Fish immunoglobulins and the genes that encode them

Annual Rev. of Fish Diseases, pp. 201-221, Printed in the USA. All rights reserved.

1992 Copyright

FISH IMMUNOGLOBULINS GENES THAT ENCODE

0

0959~x030/92 $5.00 + .Ml 1992 Pergamon Press Ltd.

AND THE THEM

Melanie R. Wilson Base1 Institute

for Immunology,

Grenzacherstrasse

487, Basel, Switzerland

Gregory W Warr Department of Biochemstry and Molecular Biology, Medical University of South Carolina, Charleston, South Carolina 29525, USA

AbsPucL The nature of fish antibodies (concentrating primarily on the most studied species of bony and cartilaginous fishes) is discussed in terms of their immunoglobulin biochemistry and immunobiology. The major serum immunoglobulin (IgM) is described in detail, and structural variants of IgM are discussed in terms of their distribution in different fish species, and different anatomical sites within a fish (e.g. blood, mucus, bile). Structural variation in IgM includes the size of the constituent heavy and light polypeptide chains, and the extent to which they are covalently associated with one another. The intramolecular heterogeneity of binding sites for antigen on IgM is reviewed and possible mechanisms for the phenomenon are presented. The evidence suggests that some, but not all, species of fish possess a detectable J chain in their IgM. The general nature of the fish immune response is that IgM antibody of moderate affinity is produced and prolonged or repeated immunization: (a) fails to produce a switch to production of a non-IgM class of antibody, and (b) fails to induce substantial increases in the affinity of the specific antibodies. Evidence supports a conclusion that fish lack the typical secondary antibody response seen in mammals, and possess antibodies of limited heterogeneity. Our current understanding of the genetic basis for fish antibodies is presented. Fish appear to utilize the same basic genetic elements as mammals to encode and regulate the expression of their immunoglobulins. The teleost heavy chain (IgH) locus resembles that of mammals and amphibia in its organization. The IgH locus of elasmobranchs is arranged in a unique multicluster organization. The light chain loci of elasmobranchs are organized analogously to the heavy chain locus (in multiclusters). The structure of the light chain locus of teleosts is presently unknown. Teleost fish utilize a unique pattern of RNA processing to generate the secreted and membrane receptor forms of the IgM heavy chain. The genes encoding the unique low molecular weight Ig heavy chain found in skates and rays have been cloned and sequenced, and also display the multicluster pattern of organization. Teleost fish appear to have normal numbers of variable regions: it is hypothesized (but as yet unproven) that the failure of their IgM to increase in affinity is due to a deficiency of somatic hypermutational mechanisms in their Ig gene variable regions during B lymphocyte differentiation.

Keywords.

Immunoglobulins, Gene recombination, Somatic

Antibodies, Genes, Fish, Teleosts, Elasmobranchs, hypermutation, Antibody diversity, Isotype

INTRODUCTION

IgH locus,

in the hagfish may, in fact, be more closely related to components of the complement system (7,7a). In the case of some of the other groups of fish (such as the sarcopterygian, chondrostean, and neopterygian) little new information has become available, since the initial studies conducted some years ago (S-10). For these reasons we concentrate here only on reviewing the antibodies and Ig genes of the elasmobranchs and the teleosts. We will attempt to emphasize what we consider to be the major features of the subject, and will refer to published studies accordingly. Obviously our opinion of what is important to review is personal and subject to debate. Similarly our selection of references from the vast amount of literature will involve omission of

Fish are a heterogeneous group of vertebrates that include hagfish, lampreys, cartilaginous fish, and bony fish; all of which are capable of mounting antibody responses (1). In recent years, much has been learned about the antibodies and the genes encoding them in the elasmobranchs and the teleosts. Information in the case of the hagfish and lampreys is still rather incomplete and difficult to interpret, in that the definitive characterization of the molecules in these species, described as antibodies or immunoglobulins (2-6) remains to be completed. There are some intriguing reports that the molecules identified as immunoglobulins (Igs) 201

202

M. R. Wilson and G. W. Warr

excellent studies that others would have considered important enough to note. We apologize in advance to those whose work in this field is not referenced. Our purpose in this review is to illustrate the major points rather than present an exhaustively comprehensive examination of them. ANTIBODY

RESPONSE

A number of noncontroversial generalizations can be made concerning the antibody responses of fish (in the context of the rest of this review, unless otherwise stated, fish means the elasmobranchs and the teleosts). First, upon immunization, fish produce antibodies with specificity and measurable affinity for the eliciting antigen, and biological properties such as agglutination, precipitation, complement fixation, opsonization, and skin sensitization (passive transfer by serum antibodies of immediate hypersensitivity reactions). Antibodies appear not only in the blood, but also in secretions such as bile and mucus. This “mucosal” immunity is often more readily elicited by exposure of the fish to immunizing agents in the aqueous environment, than by injection (11,12). Antibody responses of fish are generally affected by temperature: all else being equal, warm temperatures tend to produce better responses than cold temperatures. A detailed examination of the nature of the antibody response and the properties of the immunoglobulins of fish reveal, in some areas, a certain amount of controversy, confusion, and missing information, as will be noted in the following sections. SECONDARY

ANTIBODY

RESPONSE

OF FISH

Once a mammal has been exposed initially to antigen (primary immunization) its response to a second challenge with the same antigen is specifically altered. This anamnestic response may be lower than the primary response (or even nonexistent) if tolerance has been induced, but generally the response is better: there is a faster rise in titer, a faster shift to high affinity antibodies (so called affinity maturation [13]), and a rapid predominance of the lower molecular weight Igs (typically IgG in mammals). It is important to note that many of the above-listed features of the mammalian secondary immune responses are not found in fish antibody responses. 1. The predominant Ig in the blood of teleosts and most sharks is an IgM-like molecule. It consists of equimolar amounts of heavy (CL)and light (L) chains arranged in a basic unit containing 2 p

and 2 L chains. IgM exists either in polymeric forms, a tetramer (pcczL2),in teleosts, and a pentamer (p2L& in sharks, or in monomeric forms (p2L2) in sharks and some teleosts (reviewed in reference [l]). Low molecular weight Igs that are not apparently IgM monomers are observed in some of the teleosts (14,15), and in the rays (16,17). In the teleosts, where the antibody response has been studied quite thoroughly, there is no reason to think that these low molecular weight Igs are either the structural or functional equivalents of mammalian IgG. 2. Affinity maturation (the increase of antibody affinity with time after immunization) of the antibody response of fish has not been consistently shown, even in situations where immune responses were measured over long periods (1% 29, although some reports of affinity maturation can be found (26,27). The reason for these conflicting results is not clear, but it seems reasonable to conclude that fish are not able to give typical mammalian secondary antibody responses. In teleosts and sharks there is a lack of the characteristic switch to low molecular weight antibody, which is typically accompanied in the mammals by the emergence of high affinity binding antibodies. Whether or not the rays utilize their low molecular weight Ig in a manner analogous to that in which mammals utilize IgG, is unknown. However, under the appropriate conditions (e.g. type and dose of antigen), teleast fish clearly give a significantly elevated antibody response (a greater amount of serum antibody activity) upon second or repeated challenge with a given antigen (28-30). If investigators wish to call this phenomenon in fish a secondary response, it should be done with the realization that confusion with the mammalian secondary response (which it does not resemble in most respects) may arise in the minds of some readers. ARE ANTIBODIES

OF FISH RESTRICTED

IN HETEROGENEITY?

All the ectothermic vertebrates, including fish, are generally considered to show antibody responses in which the diversity of binding sites is significantly less than that found in the antibody response of mammals (3 1). A convenient measure of diversity is the number of bands seen upon isoelectric focusing of a population of antigen-specific antibodies. Such “spectrotypic” analyses of antibodies to trinitrophenol, penicillin, and bovine serum albumin in tenth (Tincutincu),goldfish (Carmssiusaurutus),

Fish immunoglobulins

and carp (Cyprinus carpio) yielded results that can certainly be interpreted to show restricted heterogeneity of the response (32-33). Difficulty can arise in establishing appropriate controls and rigorous quantitative methods to define “heterogeneity,” and studies such as these (32,33) probably also need to be interpreted in the light of the size of the study, the genetic relationships of the fish used, and cellular regulatory mechanisms that control the nature of the ongoing antibody response. The above referenced studies and studies in the horned shark (Heterodontusfrancisci) (34) also appear to show that antibody spectrotypes are very similar between different individuals of a given species. Thus, fish may display restricted antibody heterogeneity, not only as individuals but also as a population or species. One possible genetic basis of restricted heterogeneity could be a deficiency in the mechanism for diversification, e.g. a lack of Ig V-region-encoding gene hypermutation in the B lymphocyte population of fish and other ectothermic vertebrates (3 l), but no direct test of this hypothesis has yet been performed in fish. STRUCTURE OF THE HIGH-MOLECULAR WEIGHT IGM-LIKE ANTIRODY OF FISH The major plasma Ig found in fish is a molecule that is generally called IgM. It consists of -70,000 relative molecular mass (Mr) heavy chains (p) and -22,000-25,000 Mr light chains (L) in equimolar amounts. The basic repeating structural unit is p2L2, referred to as the monomeric form, which contains 2 antigen-binding sites (in Fig. 1, the IgM of the channel catfish, Ictalurus punctatus, is shown as an example). IgM has been isolated (and at least partially characterized) from many species of fish, both chondrichthyean and osteichthyean, and much of the earlier work is summarized and referenced (1). In Table 1 we give a partial listing of articles that have dealt with the isolation and characterization of Igs from a variety of teleost species. Whereas the high molecular weight IgM of elasmobranchs is a pentamer (21,22,26,27,49-52), containing 10 heavy and 10 light chains (p2L& (as in mammalian IgM), the high molecular weight IgM molecule in teleosts is a tetramer containing eight heavy and eight light chains, (pLzL& (8,14,15,19,20,35-48). Analyses of the nucleotide and inferred amino acid sequences of the heavy chains of fish IgMs (53-58, 65) do not indicate a particularly close relationship of the fish 1~chain to the heavy chains of prototypical mammalian IgMs (about 20-30% identity at the amino acid level, which is often not much

203

and genes

Table 1. Listing of some teleost species whose serum Ig has been characterized References Carp Goldfish Grouper Sheepshead Margate Toadfish Channel catfish Atlantic cod Northern pike Perch Gray snapper Plaice Rainbow trout Chum salmon Atlantic salmon Coho salmon Tenth

(Cyprinus carpio) ( Carassius aurutus) (Epinephelus itaira) (Archosargus probatocephalus) (Haemulon album) (Spheroides glaber) (Ictalurus punctatus) (Gadus morhua L.) (Esox lucius) CPerca fluviatilis 1 (Lutjanus griseus) (Pleuronectes platessa) (Oncorhynchus mykiss) (Oncorhynchus keta) (Salmo salar) (Oncorhynchus kisutch) ( Tinca tinca)

