- Email: [email protected]
Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance
Article
Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance Graphical Abstract
Authors Hiroyuki Nakajima, Kimiko Yamamoto, Sobhika Agarwala, ..., Markus Affolter, Virginie Lecaudey, Naoki Mochizuki
Correspondence [email protected]
In Brief Nakajima et al. monitor the spatiotemporal localization and transcriptional activity of Yap1 in ECs of living zebrafish and reveal that blood flow regulates localization of Yap1 through mechanotransduction signaling.
Highlights d
Transcriptional activity and localization of Yap1 is monitored in zebrafish ECs
d
Blood flow regulates localization of endothelial Yap1 in vivo
d
Shear stress enhances nuclear import of YAP through regulation of F-actin and AMOT
d
Yap1 contributes to vessel maintenance in zebrafish
Nakajima et al., 2017, Developmental Cell 40, 523–536 March 27, 2017 ª 2017 Elsevier Inc. http://dx.doi.org/10.1016/j.devcel.2017.02.019
Developmental Cell
Article Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance Hiroyuki Nakajima,1 Kimiko Yamamoto,2 Sobhika Agarwala,3 Kenta Terai,4 Hajime Fukui,1 Shigetomo Fukuhara,5 Koji Ando,1 Takahiro Miyazaki,1 Yasuhiro Yokota,1 Etienne Schmelzer,6 Heinz-Georg Belting,6 Markus Affolter,6 Virginie Lecaudey,7 and Naoki Mochizuki1,8,9,* 1Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute, 5-7-1 Fujishirodai, Suita, Osaka 565-8565, Japan 2Laboratory of System Physiology, Department of Biomedical Engineering, Graduate School of Medicine, University of Tokyo, Tokyo 113-0033, Japan 3Developmental Biology, SFB850, Institute for Biology I, Albert Ludwigs University of Freiburg, 79104 Freiburg, Germany 4Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606-8315, Japan 5Department of Molecular Pathophysiology, Nippon Medical School, Kawasaki, Kanagawa 211-8533, Japan 6Biozentrum der Universita €t Basel, Klingelbergstrasse 50/70, 4056 Basel, Switzerland 7Department of Developmental Biology of Vertebrates, Institute for Cell Biology and Neurosciences, Goethe University of Frankfurt, 60438 Frankfurt, Germany 8AMED-CREST, National Cerebral and Cardiovascular Center, 5-7-1, Suita, Osaka 565-8565, Japan 9Lead Contact *Correspondence: [email protected] http://dx.doi.org/10.1016/j.devcel.2017.02.019
SUMMARY
Endothelial cells (ECs) line the inside of blood vessels and respond to mechanical cues generated by blood flow. Mechanical stimuli regulate the localization of YAP by reorganizing the actin cytoskeleton. Here we demonstrate blood-flow-mediated regulation of endothelial YAP in vivo. We indirectly monitored transcriptional activity of Yap1 (zebrafish YAP) and its spatiotemporal localization in living zebrafish and found that Yap1 entered the nucleus and promoted transcription in response to blood flow. In cultured human ECs, laminar shear stress induced nuclear import of YAP and its transcriptional activity in a manner independent of Hippo signaling. We uncovered a molecular mechanism by which flow induced the nuclear translocation of YAP through the regulation of filamentous actin and angiomotin. Yap1 mutant zebrafish showed a defect in vascular stability, indicating an essential role for Yap1 in blood vessels. Our data imply that endothelial Yap1 functions in response to flow to maintain blood vessels.
