J. Shellfish Res. 12, 366. Kroeck, M., Montes, J., 2005. Occurrence of the haemocyte parasite Bonamia sp in flat oysters Ostrea puelchana farmed in San Antonio Bay (Argentina). Dis. Aquat. Org. 63, 231–235. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5, 150–163. López-Flores, I., Súarez-Santiago, V.N., Longet, D., Saulnier, D., Chollet, B., Arzul, I., 2007. Characterization of actin genes in Bonamia ostreae and their application to phylogeny of the Haplosporidia. Parasitol. 134, 1941–1948. Marty, G., Bower, S., Clarke, K., Meyer, G., Lowe, G., Osborn, A., Chow, E., Hannah, H., Byrne, S., Sojonky, K., Robinson, J., 2006. Histopathology and a real-time PCR assay for detection of Bonamia ostreae in Ostrea edulis cultured in western Canada. Aquaculture 261, 33–42. Mcardle, J., Mckiernan, F., Foley, H., Jones, D., 1991. The current status of Bonamia disease in Ireland. Aquaculture 93, 273–278. Medlin, L., Elwood, H.L., Stickel, S., Sogin, M.L., 1988. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 71, 491–499. Montes, J., Lamas, A., 1992. Present status of bonamiosis in Galicia (NW Spain). Bull. Eur. Assoc. Fish Pathol. 12, 131. Montes, J., Melendez, M., 1987. Data on the parasitism of Bonamia ostreae in the flat oyster of Galicia, Northwest coast of Spain. Aquaculture 67, 195–198. Office Internationale d'Epizootie, 2005. Dis. inf. 18 (47), 450. O'Neill, G., Culloty, S.C., Mulcahy, M.F., 1998. The effectiveness of two routine diagnostic techniques for the detection of the protozoan parasite, Bonamia ostreae (Pichot et al. 1980). Bull. Eur. Assoc. Fish Pathol. 18, 117–120. Pichot, Y., Comps, M., Tigé, G., Grizel, H., Rabouin, M.A., 1980. Recherches sur Bonamia ostreae gen. n., sp. n., parasite nouveau de l'huître plate Ostrea edulis L. Rev. Trav. Inst. Peches Marit. 43, 131–140. Polanco, E., Montes, J., Outón, M.J., Meléndez, M.I., 1984. Situation pathologique du stock d'huitres plates en Galice (Espagne) en relation avec Bonamia ostreae. Haliotis 14, 91–95. Renault, T., Stokes, N.A., Chollet, B., Cochennec, N., Berthe, F., Gerard, A., Burreson, E.M., 2000. Haplosporidiosis in the Pacific oyster Crassostrea gigas from the French Atlantic coast. Dis. Aquat. Org. 42, 207–214. Rogier, H., Hervio, D., Boulo, V., Clavies, C., Hervaud, E., Bachère, E., Mialhe, E., Grizel, H., Pau, B., Paolucci, F., 1991. Monoclonal antibodies against Bonamia ostreae (Protozoa: Ascetospora), an intrahaemocytic parasite of flat oyster Ostrea edulis (Mollusca: Bivalvia). Dis. Aquat. Org. 11, 135–142. Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. van Banning, P., 1982. Some aspects of the occurrence, importance and control of the oyster pathogen Bonamia ostreae in the Dutch oyster culture. In: Payne, C.C., Burges, H.D. (Eds.), Proceedings of the International Colloquium on Invertebrate Pathology XVth Annu Meet, Soc Invert Pathol. University of Sussex, Brighton, pp. 261–265.