(35,36) (36-38) (15) (14) (39) (40) (8,41) (42) (43) (44) ii9j

(45) (38,40,46) (47) (48) (20) (32)

higher than the identity seen with other non-p heavy chains). Even so, calling this Ig molecule IgM is justified, based on more general features of gene organization and the physicochemical properties of the molecule rather than amino acid sequence comparisons alone. These features are listed below. The heavy chains are of a similar size (-70,000 Mr) to that of typical mammalian p chains. They also contain a high proportion (up to 16% or more) of carbohydrate (38,43,59). However, the carbohydrate composition of the teleost p chains differs from that of the mammalian p chains: the content of L-fucose is higher and the ratio of mannose to galactose is much lower. Nothing is known of the detailed structure of fish p chain glycosyl moieties beyond the bulk carbohydrate analyses and the identification of potential N-glycosylation sites in the inferred amino acid sequences (53,55,57,65). Fish IgMs resemble mammalian IgMs as complex polymeric molecules. As stated above, mammalian and shark IgMs both exist as pentamers, ( P~L~)~, and the teleost high-molecular weight IgM is tetrameric, (p2L2),. Fish IgMs generally resemble mammalian IgMs in electron microscopic analyses, i.e. they are apparently of similar sizes and circularly polymerized with the binding-site containing “arms” pointing out (8,35,40). The polymerization of mammalian IgMs involves an additional polypeptide, the J chain (60), whose absence can influence the number of monomers incorporated into the

M. R. Wilson

and G. W. Warr

Light chain Heavy

chain

Heavy

chain

Light chain

Fig. 1. Diagrammatic representation of the covalent structure of the tetrameric IgM of the channel catfish, Icctaluruspuncta&s based on the studies of Lobb (25), Lobb and Clem (41), and Ghaffari and Lobb (5657). The illustrated disulfide bonding pattern covalently linking all sixteen polypeptide chains together is only one of the probable patterns of disulfide bonding in this molecule (25,41,56,57). J chain is not shown. Abbreviations: VH, heavy chain variable region domain; CH, heavy chain constant region domain; VL, light chain variable region domain; CL, light chain constant region domain.

molecule. J chains can certainly be found in some fish high-molecular weight IgMs (61-64), although their absence has been reported in other IgMs. The apparent absence of the J chain in the IgM of some species of ray-finned fish, e.g. the gar (Lepisosteus osseus), paddlefish (Polydon spathula), pike (Esox lucius), and chum salmon (Oncorhynchus keta), (43,47, 61,62), may possibly be the result of an unusual net charge on the J polypeptide, which distorts its mobility in the gel electrophoretic assays routinely used to detect its presence (63). This is per-

haps unfounded speculation on our part and many fish polymeric IgMs may, in fact, lack a J chain. 3. The number of exons in the gene encoding the catfish p chain, and their organization, are identical and analogous, respectively, to that of the mammalian p gene (58). Furthermore, the sequence (both nucleotide and inferred amino acid) of the transmembrane region of the membrane (pm) form of known teleost p chains shows strong similarities to the same region of the mammalian p chain (58,65). Typically all

Fish immunoglobulins

vertebrate I” chains show strong conservation of the consensus sequence Lys-Val-Lys for the intracytoplasmic C-terminal tail of the pm chain. The channel catfish conforms to this consensus (58), but the Atlantic cod (Gadus morhua L.) shows a different sequence, Lys-Ile-Arg (65). The significance of this different sequence is not known. For these reasons, there seems little justification for calling the high-molecular weight antibody of fish anything but IgM. In the conformation in which it is drawn in Figure 1, the channel catfish IgM is shown as a single covalent molecule in which all eight heavy and eight light chains are held together by disulfide bonds. There is no reason to believe that this is the typical covalent structure of polymeric IgM in all teleosts. In fact, in many teleosts the polymeric form of the IgM is held together to some degree by noncovalent bonds. This state of affairs can be revealed by exposing the high-molecular weight IgM to denaturing conditions (sodium dodecylsulfate-containing buffers or high molarity [usually 6M] guanidinium chloride), under which circumstances polypeptides that are not covalently bound to one another (in this instance by disulfide bonds) will dissociate from the molecule. If reducing agents, such as 2-mercaptoethanol, are added as well to disrupt disulfide bonds, the polymeric IgM will dissociate into its constituent heavy and light chains. However, in the presence of denaturing agents (and the absence of reduction of disulfide bonds), the IgMs of some teleost species show dissociation into smaller molecular species. In the case of the channel catfish, for example, eight distinct molecular species are seen under denaturing conditions (25,41) These eight species correspond to a series of structures formed of multiples of a basic unit of a covalently linked (i.e. disulfide bonded) heavy-light chain pair, called by the authors (25,41) a “halfmer. ” This series of covalently linked structures in channel catfish IgM has been proposed to have the structures (pL),_s. It is only the (FL), form that is illustrated in Figure 1. The most likely explanation for this phenomenon is alternative patterns (isomerization) of the disulfide bonds involved in linking one heavy chain to another (56). A certain degree of noncovalent association of subunits in the high-molecular weight IgM of some other teleost species has been reported: for example, in the chum salmon covalent forms of (p2L2)i, (p2L2), have been reported

(P~L~)~, (P~L~)~, and (47), in the sheepshead

and genes

205

(Archosargus probatocephalus) ( p2L2)2 and (pcL2L2), forms have been found (14), and in the toadfish ( Spheroides glaber) forms consistent with ( p2L2)i , ( p2L2)z, and ( p2L2), covalent structures have been observed (40). Preliminary studies on the high molecular-weight IgM of the sheepshead indicate that the J chain is not present in stoichiometric amounts (14), raising the possibility that the J chain may be in some way involved in the assembly of the alternately disulfide-bonded forms of the polymeric IgM in this species. Noncovalent association will most likely prove a frequent feature of the high-molecular weight IgMs of teleost fish, but it is by no means universal: for example, the IgM of goldfish, Atlantic cod, and the rainbow trout (Oncorhynchus mykiss) is resistant to dissociation in the absence of disulfide bond reduction (32,40, 42,66,67). Two points are worth noting with respect to noncovalent association in the IgM of teleosts: first, individual heavy-light chain pairs are always, to the best of our knowledge, disulfide bonded, and only alternate patterns of heavy chain-heavy chain bonding are involved in the phenomenon. Second, even though in some teleost species the IgM may be held together partially by noncovalent associations, the molecule remains intact under physiological conditions. BINDING SITE HETEROGENEITY IN FISH HIGH-MOLECULAR WEIGHT IGM In principle, each of the heavy-light chain pairs of an IgM molecule contributes a single binding site for antigen. Therefore, elasmobranch IgM should possess ten identical binding sites and teleost IgM eight identical binding sites. While measurements of populations of fish antibodies have in some cases confirmed this (21), other studies have shown heterogeneity of binding site affinities, often such that approximately half the sites are of high affinity and half of the sites are of low affinity (18,22,26). Interestingly, a similar phenomenon has also been observed with mammalian IgMs (68,69). A series of studies by Clem and his collaborators (22,69,70) on binding-site heterogeneity in mouse, shark, and channel catfish IgM has indicated that intramolecular (as opposed to intermolecular) heterogeneity plays a significant role in this phenomenon (22,69, 70). The isolation by antigen-affinity chromatography of reductive monomeric IgM from the mouse and of channel catfish IgM (Fab’), fragments, both displaying only a single antigen binding site of high affinity, strongly supports this contention (69,70). The source of the heterogeneity in IgM

206

binding site affinity (22,69,70).

M. R. Wilson and G. W. Warr

is probably

CLASS AND SUBCLASS

conformational

VARIATION

IN FISH IGS

Their are at least four separate issues concerning potential class diversity of fish Ig: 1. Is the polymeric plasma IgM only of the single class (i.e. is there more than one p or p-like isotype)?; 2. Do the low molecular weight plasma Igs represent distinct classes?; 3. Are unique classes of Ig (analogous perhaps to mammalian IgA) found in the secretions (e.g. bile and cutaneous mucus) of fish?; and 4. Are there light chain isotypes? These issues are considered

separately

below.

Additional classes of polymeric IgM The enormous number of ,Uchain constant region genes in elasmobranchs (53,54) makes this issue rather complex, and could provide an explanation for the antigenic heterogeneity of IgMs observed in sharks (52). Therefore, we will discuss primarily studies in teleost fish. Trump (37) suggested that goldfish IgM displayed antigenic and electrophoretie heterogeneity, and recent studies on channel catfish and Atlantic salmon (Salmo salar) have also addressed this issue (23,71). In both these latter cases, structural variants of the high molecular weight IgM were detected antigenically using monoclonal antibodies (23,71). The variant IgMs were present in all individuals, and in the case of the channel catfish, antigenic data were supported by comparative peptide mapping and limited N-terminal amino acid sequencing. The presence in the catfish genome of sequences, additional to the cloned and sequenced ones, that cross-hybridized with probes for exons one and two of the p-chain gene has also been reported (57). While these results are consistent with the presence of additional heavy chain (p-like) isotypes, the issue is not yet settled beyond doubt. For example, the monoclonal reagents may be reacting with determinants in the variable (V) rather than the constant (C) regions of the heavy chains. There is also no evidence that the channel catfish DNA sequence, hypothesized to be encoding an additional isotype, is a functional gene. The report by Phillips and Ourth (72) of a channel catfish IgM-like molecule with a smaller heavy chain has not been confirmed by other studies in

this species (25,41), and its significance is uncertain. Clearly the issue of additional IgM classes in teleosts will be resolved only as more data become available. Low molecular weight Igs of plasma Many condrichthyean and teleost fish are known to express low molecular weight Igs. The situation in the rays, for example, is very clear: the low molecular weight Ig contains a heavy chain that is structurally and antigenically distinct from p chain (16,17). This low molecular weight Ig is expressed in different lymphocytes from the IgM molecule (73), and it has a heavy chain that appears to be encoded by a distinct gene, as will be discussed later. In the sharks and teleosts the situation is not so well understood. The low molecular weight Igs appear to be of two types in the sharks. One is very closely related, in the nature of its heavy and light polypeptide chains, to the high molecular weight IgM, and can probably be considered to be either a monomer of the high molecular weight molecule or else a form closely related to a monomer of the high molecular weight IgM (50-52,74). A second low molecular weight Ig described in some species of sharks (e.g. the nurse shark, Ginglymostoma cirratum, [75]) has a smaller heavy chain than ,U (-50,000 Mr), but additional data on its structure and antigenie relationship to IgM are needed. The situation with respect to low molecular weight Igs in the teleosts is also complicated. Evidence exists for low molecular weight plasma Igs in various teleosts that are either (a) monomeric forms of the tetrameric IgM (or very closely related to such monomers) (39,40), or (b) are physicochemically distinct from monomers of the high molecular weight (tetramerit) IgM, but may, nevertheless, be related to this molecule (14,15,46). In addition, some Igs that are structurally distinct from typical IgM can occur in the secretions of fish. Whether or not these Igs are also found in low levels in plasma has not been established. These Igs found in secretions will be discussed in a later section. If we accept that in shark plasma there is a low molecular weight Ig, which antigenically and structurally resembles a monomer of the IgM, then understanding the relationship between these pentameric and monomeric IgMs is important. The cysteine involved in polymerizing the pentameric IgM of the nurse shark has been identified, and a thermolysin peptide containing this cysteine was isolated (76). The identical peptide was also identified in the monomeric IgM heavy chain, leaving unresolved the