INTRODUCTION Blood vessel networks mainly form by angiogenesis during vertebrate embryogenesis. Angiogenesis involves the sprouting of new vessels from the pre-existing vessels and the eventual fusion of new sprouts to form a vascular loop that circulates blood, nutrients, and waste products (Eilken and Adams, 2010; Geudens and Gerhardt, 2011; Herbert and Stainier, 2011). Blood vessels are lumenized by changing endothelial cell (EC) shape
and rearranging cell-cell junctions (Betz et al., 2016). These lumenized blood vessels are either maintained or remodeled during tissue or organ growth. Vascular remodeling, which includes alterations of the distribution and diameter, allows vessels to meet the demand of tissues so that they receive adequate perfusion with maximal efficiency (Freund et al., 2012; Hahn and Schwartz, 2009). During maintenance and remodeling, ECs lining the inner surface of blood vessels directly sense the blood flow as mechanical stimuli and exhibit a variety of responses (Chen et al., 2012; Franco et al., 2015; Lucitti et al., 2007). The EC responses to flow are essential to maintain vessel homeostasis by regulating vascular tone, blood pressure, and vascular permeability (Ando and Yamamoto, 2013; Chiu and Chien, 2011; Hahn and Schwartz, 2009). The flow-mediated mechanical stimuli are indispensable for the maintenance of lumenized blood vessels (Chen et al., 2012; Meeson et al., 1996; Wang et al., 2010). ECs sense two types of mechanical stimuli from the blood flow: one is shear stress, the frictional force tangential to ECs; the other is mechanical strain, the force perpendicular to the direction of flow, related to rhythmic heart beating (Hahn and Schwartz, 2009). Extensive studies using cultured ECs provide much information about shear stress-induced multiple mechanotransduction signals but less information about straininduced mechanotransduction (Ando and Yamamoto, 2013; Hahn and Schwartz, 2009). Shear stress causes changes in EC morphology and promotes gene expression through the activation of a variety of transcription factors (Chiu and Chien, 2011). However, how flow-mediated signals are regulated in living animals remains elusive. YAP, a final effector molecule downstream of Hippo signaling (Yu and Guan, 2013), has been identified as a mechanotransducer of various external or internal mechanical forces involving the actin cytoskeleton (Piccolo et al., 2014). YAP is a transcription cofactor that shuttles between the cytoplasm and the
Developmental Cell 40, 523–536, March 27, 2017 ª 2017 Elsevier Inc. 523
A Tg(eef1a1l1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP) B Tg(eef1a1l1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP); Ubiquitous TEAD reporter
eef1a1l1 Gal4db TeadΔN 2A UAS
GFP
mC
(fli1:Myr-mC) (Hindbrain) GFP
pA
pA
Nuclear Yap1 (-)
52-56 hpf
Myr-mC
GFP/Myr-mC
CCtA
Nuclear Yap1 (+)
Yap1 Nucleus TeadΔN
GFP(+)
Gal4db
GFP
UAS
Yap1
TeadΔN
GFP(-)
Gal4db
GFP
UAS
GFP
Myr-mC GFP/Myr-mC PCS
MMCtA
(Trunk) GFP
Myr-mC
DA
ISV
DLAV
PCV
GFP/ Myr-mC GFP
(Eye)
Myr-mC OV
(Pharyngeal arch)
GFP
AA1
1
442
zYap1 (WT) TBD N
Yap1
WW
AD C
Taget for TALEN
1 ncv101
WW
23
(25 nt deletion) Stop
D
WT yap1 Yap1
β-actin
ncv101
75 (kDa)
* ~65 kDa
GFP/Myr-mC
C
GFP/Myr-mC E Tg(eef1a1l1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP); (fli1:Myr-mC) 55 hpf (Hindbrain) wwtr1ncv114 WT yap1ncv101
CCtA
37
Figure 1. Monitoring Transcriptional Activity of Yap1 Indirectly in Endothelial Cells of Living Zebrafish (A) (Upper) The constructs used to monitor Yap1 responses ubiquitously by eef1a1l1 promoter (ubiquitous TEAD reporter). (Lower) Schematic illustration explains how the system works. In this Tg system, a fusion protein containing Gal4db-TEAD2DN, 2A peptide, and mCherry (mC) was ubiquitously expressed under the control of eef1a1l1 promoter. Gal4db-TEAD2DN is a Gal4 driver, in which a truncated form of human TEAD2 lacking the DNA-binding domain (TEAD2DN) is fused to the DNA-binding domain of