Fish immunoglobulins

question of significant structural differences between the monomeric and polymeric IgMs of sharks and the control mechanisms for assembly of the polymeric forms. The high and low molecular weight IgMs of sharks may be composed of identical monomeric units. The lack of in vivo interconversion (77) suggests that, during intracellular synthesis and assembly of the IgM, an unknown event determines whether or not monomer or pentamer is formed. Although rays and skates have been generally shown to possess predominantly a pentameric IgM (16,78), Dasayatis centroura was reported to possess an IgM that was dimeric, i.e. (P~L~)~ (79). However, when IgM from Dasayatis centroura was later analyzed on low concentration nonreducing sodium dodecylsulfate-polyacrylamide gel electrophoresis, its mobility was essentially identical to that of authentic pentameric IgM (67). Thus, the polymerization state of Dasayatis centroura IgM could be considered unresolved at the present time. Structurally and antigenically unique low molecular weight Igs in the nurse shark have been reported (75), but these results have not, to date, been confirmed or extended. Some species of teleost fish possess low molecular weight Igs related to the polymeric serum IgM. In some cases (e.g. the margate, Haemulon album, and probably also the toadfish, Spheroides glaber) the IgM closely resembles a monomer of the typical high molecular weight tetrameric IgM as based on antigenic properties and the general physicochemical characteristics of the molecules (3940). In other cases of low molecular weight Igs, the molecule is clearly physicochemically different from the p chain. In the giant grouper (Epinephelus itaira), rainbow trout and sheepshead, the heavy chain of the monomeric Ig is smaller than that of the typical p chain (Mr 40,000-52,000), and resembles a p chain with a mass deletion of Mr - 25,000. Whether this size difference results from a deletion in a duplicated p gene, alternate mRNA processing, or post-translational modification is unknown. Low molecular weight Igs are not universally reported for the teleosts. In addition to the papers cited above, there is a report of low molecular weight Ig in the goldfish (80), although other reports indicate that goldfish possess only tetrameric IgM (36,37). The factors governing monomeric IgM expression in teleosts are unknown. Low levels of monomeric IgM may be elevated under certain conditions of immunization and water temperature (39), but at present, there is no clear body of data supporting this hypothesis.

and genes

207

Antibodies of the secretory immune system of fish To the best of our knowledge,- all studies on fish secretory immunity have been conducted in teleosts, and our discussion will be limited accordingly. The skin immune system is obviously important as a first line of defense against infection because the body surfaces of fish are continuously exposed to the aquatic environment that they share with their pathogens (81). Many studies have been conducted, both in terms of basic investigations of a secretory system and practical immunization-oriented studies, however, we will not reference all of these studies here, since many of them are not strictly relevant to the topic. The paper by Lobb (12) provides many references to earlier work forthe interested reader. To summarize much of this work, antibody can be found in the mucus of fish skin (11,12,45,82-86), it appears in response to immunization, by both systemic and bath immersion routes (11,12,84), and it appears to be locally produced by skin lymphocytes rather than to be a transexudate of a plasma Ig (12,81,82,84). In a thorough study of the skin mucus antibody of the channel catfish, this Ig was found to be apparently indistinguishable from that found in the plasma (12). In contrast, mucus Ig of the sheepshead was heterogeneous, even though all the mucus Ig species possessed h and L chains similar to those of the tetrameric plasma Ig (83). While one population of sheepshead mucus IgM closely resembled the plasma IgM in physicochemical properties, a second population was dimeric (p2L,),. Part of this dimeric population was noncovalently bonded, giving p2L2 forms in dissociating conditions, and the remaining dimeric Ig was found covalently (disulfide) bonded to a Mr - 95,000 polypeptide that the authors suggested might be the equivalent of the secretory piece found in mammalian secretory Igs (83). The mucus Ig of the sheepshead was not, apparently, derived from either of the plasma Igs (82) and was, therefore, likely to have been produced locally. Studies on Igs of fish bile are limited; those on the sheepshead indicated that bile Ig: (a) was dimeric (H2L& under physiological conditions; but dissociated to monomers (HzL,) under denaturing conditions; (b) contained typical light chains but possessed a heavy chain smaller than p (-55,000 Mr); (c) did not express antigens that were not also present in plasma IgM; and (d) was not derived from tetrameric plasma IgM (83,87). The exact nature of sheepshead bile Ig and the relationship &it$&rgs(y_$ra&

M. R. Wilson and G. W. Warr

208

to the other two heavy chains found in sheepshead plasma Ig are unknown.

drawn from studies that are relevant to the topic of this review include:

Isotypes of light chains

1. Vertebrates, from fish to mammals, possess Ig genes that show a remarkable degree of structural similarity. This includes not only the utilization of V,, D, JH, and CH exons to encode the domains of the heavy chain (and V,, JL, and C, exons for the light chains), but also, for most vertebrates (including teleosts) the organization of multiple different V, genes into families sharing close relationships. 2. There are striking variations between the vertebrate classes in the way in which genes are arranged within the Ig heavy and light chain loci, and also in the specific manner in which they are expressed (53,58,93).

The multiple light chain genes of elasmobranchs make this topic difficult to discuss, if not redundant for this group of fish, and structural variation in elasmobranch light chain genes is discussed later in this review. At present, little is known about light chain genes in teleosts (SS), and the situation as it relates to the expressed proteins is interesting enough to warrant some discussion. Multiple light chain bands with Mr - 22,000-26,000 are seen when reduced fish Igs are analyzed in sodium dodecylsulfate polyacrylamide gel electrophoresis, indicating heterogeneity (40,41,43,66,89). This electrophoretic heterogeneity is reminiscent of the difference seen between mammalian kappa and lambda chains (go), and almost certainly must reflect isotypic variants of teleost fish light chains. Channel catfish possess two classes of light chain (called F and G), which support this interpretation. The two classes of light chain are distinguishable by monoclonal antibodies (89), and both associate with known heavy chain variants (71). These F and G light chains are present in all fish and account for essentially all of the plasma Ig light chain (71,89). The exact nature of teleost fish light chains will almost certainly emerge from ongoing studies at the molecular genetic level, and the results will be awaited with some anticipation. THE GENES

ENCODING

FISH ANTIBODIES

Over the past decade, the application of modern molecular genetic techniques to the study of antibodies in both mammalian and nonmammalian vertebrates has resulted in an understanding of: 1. the chromosomal organization of immunoglobulin genes; 2. the nature of the genetic rearrangements that accompany B lymphocyte development and result in the commitment of each B cell to a single antibody specificity; and 3. the manner in which both multiple V-domain encoding germline genes and somatic diversification mechanisms contribute to the observed wide variety of antibody combining sites. In addition, these studies have revealed that immunoglobulin genes have a very complex underlying structure, and many extensive reviews have been written on their organization and expression (9195). Perhaps the major conclusions that can be

The purpose of the following section is thus to give a brief review of fish immunoglobulin genes, their structure and organization, as understood at the present time. For a more detailed discussion on the possible evolutionary origins and history of immunoglobulin genes, see Litman et al. (96) and Amemiya and Litman (97). Gene organization and generation of diversity Until recently, researchers on fish Ig genes have concentrated their efforts on understanding the heavy chain genes. A major observation has been that in the teleosts the IgH locus appears to be organized similarly to the mammalian IgH locus, and therefore must utilize genetic rearrangements to produce a functional new gene (92,98,99). Figure 2 shows the prototypical mammalian IgH locus and the sorts of rearrangements involved in generating a functional gene: although not yet proven beyond all doubt, teleosts probably utilize rearrangements similar to that used in the mammalian IgH locus to generate a functional gene (Fig. 2, 99-101). Perhaps one of the best examples of Ig gene conservation in the vertebrates concerns the Vn genes (Fig. 3). All V, genes studied, to date, exhibit remarkable structural and organizational similarities in their coding regions as well as similarities in the noncoding regions (102-l lo), including regulatory regions and recombination signal sequences. Features common to nearly all vertebrate V, genes include: 1. The 5’ immunoglobulin promoter including a conserved octamer of consensus sequence ATGCAAAT and, 3’ of this, a weaker TATA box consensus sequence (111). The only exception

Fish immunoglobulins

VH genes

D segments

and genes

JH segments

209

C region genes

enhancer

0 promoter 0

VH s RSS ID J

0 class-switch signal

REARRANGED LOCUS

VH3

D3 JH2

JHn

Fig. 2. Diagrammatic structure of a prototypical mammalian IgH locus showing the DNA rearrangements cur to produce a functional, expressible IgH gene. Abbreviations: Vn, heavy chain variable sity segment; Jn, heavy chain joining segment; RSS, recombination signal sequence.

to this is found in the elasmobranchs, as first shown for the horned shark, and it is hypothesized that the unusual gene organization of elasmobranchs results in a different mechanism of regulation of gene expression in these animals (53954); An N-terminal 18-20 amino acid hydrophobic leader-encoding region split by an 80-120 base pair (bp) intron; An approximate 98 codon long region of 3 framework and 2 complementarity determining regions, with frameworks 1 and 3 each containing a cysteine that is involved in intrachain disulfide bonding; A 3’ signal sequence responsible for recombination (Vn-D joining), consisting of a heptamer motif, 22 or 23 bp spacer and a nonamer motif; and An internal cryptic recombination signal sequence of TACTGTG or its consensus, which is related to the heptamer motif of the conventional recombination signal sequence, and which permits Vn to VnDJn secondary recombination (112). The IgH locus is now at least partially characterized for five classes of vertebrates. Figure 4 shows

region

that ocgene; D, diver-

a comparison of the heavy chain gene organizations of mammals (113), sharks (53,54), chickens (93, 114,115), and bony fish (55-58,101,116). The teleost organization for the Vn, D, Jn, and C regions encoding both secretory p chains (ps) and membrane p chains (pm) is essentially like that of the mammals (Fig. 4b). There are multiple Vn’s, an unknown number of D’S, multiple Jn regions (at least six JH genes in the channel catfish (100,101, 117, and Wilson and Wan-, unpublished), and a single Cp constant region (56,57). The overall length of the teleost IgH locus is still unknown. The channel catfish and the ladyfish Elops saurus are the two species most thoroughly studied in terms of their heavy chain genes. Vn genes have been isolated and characterized in the rainbow trout (108), and the goldfish (109). Immunoglobulin heavy chain cDNAs from the Atlantic cod (65) and the Atlantic salmon (118) have been sequenced. As in all the other species, teleost V, genes fall into characteristic multigene families and the members of each family are related to one another by significant sequence similarity (280%) at the nucleotide level (103). Six distinct Vu families have been described in the channel catfish (100,117). These families appear to be quite large, as evidenced from Southern blotting, with a low estimate of 25 genes in each (see

CDRl

CDRZ

Fig. 3. Diagrammatic structure of a typical vertebrate V, gene. Abbreviations: Pr, promoter; gions; CDR, complementarity-determining regions; RSS, recombination signal sequences.

FR, framework

re-

M. R. Wilson and G. W. Warr

210

1: MAMMALS ( and the amphibian Xenopus )

VHI-n

JHl-n

Dl-n

CONSTANT I-

~GIONS

+

4 about 2ooO kb

2: CHICKENS

pSd0

VH

I Ii VH l-n

I

I,,

II I

CONSTANT

JH

REGIONS

m

60-8Okb

I I I I” I I I I-

w

4 30kb

(V-D-D-J-C ) l....

3: SHARKS

Ds

?kb

(V-D-D-J-C) n

I I I ‘[II I I I

approx 1Okb

(a)

JH Region

Cleavage/polyadenylation

signals

Enhancer-lie sequences: ATGCAAAT, TGGTITG etc. consensus. E, Eco Rl H, Hid III S,Sall

\ Repeat sequences present, bur no clear relationship to class-switch signals.

(b) Fig. 4. Comparison of the overall structures of the IgH loci of diverse vertebrates. (a) The IgH locus of a typical mammal (mouse), the domestic chicken, and the horned shark are shown. Based on the work of Reynaud et al. (93,114,115) for the chicken, Kokubu et al. (53,54) for the shark, and Du Pasquier and co-workers (120,138) and Schwager et al. (110) for Xenopus. Abbreviations: V, variable region gene; D, diversity segment; J, joining segment; kb, kilobase pairs. (b) Partial structure of the catfish IgH locus as defined by the studies of Ghaffari and Lobb (101) and Wilson et al. (58, and unpublished). The catfish V, genes and D segments have not been mapped definitively but are presumed to be 5’ of the JH regions as in the mammals (see Fig. 2).

[ 1001 for a detailed discussion and sequence analysis of catfish V, families). Other VH families may be discovered in this species since the initial searches have not been exhaustive (loo,1 17). In contrast to the channel catfish, the V, genes of other teleost species have not been as intensively studied and this seems a likely reason for the low number of de-

scribed families in these other species, e.g. one in the trout, two in the ladyfish, and three in the goldfish (55,108,109). The number of VH families in these species will almost certainly increase with further studies. Channel catfish possess a minimum of 140 VH hybridizing elements, but how many of these ele-

Fish immunoglobulins and genes

ments are functional is unknown. Initial studies in the ladyfish and the goldfish indicate a prevalence of pseudogenes. The first two genomic Vu sequences cloned in the ladyfish were pseudogenes (55), as were four out of the five genomic Vu sequences cloned in the goldfish (109). A third rainbow trout Vu gene cloned by Andersson and co-workers is also a pseudogene (119). At the moment it is not clear if this high occurrence of pseudogenes is relevant or if it is common to other teleost fish. It is possible that these findings of pseudogenes are unrepresentative because of the relatively small number of sequence samples, or because a heterologous mammalian Vn probe (mouse S107) was used initially in two of the cases to identify fish Vn genes (55,109). Knowing the proportion of functionally expressible variable region genes in these species may be important if, as has been suggested, lower vertebrates such as fish and amphibia lack, or are deficient in, somatic hypermutation or other Ig sequence diversification mechanisms (31), and are, therefore, particularly dependent on their germline repertoire for the generation of antibody diversity. Heterologous DNA/DNA hybridization has been used frequently to isolate variable region (V,) genes (94,96,97,106,107). A Vn probe from one teleost species can be used to probe for related V, genes in another teleost (Fig. 5). Cross-species probing with C region genes is less likely to be successful than when Vn genes are used unless the two species are relatively closely related. Paradoxically, C region sequences vary more between species than do V region sequences! The third hypervariable region of a heavy chain polypeptide variable (V) domain is primarily encoded by the D and Ju segments. Identifying regions of sequence conservation among different vertebrates, including the fish, is possible (120). The most conserved part of the JH genes begins at the tryptophan codon, at the start of framework 4 (55, 100,117). In the channel catfish at least six Jn genes have been deduced from cDNA sequences (100,117). The 3’ most Jn has been sequenced and mapped (101,116, Figs. 4b and 6). This JH gene encodes 17 amino acids and is flanked 5’ by the characteristic nonamer and heptamer sequence for D-Jn joining (l13,121,122a). So far, the presence of D genes in teleosts is inferred only by inspection of cDNA sequences (65,100,l I7), and definitive proof will have to await their sequencing in the germline. Although full length cDNA sequences for the heavy chain of several teleosts are known, the constant region of only a single gene (p chain) in the channel catfish has been cloned and sequenced

211

Fig. 5. Detection of Vn-related sequences by using a heterologous probe. DNA from individual channel catfish (numbered l-4) was digested to completion with EcoRI, electrophoresed on an agarose gel, Southern blotted to nitrocellulose paper and hybridized with a 32P-labelled DNA probe for goldfish V, gene 99A (109). The blot was washed at low stringency, and after approximately 72 hours exposure to X-ray film, clearly shows Vn-cross hybridizing sequences of the channel catfish. High stringency washing resulted in a loss of the signal, indicating that channel catfish and goldfish V, sequences probably differ in sequence by at least 20% overall. The appearance of typical mouse Vn families in Southern blot analyses can be compared in the Riblet et al. articles (95,145,153).

(58,101, Fig. 4b). Southern blot analysis indicated that channel catfish possess additional genomic sequences related to the characterized CHl and CH2 exons (57). Sufficient data are not presently available to allow us to draw any firm conclusions about

212

M. R. Wilson and G. W. Wan

the possible existence of additional functional heavy chain isotype-encoding genes in this species. Comparison of the cloned channel catfish ~1chain gene (58) with cDNA sequences and Southern blot analyses (56,57) suggests that this is the major (and to date the only) heavy chain gene that is expressed in this fish. Several studies have recently extended our knowledge of the organization of the IgH locus in the channel catfish. Sequencing upstream of the CHl exon (101,116) (Figs. 6 and 7) has shown that the closest Jn region is approximately 1.9 kilobase pairs (kb) 5’of the CHl exon. Ghaffari and Lobb (101) isolated a recombinant genomic lambda phage clone containing a part of the IgH locus that enabled the mapping of the extent of the JH cluster. Earlier studies of Amemiya and Litman (55,97) on the ladyfish IgH locus also showed a short Jn to CHl intron, and it seems likely that this will be the common feature of all teleost IgH loci. The Ju to CHl intron is too short to contain a class-switch recombination sequence analogous to that known in other vertebrates (see below). This fact, confirmed by inspection of the sequence of the intron (101, and the unpublished data of Wilson and Warr, presented in Figs. 6 and 7) suggests that if additional immunoglobulin classes do exist in the channel catfish, as may be possible (56,71), their expression most certainly does not involve the typical class-switch DNA rearrangement demonstrated in the mammals (122,123). The degree of sequence similarity between inferred amino acid sequences of channel catfish CHl, 2,3, and 4 domains and those of other vertebrates has been examined (57,58,65). The CHl and CH4 domains are the most phylogenetically conserved, with CH4 having the higher amino acid identity values. Reasons for this are not clear, although they may relate to the role of the CH4 in polymerization of the IgM molecule, or other conserved secondary biological functions. Quantitative gene titration experiments have also shown that channel catfish possess only a single genomic copy of the p gene along with multiple copies of Vn genes (56). Likewise, Amemiya and Litman (55) reported that multiple Vn genes, but only one copy of a Cn gene, could be defined in the ladyfish. Quite similar results have also been obtained recently with Vn and Ccl probes in Southern blot analysis of Atlantic cod genomic DNA (65). All of the data now indicate that teleost fish possess an IgH locus arranged analogously to that of the mammals (compare Figs. 2 and 4), but with apparent paucity of Cn genes (perhaps only one, the p gene), and the distinctive short Jn to CHl intron. Because this intron contains, in mammals, an enhancer for the IgH locus, as well as the class-

switch sequences, we will discuss it below in more detail. The JH to CHl intron The mammalian immunoglobulin heavy chain locus possesses an enhancer that lies between the JH cluster and the CHl exon of the or.gene (124) and an additional enhancer 3’ of the constant region gene, at least in the rodents (125). In contrast, multiple promoters are present, each one lying upstream of a functional Vu gene (111,126). The production of a functional heavy chain gene is the result of the rearrangement of the IgH locus (Fig. 2); the rearranged Vu promoter is brought closer to the Jn-CH intronic enhancer (within a few kb), and this close proximity is thought to permit the enhancer to drive expression of the rearranged heavychain gene. Both promoter and enhancer are B cell specific (124-128). The IgH promoter activity has clearly been shown to reside in the octamer sequence ATGCAAAT ( 126,129)) and as mentioned above, this sequence is observed upstream in teleost Vn genes. The mammalian IgH enhancer has been studied in great detail; it has been mapped, sequenced, the functional core has been defined, and B cell proteins binding specifically to the enhancer (and to the octamer promoter), and which are almost certainly involved in the regulation of heavy chain gene expression, have been described (124,125,127,130). The Jn to CHl intron of the channel catfish has been sequenced (101, and Wilson and Warr unpublished data shown in Figs. 6 and 7). The approximately 1.9kb intron contains consensus enhancer-like sequences, and consensus transcription factor-binding sequences, analogous to identifiable regions in the mammalian locus (and other genes). These motifs include the octamer ATGCAAAT (or its reverse complement), GTGGTTT, CCAGGTGGA (131-133), and the (TC), repeat, or GAGA elements (134). The two known sequences of this intron (10 1, and Wilson and Warr , unpublished) show differences (overall about 4070), including some in potential regulatory sequences such as the (TC), repeat (Figs. 6 and 7). The significance of these differences is not known but it seems likely that they are reflections of straightforward allelic variation, and may be the result of slippage and mismatch events during DNA replication (135,154). Confirmation of function and closer identification of the channel catfish IgH enhancer will require direct assessment of its influence on B cell specific gene expression, which has not yet been reported.

Fish immunoglobulins

and genes

1

~TCGCGT~~TAAAACAAACACCATATTAT

101

GTTGCGd

201

....... ......... TAGTTTAGTGTATTGAGGTGTGCTGTAAGCTTGAGCACTGTGT~TT~~A-MXXUXTAAG NWAFDYWGKGTAVTVTS

301

TAATTCAGCGCrmACCGTAAACmAmCTCTGCTCATAAAGT~TATAT~T~T~~TGT~~~C~~AT~~~~

213

AATGATGTGcGTCTTAAGcrT~~T~TAATArr

601 701 801 900 1000

ATAATAATAT AAAAAAAAAAAI----TTAAAAAGCACCGTTGGATA~GTAGT~T~G~CGTA~CT~CTC~CffiTAGTAT~T~TA AAAAA T

1188

ATTGCTCGAmCGATGTAAAATAAACAATA~ATATmAACC~T

1288

ACAAATGCGmrrATATAAAGAAATCAAGTmATTAGTmGmGG

1369

GTAGCTTACGAGAACU;ATGAAATCGTAAGT~C~A~T~~~~~~TC~~~ATGT~~C~~T

1469

TCAGTTGTAAAACTGCG7TCGAAGmGCGCGAGAGGAT[TGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATAGTATGTATGTATGTA

1568

TAGTATGTATGTATGTATGTATGTATGTATAGTATGTATGTATGTATGTATGTATGTATAGTATGTATGTATGTATGTATGTATGTATGTATAGTATGTA

1668

TGTATGTATGTATGTATGTATGTAffiTATAGTATGTATGTATGTATGTATGTATAGTAITGCATGTTGGCTATGTAmG~ATGmATCAAGAAA

1967

TAGAGMAAACAATGTTGAT

2067

CTCTCTCTCTCTCTCTCTCTCTC;CTCTCTCTCTCTCT ________________

--TAATCTTAATCTTAATCTTG

A

TA~AATAAAAATGT~C~~A~~~TG~~~GT~T~~ATCTCT

A

--__-_

--

Fig. 6. Nucleotide sequence of the most 3’ JH region and the JH to CHl intron of the Ig heavy chain locus of the channel catfish. The sequence of the authors is shown. Symbols below the sequence indicate differences from that published by Ghaffari and Lobb (101). Dashes ( - ) denote deletions introduced manually to allow alignment of the sequences, and base changes are indicated by upper case letters. The arrows (1) above the line indicate areas where differences in the two sequences occur in regions of repeat sequences, and may have resulted from slipped-strand misparing during DNA replication (135,154). The heptamer and nonamer signal sequences for D to JU joining are indicated by underlining and overlining. The bases encoding the J region (base pairs 244 to 294 ) are in bold type and the encoded amino acids are shown in single-letter code below the first base of each codon. The acceptor splice site for the CHI exon is indicated by /. Examples of sequences showing similarity to known IgH enhancer motifs are underlined (see also [IO11 for a more detailed discussion of enhancer-like sequences). The brackets [ ] enclose the area of the major repeat sequences, which are shown in detail in Figure 7. The EMBL and GenBank accession numbers of these sequences are, for the authors’ sequence, X65182, and for that of Ghaffari and Lobb, M74041.