Gal4 (Gal4db), whereas UAS-GFP is a responder transgene, in which GFP gene was placed downstream of UAS, the Gal4 recognition sequence. Upon nuclear translocation of Yap1, it binds to Gal4db-TEAD2DN in the nucleus, thereby inducing GFP expression via the Gal4-UAS system. This reporter reflects the interaction between endogenous Yap1 (or Wwtr1) and exogenously expressed Gal4db-TEAD2DN in the nucleus. pA, polyadenylation signal; UAS, upstream activation sequence. (B) Projection view of confocal stack fluorescence images of Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) embryos (52–56 hr post fertilization [hpf]). Images of hindbrain. Dorsal view, anterior to the top. Images of trunk, eye, and pharyngeal arch. Lateral view, anterior to the left. GFP images (green), mC images (red), and the merged images are shown. Arrows indicate GFP signal-positive ECs of lumenized blood vessels. Arrowheads indicate a vessel sprout showing GFP signals. (C) Schematic illustration of wild-type (WT) Yap1 and truncated Yap1ncv101 resulting from 25 nucleotides deletion in the exon1 of yap1ncv101 allele. TBD, TEADbinding domain; WW, WW domain; AD, transcriptional activation domain. (legend continued on next page)
524 Developmental Cell 40, 523–536, March 27, 2017
nucleus where it associates with TEA domain (TEAD) family members. The mechanical forces, which are generated by extracellular matrix rigidity (Calvo et al., 2013; Dupont et al., 2011), cell strain (Aragona et al., 2013; Benham-Pyle et al., 2015; Codelia et al., 2014; Cui et al., 2015), and cell shape (Dupont et al., 2011; Wada et al., 2011), control nuclear translocation of YAP through the modulation of filamentous actin (F-actin) structures, although the molecular mechanisms have not been fully elucidated in vivo. In contrast, canonical Hippo signaling negatively regulates YAP by inducing nuclear export of YAP. In the Hippo signaling cascade, MST1/2 kinases phosphorylate and activate LATS1/2 kinases, which in turn directly phosphorylate YAP, thereby exporting YAP from the nucleus (Avruch et al., 2012; Yu and Guan, 2013). It is not fully determined whether classical Hippo signaling and mechanotransduction signaling cooperatively or independently regulate the localization of YAP (Calvo et al., 2013; Codelia et al., 2014; Dupont et al., 2011; Wada et al., 2011). YAP-deficient mice show defects in the formation of the vasculature of the yolk sac (Morin-Kensicki et al., 2006). In addition, vascular density is significantly decreased in mouse retinas injected with YAP small interfering RNA (siRNA) (Choi et al., 2015), indicating an essential role for YAP in angiogenesis. However, the mechanism underlying the determination of YAP localization during developmental angiogenesis is unknown. Whereas YAP and its paralog WWTR1 (TAZ) are reported to respond to disturbed flow in lymphatic ECs in vitro (Sabine et al., 2015), whether it is regulated by blood flow in vivo has not been elucidated. In this study, we examined the flow-regulated localization of YAP both in vivo using zebrafish embryo and in vitro using cultured ECs. We monitored spatiotemporal localization and transcriptional activity of Yap1, a zebrafish ortholog of mammalian YAP, in ECs of living zebrafish and found that Yap1 is regulated by blood flow. In cultured ECs, shear stress induced nuclear translocation of YAP in a manner independent of Hippo signaling. The flow-induced reorganization of F-actin was associated with nuclear localization of YAP that was released from angiomotin (AMOT). Moreover, we demonstrate the requirement of Yap1 in the maintenance of blood vessels. RESULTS Monitoring Transcriptional Activity of YAP Indirectly in ECs of Living Zebrafish Yap1-regulated transcription depends upon its translocation to the cell nucleus. To monitor Yap1-dependent transcription in vivo, we developed a transgenic (Tg) zebrafish line, Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mCherry (mC));(UAS:GFP), hereafter called ‘‘ubiquitous TEAD reporter Tg,’’ that could indi-
rectly monitor the transcriptional activity of Yap1 or Wwtr1 (Taz) ubiquitously (Figure 1A) (Fukui et al., 2014). In this reporter system, nuclear translocated Yap1 or Wwtr1 drives GFP expression via the Gal4/UAS system in the whole body under eef1a1l1 promoter (for details see legend of Figure 1). By crossing this ubiquitous TEAD reporter fish with Tg(fli1:Myristoylated (Myr)-mC) that labels ECs with Myr-mC, we found that GFP-positive cells were detected in mC-positive ECs at 2 days post fertilization (dpf), including cells in the optic vessels (OV) of the eyes; in the mandibular arch (AA1) of the pharyngeal arch; the cerebellar central artery (CCtA), middle mesencephalic central artery (MMCtA), and posterior communicating segment (PCS) in the hindbrain; and in the intersomitic vessels (ISVs), dorsal aorta (DA), posterior cardinal vein (PCV), and the dorsal longitudinal anastomotic vessels (DLAVs) in the trunk vasculature (Figure 1B). We confirmed that fluorescence of mC of Tg(eef1a1l1:Gal4dbTEAD2DN-2A-mC) was negligibly faint compared with that of Myr-mC of Tg(fli1:Myr-mC) (Figure S1A). GFP expression was weaker in sprouting vessels than in lumenized vessels in the brain (Figure 1B, arrowheads). Besides blood vessels, GFP-positive cells were also detected in the heart (Fukui et al., 2014) and notochord, where YAP-TEAD signals are active in mice (Ota and Sasaki, 2008). To examine whether the TEAD reporter fish reflects the transcriptional activity of Yap1 or Wwtr1, we generated their loss-offunction alleles, yap1ncv101 and wwtr1ncv114, by using transcription activator-like effector nucleases (TALENs) (Figures 1C and S1B–S1D). In homozygous yap1ncv101 mutants that lacked Yap1 protein (about 65 kDa as reported by Miesfeld et al., 2015) (Figure 1D), the GFP signals were hardly detected in ECs (Figure 1E). In contrast, the GFP signals in ECs were not significantly affected in homozygous wwtr1ncv114 mutants (Figure 1E). These results suggest that the reporter signals mainly reflect the transcriptional activation of Yap1, but not Wwtr1, in ECs. We confirmed that these effects in yap1ncv101 mutants were not due to the secondary effects by changing heart function and blood flow. Although yap1 morpholino (MO)-injected embryos exhibit cardia bifida (Fukui et al., 2014), homozygous yap1ncv101 mutants did not show any cardia bifida (0/61) and had normal blood flow (Figures S1E and S1F; Movies S1 and S2). To test whether this reporter system responds to an increase in nuclear Yap1 or Wwtr1, we examined the effects of knockdown of lats1 and lats2 using MO oligonucleotides on GFP expression (Chen et al., 2009). In lats1 and lats2 double morphants, GFP signals of the ubiquitous TEAD reporter were markedly enhanced in both ECs and non-ECs (Figures S1G and S1H), suggesting that this TEAD reporter system faithfully responds to an increase in nuclear Yap1 or Wwtr1. Collectively, our TEAD reporter system points to transcriptionally active Yap1 in ECs in vivo.
(D) Lysates from WT and homozygous yap1ncv101 mutant embryos were subjected to western blot analyses with anti-Yap1 and anti-b-actin antibodies. Arrow indicates Yap1. Asterisk indicates non-specific band. (E) Projection view of confocal stack fluorescence images of the hindbrain in Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT (left), homozygous yap1ncv101 mutant (middle), and wwtr1ncv114 mutant (right) embryos at 55 hpf. Upper panels, GFP images (green); lower panels, merged images (GFP, green; Myr-mC, red). Representative images of three independent experiments are shown. CCtA, cerebellar central artery; MMCtA, middle mesencephalic central artery; PCS, posterior communicating segment; ISV, intersomitic vessel; DA, dorsal aorta; PCV, posterior cardinal vein; DLAV, dorsal longitudinal anastomotic vessel; OV, optic vessel; AA1, mandibular arch. Scale bars, 10 mm. See also Figure S1; Movies S1 and S2.