Alternate

&pm

splicing

During B cell development there is a switch from the initial predominant expression of membrane (pm) heavy chain to the almost exclusive expression

of secretory (ps) heavy chain in plasma cells. This switch between membrane and secreted p chain forms involves utilizing two additional p gene exons that encode the membrane-spanning domain. Alternate mRNA processing determines whether

M. R. Wilson and G. W. Warr

214

1503

TGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATAGTATGT~TGTATGTATAGTATGTATGTATGTATGTATGTAT-GTATAGTA TGTATGTATGTATGTATGTATGTATGTATGTATGTATGTATGTAT-GTATGTGTGTATGTATAGTATGTATGTATGTATGTATGTATAGTAT-GTA

1600

TGTATGTATGTATGTATGTATGTATAGTAT-GTATGTATGTATGTATGTATGTATGTATAGTATGTATGTATGTAT-GTATGTATGTATGTA~TA TGTATGTATGTATGTATGTATGTAT-GTATAGTATGTATGTATGTATGTATGTATGTAT-GTATGTATGTATGTATAGTATGTATGTATGTATGTA

1696

TAGTATGTATGTA-----------------TGTATGTATGTATAGTA T-GTATGTATGTACGTATAGTATGTATGTATGTATGTATGTATAGTA

Fig. 7. Major repeat region of the JH to CHl intron, as indicated by the brackets in Figure 6. The sequence of the authors (top line) is aligned with that of Ghaffari and Lobb (101) beneath. The dashes ( - ) indicate gaps introduced into the sequences manually to permit alignment. The arrows (1) indicate base changes. The frequent occurrence of gaps in this repeat-rich region, in which there is an overall 11.5% difference in the two sequences, is consistent with slipped-strand mispairing having occurred during DNA replication (135,154).

the ps or the pm form of the polypeptide is expressed. In most vertebrates, the pattern of exon splicing is identical (136,137). Teleosts possess the two extra transmembrane-domain encoding exons (TM1 and TM2) (Fig. 4 and [%I), but their pathway of mRNA processing is very different from the typical vertebrate one (Fig. 8). Sequence comparisons show that identity values for the transmembrane domains in different vertebrates are high: for TM1 the channel catfish shows between 38 and 42% amino acid sequence identity to the TM1 of Atlantic cod, mouse, horned shark (53,58,65,136,138). The TM2and Xenopus encoded sequence of Val-Lys is almost invariant in vertebrate pm chains (102), the exception being the Atlantic cod with Ile-Arg (65). In contrast to this sequence conservation, the mechanism by which this domain is expressed in teleost fish appears to be unique among the vertebrates. In the typical vertebrate constant region gene, the pm message is generated when the TM1 exon is spliced into a cryp-

tic site within the CH4 exon. This is not the case in the channel catfish; instead, as shown in Figure 8, the TM exons are spliced directly into the CH3 donor splice site, eliminating the CH4 exon (58, 139). This splicing pattern produces a characteristically smaller pm polypeptide (Fig. 8, [58]). This unusual splicing for production of pm heavy chain will probably prove to be general to all teleosts. The evidence for this is:

1. A pm cDNA clone from the Atlantic cod has the same apparent splice pattern of CH3 to TM1 (65); 2. Although pm cDNA has not been studied in the ladyfish, there are no identifiable internal donor splice sites in the CH4 exon of this species (55), as is also observed in the Atlantic cod and channel catfish (58,65); and 3. The pm form of the IgM heavy chain of the goldfish migrates faster, using double label techniques in SDS-PAGE, than does the pm form

CATFISH

3’

Splicing

Ior p3

Splicing

for pm

Cleavage/ polyadenylation

_ SHARK

Fig. 8. Diagrammatic comparison of the mRNA splicing pathways sage in the channel catfish and mammals, amphibia and sharks.

for the alternate

production

. of @s and pm mes-

Fish immunoglobulins

(an apparent Mr difference of 10,000) (140). Analysis of lymphocyte surface-labelled IgM in the rainbow trout by similar methods also showed significant p-chain associated radioactivity migrating faster than the I.CSstandard (141). The reason for the deletion of the CH4 exon from the pm message in the channel catfish (and other teleosts) is unknown. The functional significance of the loss of the CH4 exon is also unknown, but it is probably of little or no consequence, since channel catfish (and other teleost) B lymphocytes appear to be, in many respects, functionally equivalent to their mammalian counterparts (142-144). If, as is usually assumed, the p chains of mammals and teleosts were evolutionarily derived from a single ancestral gene, then the subsequent 300 million or so years of separation have produced significant divergence. The changes include a much longer JH to Cp.1 intron in mammals (and most other vertebrates) to accommodate the class-switch recombination sequences necessary for the expression of the additional heavy chain genes, and the utilization of a different pre-mRNA processing pathway to produce the pm message (5865,139). These differences collectively suggest that the teleosts may have passed through a genetic bottleneck early in their evolutionary history, because the acquisition of unusual genetic characteristics, such as the CH3/ TM1 splice pattern for pm production, would be unlikely to occur twice or more in distinct populations.

Light chain genes Very few genetic data are available on teleost light chains. Only cDNA clones, corresponding to the constant region of a light chain in the Atlantic cod, have been sequenced. The predicted amino acid composition of this light chain constant region shows 30-36% similarity to other known vertebrate light chains (88). The organization of the teleost light chain locus, information on the genes encoding different isotypes (89), and the number and organization of Vr genes are presently unknown. ORGANIZATION OF IG GENES IN CARTILAGINOUS FISH

Heavy chain gene organization Litman and co-workers are responsible for most of our current knowledge of elasmobranch immunoglobulin genes: their structure, organization, and evolutionary comparisons. There are excellent and recent reviews on the evolution of immunoglobu-

and genes

215

lin genes, which discuss the elasmobranchs in detail (94,96,97), and so only a brief summary follows here. The elasmobranch IgH germline organization is much different from the Ig gene organization found in mammals, amphibians, birds, and in the bony fish (Fig. 4). In the horned shark, the heavy chain genes are organized as repeating clusters of an unrearranged Vu, two D, one Ju, and one C,W,which can be written as (VHD1D2JHC~). This pattern of unrearranged genes is repeated many times, perhaps hundreds, and the clusters, although varying in size, are approximately 16kb in length. The complete rearranged heavy chain is transcribed, just as in the mammals, only after intervening DNA between the Vu and D, , Dz and JH are deleted. Fifty percent of the clusters contain partially rearranged VuD-J, or VuDJ, completely joined genes (53,97). Identical VuD-Ju and VuDJ, joined genes have also been isolated from nonlymphoid tissues (liver and gonad). The completely joined (VuDJ,) genes are always in the correct reading frame. These genes may not be the result of normal somatic rearrangement, and may not even be expressed (96,97). The Cp exons are organized in essentially the same pattern as found in all other vertebrate Cps. There are four exons for the secretory p chains (CHl to CH4) and two additional transmembrane-domain encoding exons. Out of 186 clones, only 20% of the Cps appeared to be identical (54,96,97). The differential mRNA splicing mechanism, which regulates transcription of the secretory versus transmembrane p forms, appears to be the same as that found in mammals (54,94,137) (Fig. 8). An IgH cluster type of arrangement is also found in the little skate, Raja erinacea, an elasmobranch related to the shark but belonging to a different order. The nonrearranged clusters (as in Heterodontus) are approximately 16kb in length. However, Litman and co-workers believe this length may only be coincidental; the similarity in cluster sizes is accounted for by a longer J,-CHI intron in Heterodontus, and by longer introns between the Cp exons in Raja (145a,146). Elasmobranch Vu genes, although typical vertebrate Vu genes (see Fig. 3), do not have the B cell specific regulatory octamer of other Vus. The as-’ sumption is that this octamer is probably not needed because of the close proximity of the heavy chain genes within a cluster. If this is so, it suggests that cartilaginous fish must use a different mode of IgH regulation. The cluster types of organization would seem to have the possibility of limiting combinatorial diversity. Few experimental data are available

M. R. Wilson and G. W. Warr

216

on the regulation of immunoglobulin gene expression in cartilaginous fish, but, like bony fish, they are considered to exhibit limited immunoglobulin diversity (24,34,147,148). Litman and co-workers have recently isolated both cDNA and recombinant genomic phage clones from the ratfish, Hydrolagus colliei, a representative of the holocephali. Structural similarities in its V,, JH, and CH genes to shark and skate genes were found (97). Elasmobranch

light chain genes

Light chain cDNA clones have been isolated from both the horned shark (149,150), and the sandbar shark, Carcharinusplumbeus (151). The predicted amino acid sequences from both species appear to be more closely related to mammalian lambda chains than to kappa chains. At the genomic level, Heterodontus V,, JL, and C, genes, like the heavy chain genes, are organized in multiple clusters. The genes are always in close linkage, approximately 2.7kb, and no joined germline genes are found (150). In the sandbar shark, restriction mapping and Southern blot analyses indicate a cluster size of 5kb. Unlike the horned shark, the sandbar shark has internal variation of spacing distance between the genes within the individual clusters and at least five different types of light chain encoding clusters are predicted (152). Shark V,s exhibit the typical features of mammalian V,s, including the characteristic 3’ recombination signal sequences, separated by the 12bp spacer for JL joining and (unlike the heavy chain) they possess the regulatory octamer 5’ of the initiation codon, ATTTGCAT, or its inverse complement (111).

would (146). heavy in the

Acknowledgments- Research reported in this article was supported in part by grants from the National Science Foundation (DCB 8709877 and DCB 9106316). We thank Drs. J. Robert and L. Du Pasquier for helpful comments on the manuscript, Drs. S. Ghaffari and C. Lobb for prepublication access to their data, Brad Magor for permission to use his illustration in Figure 8, and MS Janette Millar for expert secretarial assistance. The Base1 Institute for Immunology was founded and is supported by F. Hoffmann-La Roche Ltd., Basel, Switzerland.

REFERENCES 1. Warr, G.W., Marchalonis, J.J. (1982). Molecular ba-

2.

3.

4.

5.

6.

A second heavy chain isotype in elasmobranchs As discussed in the first section of this review, sharks are generally considered to express only IgMtype antibody, whereas the skates clearly possess a second class of low-molecular weight antibody. A cDNA clone, believed to represent this second heavy chain isotype in the little skate has been isolated and sequenced (146). The inferred amino acid sequence is consistent with three immunoglobulin domains called by the authors V,x-Cxl-Cx2. The 3’ end of the Cx2 domain contains a cysteine rich region (5 of 44 residues), which may be a secretory element. Genomic Southern blots hybridized with Vx and Cx specific probes indicate that these genes are probably members of multigene families. The predicted amino acid sequence of the cDNA clone

encode a heavy chain with an Mr - 40,000 This agrees with the predicted Mr of the chain of the second class of Ig (IgR) detected spiny rasp skate, Raja kenojei (16,17).

7.

7a.

8.

9.