Developmental Cell 40, 523–536, March 27, 2017 525
Activation of Yap1-Dependent Transcription Occurs in Perfused Vessels The results obtained from ubiquitous TEAD reporter Tg suggested the role for Yap1 in ECs and prompted us to examine the expression of Yap1 in zebrafish ECs. qPCR analyses revealed that yap1 mRNA was expressed in ECs isolated from embryos of a transgenic Tg(fli1:EGFP) line, in which EGFP expression was driven by the endothelial specific promoter fli1 (Figure S2A). To more specifically monitor Yap1/TEAD-dependent transcription in ECs in vivo, we developed Tg(fli1:Gal4db-TEAD2DN2A-mC);(UAS:GFP) fish, hereafter called ‘‘EC-specific TEAD reporter Tg,’’ in which Yap1- or Wwtr1-dependent transcription of GFP was monitored exclusively in the ECs under the fli1 promoter (Figure 2A) (Uemura et al., 2016). Similar to ubiquitous TEAD reporter (Figure 1), GFP-positive cells were found in various types of blood vessels at 2 dpf, including the ISVs, DA, PCV, and DLAVs in the trunk vasculature; the CCtA, MMCtA, and PCS in the hindbrain; the LDA and OV in the head; and the AA1 of the pharyngeal arch (Figures 2B and S2B). GFP signals were hardly detected in the homozygous yap1ncv101 mutants (Figure 2B), indicating that this reporter also reflects Yap1-dependent transcription in ECs. Because two TEAD reporters behave similarly in ECs, we mainly used EC-specific TEAD reporter in the following experiments to clarify the regulation of Yap1 exclusively in ECs. Before or during the formation of the DA and PCV (24 hr post fertilization [hpf]), we rarely detected GFP-positive cells in the trunk vasculature. GFP signals were detected in the DA and PCV, but not in the ISVs and DLAVs, at 32 hpf (Figure 2C, 32 hpf). The DA and PCV but not the ISVs and DLAVs were lumenized and perfused at 32 hpf when we visualized vessel perfusion by injecting Qdot into the heart (Figure 2C, 32 hpf). In contrast, after the ISVs and DLAVs were lumenized and perfused, GFP signals started to be detected (Figure 2C: Trunk, 50 hpf). In the hindbrain, GFP signals were not detected in the developing non-perfused CCtA (Figure S2C: 42 hpf, red arrows), but detected in perfused CCtA (Figure S2C: 52 hpf, white arrows). These results suggest that Yap1-dependent transcription starts especially in perfused blood vessels. Nuclear Localization of Yap1 in ECs Is Related to Lumenization of Blood Vessels To monitor localization of Yap1 directly, we developed the third Tg fish, Tg(fli1:EGFP-YAP), which expressed EGFPtagged human YAP specifically in ECs. EGFP-YAP behaves similarly to endogenous YAP (Bao et al., 2011). Using the fixed Tg embryos, we first studied whether EGFP-YAP is in the cytoplasm or in the nuclei by staining nuclei with DAPI. EGFP-YAP was in the cytoplasm in ECs of the DA and ISVs before the lumen had formed (Figures 2D and 2E; 25–28 hpf). In contrast, EGFP-YAP was in the nuclei of the DA and ISVs after a continuous lumen was established (Figures 2D and 2E; 35–36 hpf in the DA, 50–52 hpf in the ISVs). To examine when EGFP-YAP enters the nucleus, we time-lapse imaged the embryos during lumen formation of ISVs using a two-photon microscope. EGFP-YAP was mostly in the cytoplasm before or just after lumen formation and then translocated into the nucleus of ECs of lumenized ISVs (Figure 2F, see the left and right among the three ISVs). EGFP-YAP often 526 Developmental Cell 40, 523–536, March 27, 2017