10.

sis of self/non-self discrimination in the ectothermic vertebrates. In: Cohen, N., Sigel. M.M. teds.) The Recticuloendothelial system: Acomprehe&ivetreatise. 3. Phylogeny and ontogeny. Plenum, New York, pp. 541-567. Raison, R.L., Hull, C.J., Hildemann, W.H. (1978). Characterization of immunoglobulin from the Pacific hagfish, a primitive vertebrate. Proc. Natl. Acad. Sci. USA 75: 5679-5682. Varner, J., Neame, P., Litman, G.W. (1991). A serum heterodimer from hagfish (Eptatretus stouti) exhibits structural similarity and partial sequence identity with immunoglobulin. Proc. Natl. Acad. Sci. USA 88: 1746-1750. Marchalonis, J.J., Edelman, G.M. (1968). Phylogenetic origins of antibody structure. III. Antibodies in the primary immune response of the sea lamprey, Petromyzon marinus. J. Exu. Med. 127: 891-914. Hanley; P.J., Seppelt, I.M.; Gooley, A.A., Hook, J.W., Raison, R.L. (1990). Distinct Ig H chains in a primitive vertebrate, Eptatretus stouti. J. Immunol. 145: 3823-3828. Kobayashi, K., Tomonaga, S., Hagiwara, K. (1985). Isolation and characterization of immunoglobulin of hagfish, Eptatretus burgeri, a primitive vertebrate. Mol. Immunol. 22: 1091-1097. Kurosawa, Y., Hashimoto, K., Ishiguro, H. (1991). Isolation of MHC genes from carp and shark, and a gene for a complement from hagfish. Proc. Jpn. Assoc. Dev. Comp. Immunol. 3: All. (Abstract). Ishiguro, H., Kobayashi, K., Suzuki, M., Titani, K., romonaga, S., Kurosawa, Y. (1992). Isolation of a hagfish gene that encodes a complement component. EMBO J. 11: 829-837. Acton, R.T., Weinheimer, P.F., Hall, S. J., Niedermeier, W., Shelton, E., Bennett, J.C. (1971). Tetramerit immune macroglobulins in three orders of bony fish. Proc. Natl. Acad. Sci. USA 68: 107-l 11. Marchalonis, J.J. (1969). Isolation and characterization of immunoglobulin-like proteins of the Australian lungfish (Neoceratodus forsteri). Aust. J. Exp. Biol. Med. Sci. 47: 405-419. Litman, G.W., Wang, A.C., Fudenberg, H.H., Good, R.A. (1971). N-terminal amino acid sequence

Fish immunoglobulins

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

of African lungfish immunoglobulin light chains. Proc. Natl. Acad. Sci. USA 68: 2321-2324. Fletcher, T.C., White, A. (1973). Antibody production in the plaice after oral and perenteral immunization with Vibrio anguillarum antigens. Aquaculture 1: 417-428. Lobb, C.J. (1987). Secretory immunity induced in catfish, Zctaluruspunctatus, following bath immunization. Dev. Comp. Immunol. 11: 727-738. Eisen, H.N., Siskind, G.W. (1964). Variations in affinities of antibodies during the immune response. Biochemistry 3: 996-1008. Lobb, C.J., Clem, L.W. (1981). Phylogeny of immunoglobulin structure and function. X. Humoral imArchosargus munoglobulins of the sheepshead, probatocephalus. Dev. Comp. Immunol. 5: 271-282. Clem, L.W. (1971). Phylogeny of immunoglobulin structure and function. IV. Immunoglobulins of the giant grouper, Epinephelus itaira. J. Biol. Chem. 246: 9-15. Kobayashi, K., Tomonaga, S. Kajii, T. (1984). A second class of immunoglobulin other than IgM present in the serum of a cartilaginous fish, the skate Raja kenojei: Isolation and characterization. Mol. Immunol. 21: 397-404. Kobayashi, K., Tomonaga, S. (1988). The second immunoglobulin class is commonly present in cartilaginous fish belonging to the order Rajiformes. Mol. Immunol. 25: 115-120. Clem, L.W., Small, P.A., Jr. (1970). Phylogeny of immunoglobulin structure and function. V. Valences and association constants of teleost antibodies to a haptenic determinant. J. Exp. Med. 132: 385-400. Russell, W. J., Voss, Jr., E.W., Sigel, M.M. (1970). Some characteristics of anti-dinitrophenyl antibody of the gray snapper. J. Immunol. 105: 262-264. Voss, Jr., E.W., Groberg, Jr., W.J., Fryer, J.L. (1978). Binding affinity of tetrameric coho salmon Ig antihapten antibodies. Immunochemistry 15: 459-464. Shankey, V.T., Clem, L.W. (1980). Phylogeny of immunoglobulin structure and function. VIII. Intermolecular heterogeneity of shark 19s IgM antibodies to pneumococcal polysaccharide. Mol. Immunol. 17: 365-375. Shankey, V.T., Clem, L.W. (1980). Phylogeny of immunoglobulin structure and function. IX. Intramolecular heterogeneity of shark 19s IgM antibodies to the dinitrophenyl hapten. J. Immunol. 125: 26902698. Killie, J.-E., Espelid, S., Jorgensen, T.O. (1991). The humoral immune response in Atlantic salmon (Sulmo sular L.) against the hapten carrier antigen NIP-LPH; the effect of determinant (NIP) density and the isotype profile of anti-NIP antibodies. Fish Shellfish Immunol. 1: 33-46. Litman, G. W., Stolen, J.S., Sarvas, H.O., Make& 0. (1982). The range and fine specificity of the antihapten immune response: Phylogenetic studies. J. Immunogenetics 9: 465-474. Lobb, C.J. (1985). Covalent structure and affinity of channel catfish anti-dinitrophenyl antibodies. Mol. Immunol. 22: 993-999. Voss, E.W., Sigel, M.M. (1972). Valence and temporal change in affinity of purified 7s and 18s nurse shark a&-2,4 dinitrophenyl antibodies. J. Immunol. 109: 665-673.

and genes

27. Sigel, M.M.,

28.

29.

30.

31. 32.

33.

34.

35. 36.

37. 38.

39.

40. 41. 42.

217

Voss, Jr., E.W., Rudikoff, S. (1972). Binding properties of shark immunoglobulms. Comp. Biochem. Physiol. 42A: 249-259. Anderson, D.P., Klontz, G.W. (1975). Characterization of antibody from the primary and secondary responses of rainbow trout inoculated with Aeromonas salmonicida. In: Morton, B. (ed.) Marine Sciences Special Symp., 7-16 December 1973, Pacific Science Association, Hong Kong, pp. 81-84. O’Neill, J.G. (1979). The immune response of the brown trout, Salmo trutta L. to MS2 bacteriophage: Immunogen concentration and adjuvants. J. Fish Biol. 15: 237-248. Cossarini-Dunier, M. (1986). Secondary response of rainbow trout (Safmo gairdneri Richardson) to DNP52: haemocyanin and Yersinia ruckeri. Aquaculture 81-86. Du Pasquier, L. (1982). Antibody diversity in lower vertebrates-Why is it so restricted? Nature 296: 31 l313. Vilain, C., Wetzel, M.-C., Du Pasquier, L., Charlemagne, J. (1984). Structural and functional analysis of spontaneous anti-nitrophenyl antibodies in three cyprinid fish species; carp (C@zus carpio), goldfish (Carassius auratus) and tenth (Tinca tincu). Dev. Comp. Immunol. 8: 611-622. Wetzel. M.C.. Charlemaane. J. (1985). Antibodv diversity’in fish: Isolelectrofocalisatiod study of individually-purified specific antibodies in three teleost fish species: Tenth, carp and goldfish. Dev. Comp. Immunol. 9: 261-270. Litman, G.W., Scheffel, C., Gerber-Jenson, B. (1980). Immunoglobulin diversity in the phylogenetically primitive shark Heterodontus francisci. I. Suggested lack of structural variation between light chains isolated from different animals. J. Immunogenetics 7: 197-206. Shelton, E., Smith, M. (1970). The ultrastructure of carp (Cyprinus carpio) immunoglobulin: A tetrameric macroglobulin. J. Mol. Biol. 54: 615-617. Marchalonis, J.J. (1971). Isolation and partial characterization of immunoglobulins of goldfish (Carussius auratus) and carp (Cyprinus carpio). Immunology 20: 161-173. Trump, G.N. (1970). Goldfish immunoglobulins and antibodies to bovine serum albumin. J. Immunol. 104: 1267-1275. Wilson, M.R., Wang, A.-C., Fish, W.W., Warr, G.W. (1985). Anomalous behavior of goldfish IgM heavy chain in sodium dodecylsulfate polyacrylamide gel electrophoresis. Comp. Biochem. Physiol. 82B: 41-49. Clem, L.W., McLean, W.E. (1975). Phylogeny of immunoglobulin structure and function. VII. Monomeric and tetrameric immunoglobulins of the margate, a marine teleost fish. Immun. 29: 791-799. Warr, G.W. (1983). Immunoglobulin of the toadfish Spheroides glaber. Comp. Biochem. Physiol. 76B: 507-514. Lobb, C.J., Clem, L.W. (1983). Distinctive subpopulations of catfish serum antibody and immunoglobulin. Mol. Immunol. 20: 811-818. Pilstrom, L., Petersson, A. (1991). Isolation and partial characterization of immunoglobulin from cod (Gadus morhuaL.) Dev. Comp. Immunol. 15: 143152.

218

M. R. Wilson

43. Clerx, J.P.M., Caste], A., Bol, J.F., Gerwig, G. J. (1980). Isolation and characterization of the immunoglobulin of pike (Esox lucius L.). Vet. Immunol. Immunopathol. 1: 125-144. 44. Richter, R., Ambrosius, H. (1972). Immune biology of poikilothermic vertebrates. 8. A high molecular immune globulin of the perch, Percafluviatilis. Acta. Biol. Med. Ger. 29: 309-318. 45. Fletcher, T.C., Grant, P.T. (1969). Immunoglobulin in the serum and mucus of the plaice (Pleuronectes platessa). Biochem. J. 115: 65P. 46. Elcombe, B.M., Chang, R.J., Taves, C.J., Winkelhake, J.L. (1985). Evolution of antibody structure and effector functions: Comparative hemolytic activities of monomeric and tetrameric IgM from rainbow trout, Salmo gairdneri. Comp. Biochem. Physiol. SOB: 697-706. 47. Kobayashi, K., Hara, A., Takano, K., Hirai, H. (1982). Studies on subunit components of immunoglobulin M from a bony fish, the chum salmon, (On~orhynchus k&a). Mol. Immunol. 19: 95-103.. 48. Havarstein. L.S.. Aasiord. P.M.. Ness. S.. Endresen, C. (1988). Purification and partial characterization of an IgM-like serum immunoglobulin from Atlantic salmon, (Saho salar). Dev. Comp. Immunol. 12: 173-785. 49. Clem, L.W., Leslie, G.A. (1971). Production of 19s IgM antibodies with restricted heterogeneity from sharks. Proc. Natl. Acad. Sci. USA 68: 139-141. 50. Marchalonis, J.J., Edelman, G.M. (1965). Phylogenetic origins of antibody structure. I. Multichain structure of immunoglobulins in the smooth dogfish (Musfelus canis). J. Exp. Med. 122: 601-618. 51. Clem, L.W., Small, P.A., Jr. (1967). Phylogeny of immunoglobulin structure and function. I. Immunoglobulins of the lemon shark. J. Exp. Med. 125: 893-920. 52. Gitlin, D., Perricelli, A., Gitlin, J.D. (1973). Multiple immunoglobulin classes among sharks and their evolution. Comp. Biochem. Physiol. 44B: 225-239. 53. Kokubu, F., Hinds, K., Litman, R., Shamblott, M.J., Litman, G.W. (1988). Complete structure and organization of immunoglobulin heavy chain constant region genes in a phylogenetically primitive vertebrate. EMBO J. 7: 1979-1988. 54. Kokubu, F., Litman, R., Shamblott, M.J., Hinds, K., Litman, G.W. (1988). Diverse organization of immunoglobulin Vn gene loci in a primitive vertebrate. EMBO J. 7: 3413-3422. 55. Amemiya, C.T., Litman, G.W. (1990). Complete nucleotide sequence of an immunoglobulin heavy-chain gene and analysis of immunoglobulin gene organization in a primitive teleost species. Proc. Natl. Acad. Sci. USA 87: 811-815. S.H., Lobb, C.J. (1989). Cloning and se56. Ghaffari, quence analysis of channel catfish heavy chain cDNA indicate phylogenetic diversity within the IgM immunoglobulin family. J. Immunol. 142: 1356-1365. S.H., Lobb, C.J. (1989) Nucleotide se57. Ghaffari, quence of channel catfish heavy chain cDNA and genomic blot analyses. Implications for the phylogeny of Ig heavy chains. J. Immunol. 143: 2730-2739. 58. Wilson, M.R., Marcuz, A., van Ginkel, F., Miller, N.W., Clem, L.W., Middleton, D.L., Warr, G.W. (1990). The immunoglobulin M heavy chain constant

and G. W. Warr

59.

60.

61.

62.

63.

64.

65.

66.

67.

68.

69.

70.

71.

72.

73.

region gene of the channel catfish, Ictaluruspunctatus: An unusual mRNA splice pattern produces the membrane form of the molecule. Nucleic Acids Res. 18: 5227-5233. Acton, R.T., Niedermeier, W., Weinheimer, P.F., Clem, L.W., Leslie, G.A., Bennett, J.C. (1972). The carbohydrate composition of immunoglobulins from diverse species of vertebrates. J. Immunol. 109: 371-381. Davis, A.C., Shulman, M.J. (1989). IgM-Molecular requirements for its assembly and function. Immunol. Today 10: 118-128. Mestecky, J., Kulhavy, R., Schrohenloher, R.E., Tomana, M., Wright, G.P. (1975). Identification and properties of J chain isolated f&m catfish macroglobulin. J. Immunol. 115: 993-997. Weinheimer, P.F., Mestecky, J., Acton, R.T. (1971). Species distribution of J chain. J. Immunol. 107: 1211-1212. McCumber, L.J., Clem, L.W. (1976). Esterification of J chain and its effect on electrophoretic mobility in sodium dodecyl sulfate polyacrylamide gels. Biochim. Biophys. Acta. 446: 536-541. Hagiwara, K., Kobayashi, K., Kajii, T., Tomonaga, S. (1985). J-chain-like component in 18s immunoglobulin of the skate, Raja kenojei, a cartilaginous fish. Mol. Immunol. 22: 775-778. Bengten, E., Leanderson, T., Pilstrom, L. (1991). Immunoglobulin heavy chain cDNA from the teleost Atlantic cod (Gadus morhua L): Nucleotide sequences of secretory and membrane forms show an unusual splicing pattern. Eur. J. Immunol. 21: 3027-3033. Warr, G.W., DeLuca, D., Marchalonis, J. J. (1976). Phylogenetic origins of immune recognition: Lymphocyte surface immunoglobulins in the goldfish, Carassius aura&s. Proc. Natl. Acad. Sci. USA 73: 2476-2480. Warr, G.W. (1982). Behavior of unreduced polymeric and monomeric immunoglobulins in sodium dodecylsulfate-polyacrylamide gel electrophoresis. Mol. Immunol. 19: 75-81. Oriol, R., Rousset, M. (1974). The IgM antibody site. II. Comparison of the two populations of IgM antibody sites and analysis of the behavior of the low affinity population at equilibrium with a dinitrophenylated hapten. J. Immunol. 112: 2235-2240. Giles, R.C., Klapper, D.G., Clem, L.W. (1983). Intramolecular heterogeneity of ligand binding by two IgM antibodies derived from murine hybridomas. Mol. Immunol. 20: 737-744. van Ginkel, F.W., Pascual, D.W., Clem, L.W. (1991). Proteolytic fragmentation of channel catfish antibodies. De;. Corn& Immunol. 15: 41-51. Lobb, C.J.. Olson, M.O. (1988). lmmunoglobulin heavy H chain isotypes in a teleost fish. J. Immunol. 141: 1236-1245. Phillips, J.O., Ourth, D.D. (1986). Isolation and molecular weight determination of two immunoglobulin heavy chains in the channel catfish, Ictalurus punctat&. Comp. Biochem. Physiol. 85B: 49-54. Tomonaaa. K., Kobavashi, K., Kaiii, T., Awaya, K. (1984). Two populations of immunoglobulin-forming cells in the skate, Raja kenojei: Their distribution and characterization. Dev. Comp. Immunol. 8: 803-812.

Fish immunoglobulins

74. Marchalonis, J.J., Edelman, G.M. (1966). Polypeptide chains of immunoglobulins from the smooth dogfish Mustelus canis. Science 154: 1567-1568. 75. Fuller, L., Murray, J., Jensen, J.A. (1978). Isolation from nurse shark serum of immune 7s antibodies with two different molecular weight H chains. Immunochemistry 15: 251-259. 76. Klapper, D.G., Clem, L.W. (1977). Phylogeny of immunoglobulin structure and function: Characterization of the cysteine-containing peptide involved in the pentamerization of shark IgM. Dev. Comp. Immunol. 1: 81-92. 77. Small, Jr., P.A., Klapper, D.G., Clem, L.W. (1970). Half-lives, body distribution and lack of interconversion of serum 19s and 7s IgM of sharks. J. Immunol. 105: 29-37. 78. Johnston, Jr., W.H., Acton, R.T., Weinheimer, P.F., Niedermeier. W., Evans. E.E.. Shelton. E., Bennett, J.C. (1971). Isolation and physico-chemical characl terization of the IgM-like immunoglobulin from the (Dasyatis americana). J. Immunol. 107: stingray 782-793. J.J., Schonfeld, S.A. (1970). Polypep79. Marchalonis, tide chain structure of sting ray immunoglobulin. Biochim. Biophys. Acta. 221: 604-611. 80. Uhr, J.W., Finkelstein, M.S., Franklin, E.C. (1962). Antibody response to bacteriophage 0x174 in nonmammalian vertebrates. Proc. Sot. Exp. Biol. Med. 111: 13-15. 81. Cooper, E.L., Grewal, IS., Magor, B.G. (1990). Comparative immunology of the integument, In: Bos, J.D. (ed.) Skin immune system (SIS). CRC Press, Boca Raton, FL, pp. 9-24. 82. Lobb, C.J., Clem, L.W. (1981). The metabolic relationships of the immunoglobulins in fish serum, cutaneous mucus and bile. J. Immunol. 127: 1525-1529. 83. Lobb, C.J., Clem, L.W. (1981). Phylogeny of immunoglobulin structure and function. XI. Secretory immunoglobulins in the cutaneous mucus of the sheepshead, Archosargus probatocephalus. Dev. Comp. Immunol. 5: 587-596. 84. St. Louis-Cormier, E.A., Osterland, C.K., Anderson, P.D. (1984). Evidence for a cutaneous secretory immune system in rainbow trout (Salmo gairdneri). Dev. Camp. Immunol. 8: 71-80: 85. Bradshaw. CM.. Richard. A.S.. Siael. M.M. (1971). IgM antibodies in fish mucus. Pro; Sot. Exp. Biol. Med. 136: 1122-1124. 86. DiConza, J.J., Halliday, W.J. (1971). Relationship of catfish serum antibodies to immunoglobulin in mucus secretions. Aust. J. Exp. Biol. Med. Sci. 49: 517-519. 87. Lobb, C.J., Clem, L.W. (1981). Phylogeny of immunoglobulin structure and function. XII. Secretory immunoglobulins in the bile of the marine teleost Archosargusprobatocephalus. Mol. Immunol. 18: 615619. 88. Petersson, A., Pilstrom, L. (1991). Nucleotide sequence of immunoglobulin light chain cDNA from Atlantic cod (Gadus morhua L.). Dev. Comp. Immunol. 15, Suppl. 7: S42. (Abstract). 89. Lobb, C.J., Olson, M.O., Clem, L.W. (1984). Immunoglobulin light chain classes in a teleost fish. J. Immunol. 132: 1917-1923. 90. Virella, G., Coelho, I.M. (1974). Unexpected mobil-

and genes

91. 92.

93.

94.

95.

96.

97.

98. 99.

100.

101.

102.

103. 104.

105.

106.

219

ity of human lambda chains in sodium dodecylsulfate polyacrylamide gel electrophoresis. Immunochemistry 11: 157-160. Honjo, T. (1983). Immunoglobulin genes. Ann. Rev. Immunol. 1: 498-528. Ah, F.W., Blackwell, T.K., DePinho, R.A., Reth, M.G., Yancopoulos, G.D. (1986). Regulation of genomic rearrangement events during lymphocyte differentiation. Immunol. Rev. 89: 5-30. Reynaud, C.-A., Dahan, A., Anquez, V., Weill, J.-C. (1989). Development of the chicken antibody repertoire. In: Honjo, T., Ah, F.W., Rabbitts, T.H. (eds.) Immunoglobulin genes. Academic Press, San Diego, CA, pp. 151-162. Litman, G.W., Hinds, K., Kokubu, F. (1989). The structure and organization of immunoglobulin genes in lower vertebrates. In: Honjo, T., Ah, F.W., Rabbitts, T.H. (eds.) Immunoglobulin genes. Academic Press, San Diego, CA, pp. 163-180. Riblet, R., Brodeur, P., Tutter, A., Thompson, M.A. (1987). Structure and evolution of the mouse IgH locus. In: Kelsoe, G., Schulze, D.H. (eds.) Evolution and vertebrate immunity: The antigen-receptor and MHC gene families. University of Texas Press, Austin, TX, pp. 53-61. Litman, G.W., Varner, J., Harding, F. (1991). Evolutionary origins of immunoglobulin genes. In: Warr, G.W., Cohen, N. (eds.) Phylogenesis of immune functions. CRC Press, Boca Raton, FL, pp. 171189. Amemiya, C.T., Litman, G.W. (1991). Early evolution of immunoglobulin genes. Amer. Zool. 3 1: 558-569. Tonegawa, S. (1983). Somatic generation of antibody diversity. Nature 302: 575-581. Early, P., Huang, H., Davis, M., Calame, K., Hood, L. (1980). An immunoglobulin heavy chain variable region gene is generated from three segments of DNA: V,, D, and JH. Cell 19: 981-992. Ghaffari, S.H., Lobb, C.J. (1991). Heavy chain variable region gene families evolved early in phylogeny. Ig complexity in fish. J. Immunol. 146: 1037-1046. Ghaffari, S.H., Lobb, C.J. (1992). Organization of immunoglobulin heavy chain constant and joining region genes in the channel catfish. Mol. Immunol. 29: 151-159. Kabat, E.A., Wu, T.T., Reid-Miller, M., Perry, H.M., Gottesman, K.S. (1987). Sequences of proteins of immunological interest. 4th Ed. USDHHS, Public Health Service, National Institutes of Health, Bethesda, MD, 804 pp. Dildrop, R. (1984). A new classification of mouse Vn sequences. Immunol Today 5: 85-86. Givol, D., Zakut, R., Effron, K., Rechavi, G., Ram, D., Cohen, J.B. (1981). Diversity of germ-line immunoglobulin Vn genes. Nature 292: 426-430. Litman, G.W., Berger, L., Murphy, K., Litman, R., Hinds, K., Jahn, C.L., Erickson, B.W. (1983). Complete nucleotide sequence of an immunoglobulin Vn gene homologue from Caiman, a phylogenetically ancient reptile. Nature 303: 349-352. Litman, G.W., Berger, L., Murphy, K., Litman, R., Hinds, K., Erickson, B.W. (1985). Immunoglobulin V, gene structure and diversity in Heterodontus,

220

107.

108.

109.

110.

111.

112.

113.

114.

115.

116.

117.

118.

119.

120.

121.

M. R. Wilson

a phylogenetically primitive shark. Proc. Natl. Acad. Sci. USA 82: 2082-2086. Litman, G.W., Murphy, K., Berger, L., Litman, R., Hinds, K., Erickson, B.W. (1985). Complete nucleotide sequences of three V, genes in Caiman, a phylogenetically ancient reptile: Evolutionary diversification in coding segments and variation in the structure and organization of recombination elements. Proc. Natl. Acad. Sci. USA 82: 844-848. Matsunaga, T., Chen, T., Tormanen, V. (1990). Characterization of a complete immunoglobulin heavy-chain variable region germ-line gene of rainbow trout. Proc. Natl. Acad. Sci. USA 87: 767-771. Wilson, M.R., Middleton, D., Warr, G.W. (1991). Immunoglobulin V, genes of the goldfish, Carassius auratus: Are-examination. Mol. Immunol. 28: 449-457. Schwager, J., Grossberger, D., Du Pasquier, L. (1988). Organization and rearrangement of immunoglobulin M genes in the amphibian Xenopus. EMBO J. 7: 2409-2415. Parslow, T.G., Blair, D.L., Murphy, W.J., Granner, D.K. (1984). Structure of the 5’ ends of immunoglobulin genes: A novel conserved sequence. Proc. Natl. Acad. Sci. USA 81: 2650-2654. Reth, M., Gehrmann, P., Petrac, E., Wiese, P. (1986). A novel V, to VHDJH joining mechanism in heavy-chain negative (null) pre-B cells results in heavy-chain production. Nature 322: 840-842. Max, E.E. (1989). Immunoglobulins: Molecular genetics. In: Paul, W.E. (ed.) Immunology. 2nd Ed. Raven Press Ltd., New York, pp. 235-290. Reynaud, C.-A., Dahan, A., Anquez, V., Weill, J.-C. (1989). Somatic hyperconversion diversifies the single Vu gene of the chicken with a high incidence in the D region. Cell 59: 171-183. Reynaud, A.-C., Anquez, V., Weill, J.-C. (1991). The chicken D locus and its contribution to the immunoglobulin heavy chain repertoire. Eur. J. Immunol. 21: 2661-2670. Warr, G.W., Wilson, M.R., Clem, L.W., Miller, N.W. (1991). The antibody repertoire and the organization of fish immunoglobuhn genes. In: The F&t Nordic Symposium on Fish Immunology, 6-8 June 1991, Tromso, Norway, Paper No. 4. (Abstract). Warr, G.W., Middleton, D.L., Miller, N.W., Clem, L.W., Wilson, M.R (1991). An additional family of Vu sequences in the channel catfish. Eur. J. Immunogenetics 18: 393-397. Hordvik, I., Voie, A.-M., Glette, J., Fosse, V., Male, R., Endresen, C. (1991). Analysis of immunoglobulin heavy chain gene organization in Atlantic salmon. In: The First Nordic Symposium on Fish Immunology, 6-8 June 1991, Tromso, Norway, Paper No. 53 (Abstract). Andersson, E., T(irm&nen, V., Matsunaga, T. (1991). Evolution of a Vu gene family in low vertebrates. Int. Immunol. 3: 527-533. Du Pasquier, L. (1989). Evolution of the immune system. In: Paul, W.E. (ed.) Fundamental immunology. 2nd Ed. Raven Press Ltd., New York, pp. 139-165. Kurosawa, Y., Tonegawa, S. (1982). Organization, structure, and assembly of immunoglobulin heavy chain diversity DNA segments. J. Exp. Med. 155: 201-218.

and G. W. Warr

122.

122a.

123.

124.

125.

126.

127.

128.

129.

130.

131.

132.

133.

134.

135.

136.

137.

Briiggemann, M. (1987). Genes encoding the immunoglobulin constant regions. In: Calabi, F., Neuberger, M.S. (eds.) Molecular genetics of immunoglobulin. Elsevier, Amsterdam, pp. 51-80. Nisonoff, A. (1984). The organization of genes controlling immunoglobulins. In: Introduction to molecular immunology. Sinaur Assoc. Inc., Sunderland, MA, pp. 91-116. Stanton, L.W., Marcu, K.B. (1982). Nucleotide sequence and properties of the murine y3 immunoglobulin heavy chain gene switch region: Implications for successive Cy gene switching. Nucleic Acids Res. 10: 5993-6006. Calame, K.L. (1985). Mechanisms that regulate immunoglobulin gene expression. Ann. Rev. Immunol. 3: 159-195. Pettersson, S., Cook, G.P., Briiggemann, M., Williams, G.T., Neuberger, MS. (1990). A second B cell-specific enhancer 3’ of the immunoglobulin heavy-chain locus. Nature 344: 165-168. Mason, J.O., Williams, G.T., Neuberger, M.S. (1985). Transcription cell type specificity is conferred by an immunoglobulin Vn gene promoter that includes a functional consensus sequence. Cell 41: 479-487. Mercola, M., Goverman, J., Mirell, C., Calame, K. (1985). Immunoglobulin heavy-chain enhancer requires one or more tissue-specific factors. Science 227: 266-270. Schlokat, U., Bohmann, D., Scholer, H., Gruss, P. (1986). Nuclear factors binding specific sequences within the immunoglobulin enhancer interact differentially with other enhancer elements. EMBO J. 5: 3251-3258. Wirth, T., Staudt, L., Baltimore, D. (1987). An octamer oligonucleotide upstream of a TATA motif is sufficient for lymphoid-specific promoter activity. Nature 329: 174-178. Sen, R., Baltimore, D. (1989). Factors regulating immunoglobulin-gene transcription. In: Honjo, T., Alt, F.W., Rabbitts, T.H. (eds.) Immunoglobulin genes. Academic Press, New York, pp. 327-342. Church, G.M., Ephrussi, A., Gilbert, W., Tonegawa, S. (1985). Cell-type-specific contacts to immunoglobulin enhancers in nuclei. Nature 313: 798-801. Banerji, J., Olson, L., Schaffner, W. (1983). A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell 33: 729-740. Calame, K., Eaton, S. (1988). Transcriptional controlling elements in the immunoglobulin and T cell receptor loci. Adv. Immunol. 43: 235-275. Biggen, M.D., Tjian, R. (1988). Transcriptional factors that activate the Uitrabithorax promoter in developmentally staged extracts. Cell 53: 699-711. Levinson, G., Gutman, G.A. (1987). Slipped-strand mispairing: A major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4: 203-221. Early, P., Rogers, J., Davis, M., Calame, K., Bond, M., Wall, R., Hood, L. (1980). Two mRNAs can be produced from a single immunoglobulin ccgene by alternative RNA processing pathways. Cell 20: 313-319. Peterson, M.L., Perry, R.P. (1989) The regulated production of pm and ps mRNA is dependent on

Fish immunoglobulins

138.

139.

140.

141.

142.

143.

144.

145.

145a.

the relative efficiencies of ps poly(A) site usage and the Cp4-to-Ml splice. Mol. Cell. Biol. 9: 726738. Du Pasquier, L., Schwager, J. (1989). Evolution of the immune system. In: Melchers, F. (ed.) Progress in immunology. Vol. VII. Springer Verlag, New York/Berlin/Heidelberg, pp 1246-1255. Warr, G.W., Miller, N.W., Clem, L. W., Wilson, M.R. (1992). Alternate splicing pathways of the immunoglobulin heavy chain transcript of a teleost fish, Ictalurus punctatus. Immunogenetics. 35: 254-257. Warr, G.W., Marchalonis, J.J. (1977). Lymphocyte surface immunoglobulin of the goldfish differs from its serum counterpart. Dev. Comp. Immunol. 1: 15-22. Warr, G.W., DeLuca, D., Griffin, B.R. (1979). Membrane immunoglobulin is present on thymic and splenic lymphocytes of the trout Salrno gairdnerd. J. Immunol. 123: 910-917. Miller, N.W., Clem, L.W. (1984). Temperaturemediated processes in teleost immunity: Differential effects of temperature on catfish in vitro antibody responses to thymus-dependent and thymus-independent antigens. J. Immunol. 133: 2356-2359. Miller, N.W., Sizemore, R.C., Clem, L.W. (1985). Phylogeny of lymphocyte heterogeneity: The cellular requirements for in vitro antibody responses of channel catfish leukocytes. J. Immunol. 134: 2884-2888. Clem, L.W., Miller, N.W., Bly, J.E. (1991). Evolution of lymphocyte subpopulations, their interactions, and temperature sensitivities. In: Warr, G.W., Cohen, N. (eds.) Phylogenesis of immune functions. CRC Press, Boca Raton, FL, pp. 191-213. Brodeur, P.H., Riblet, R. (1984). The immunoglobulin heavy chain variable region (IgH-V) locus in the mouse. I. One hundred IgH-V genes comprise seven families of homologous genes. Eur. J. Immunol. 14: 922-930. Harding, F.A., Cohen, N., Litman, G.W. (1990).

146.

147.

148.

149.

150.

151.

152.

153.

154.

and genes

221

Immunoglobulin heavy chain gene organization and complexity in the skate, Raja erinacea. Nucleic Acids Res. 18: 1015-1020. Harding, EA., Amemiya, C.T., Litman, R.T., Cohen, N., Litman, G.W. (1990). Two distinct immunoglobulin heavy chain isotypes in a primitive, cartilaginous fish, Raja erinacea. Nucleic Acids Res. 18: 6369-6376. Litman, G.W., Scheffel, C., Make& 0. (1980). Immunoglobulin diversity in the phylogenetically primitive shark Heterodontusfrancisci: Comparison of fine specificity in hapten binding by antibody to p-azobenzenearsonate. Immunol. Let. 1: 213215. Makell, O., Litman, G.W. (1980). Lack of heterogeneity in antihapten antibodies of a phylogenetitally primitive shark. Nature 287: 639-640. Shamblott, M., Litman, G.W. (1989). Complete nucleotide sequence of primitive vertebrate immunoglobulin light chain genes. Proc. Natl. Acad. Sci. USA 86: 4684-4688. Shamblott, M.J., Litman, G.W. (1989). Genomic organization and sequences of immunoglobulin light chain genes in a primitive vertebrate suggest coevolution of immunoglobulin gene organization. EMBO J. 8: 3733-3739. Schluter, SF., Hohman, VS., Edmundson, A.B., Marchalonis, J.J. (1989). Evolution of immunoglobulin light chains: cDNA clones specifying sandbar shark constant regions. Proc. Natl. Acad. Sci. USA 86: 9961-9965. Hohman, V.S., Schluter, S.F., Marchalonis, J. J. (1991). Sandbar shark light chain genes: Implications for the evolution of X chain genes. Dev. Comp. Immunol. 15, Suppl. 1: S83 (Abstract). Riblet, R., Brodeur, P.H. (1986). The IgH-V gene repertoire of the mouse. Mount Sinai J. Med. 53: 170-174. Warr, G.W., Dover, G.A. (1991). Mechanisms of molecular evolution in the immunoglobulin superfamily. In: Warr, G.W., Cohen, N. (eds.) Phylogenesis of immune functions. CRC Press, Boca Raton, FL, pp. 295-316.