shuttled between the nucleus and the cytoplasm even after lumen formation (Figure S2D). These results suggest that lumenization triggers the nuclear translocation of EGFP-YAP in living animals. Flow Induces Nuclear Translocation of YAP Blood flow is necessary to form a continuous lumen (Herwig et al., 2011; Montero-Balaguer et al., 2009). To examine the effect of blood flow on the localization of Yap1, we visualized blood flow by Qdot in the Tg(fli1:EGFP-YAP) (Figure 3A). We simultaneously marked EC nuclei in living zebrafish, by crossing the Tg(fli1:EGFP-YAP) line with a Tg line, Tg(fli1:H2B-mC), in which EC nuclei were labeled by histone H2B-mC. The circulation started in the DA around 29 hpf under our experimental conditions. Before circulation, EGFP-YAP was excluded from the nuclei even in the lumenized DA (Figure 3A). After the circulation started, EGFP-YAP translocated into the nuclei in some ECs of the DA (Figures 3A and 3B), indicating that blood flow rather than lumen formation per se induces the translocation of EGFP-YAP into the nuclei. We then investigated whether YAP can respond to mechanical stimuli generated by blood flow using cultured human pulmonary artery ECs (HPAECs). We found that YAP was significantly accumulated in the nucleus of the EC after 10 min of laminar shear stress (Figures 3C and 3D). The mRNA expression of YAP/TAZ target genes, CTGF and CYR61, were enhanced by shear stress in a manner dependent on YAP but not Wwtr1 (Figures 3E, 3F, and S3A), suggesting that nuclear translocated YAP in sheared ECs functioned as a coactivator. Laminar shear stress also induced YAP nuclear translocation in human umbilical vein ECs (Figures S3B and S3C). Thus, YAP serves as a mechanotransducer that responds to flow in vascular ECs. YAP accumulated in the nuclei in response to shear stress within 10 min. However, YAP was excluded from the nuclei after 6 hr or 24 hr of shear stress (Figures S3D and S3E). Consistently, CTGF mRNA expression increased within 1 hr and decreased below the basal level after 6 hr of shear stress (Figure S3F). Thus, YAP at least responds to laminar shear stress transiently. Blood Flow Is Important for Nuclear Localization of Yap1 To examine whether blood flow is required for nuclear localization of Yap1 in vivo, we stopped blood flow by using nifedipine and 2,3-butanedione monoxime (BDM), both of which can stop the heart beating in zebrafish (Serluca et al., 2002; Bussmann et al., 2011). Nifedipine is a Ca2+ channel blocker that inhibits cardiomyocyte contractility (Langheinrich et al., 2003), whereas BDM is a small-molecule myosin ATPase inhibitor that targets muscle myosin II (Cheung et al., 2002). After cessation of blood flow by either nifedipine or BDM treatment, EGFP-YAP was rapidly exported from the nuclei to the cytoplasm of ECs in the ISVs, DA, and DLAVs (Figures 4A–4D and S4A–S4D). Once flow resumed after the washout of BDM, EGFP-YAP re-entered the nucleus of these vessels (Figures 4C, 4D, S4B, and S4D). These results indicate that blood flow is important for nuclear localization of EGFP-YAP. In the EC-specific TEAD reporter fish, Yap1-dependent GFP expression was significantly reduced after cessation of blood flow by both nifedipine (Figures 4E and 4F) and BDM (Figures S4E and S4F), confirming that the localization of endogenous
A
D Tg(fli1:EGFP-YAP) EGFP-YAP/DAPI
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP) EC-specific TEAD reporter
fli1 UAS
Gal4db TeadΔN 2A GFP
mC
27 hpf
50 hpf
pA
pA ISV
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP); (fli1:Myr-mC)
B
50 hpf
yap1ncv101
WT
28 hpf
36 hpf
GFP
DA
GFP/ Myr-mC
ISV DA PCV
C
(%) (219) (92) (57) (33) 100
Localization of EGFP-YAP
E DLAV
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP);(fli1:Myr-mC) GFP
Qdot/GFP/Myr-mC
F
80 60 40
N C or N=C
20 0
f f f f hp hp hp hp 2 6 8 8 5 3 2 2 50 25 35 25 DA (a)ISV
Tg(fli1:EGFP-YAP) 37 hpf0
32 hpf
20
40
50 hpf
*
*
60 (min)
Figure 2. Yap1/TEAD-Dependent Transcription Becomes Active in Perfused Vessels (A) The constructs used to monitor Yap1 responses in EC by using fli1 promoter (EC-specific TEAD reporter). (B) Projection view of confocal stack fluorescence images of the trunk region in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT (left) and homozygous yap1ncv101 mutant embryos (right) at 50 hpf. Lateral views, anterior to the left. Upper panels, GFP images (green); lower panels, merged images (GFP, green; Myr-mC, red). White arrows indicate GFP signal-positive ECs of lumenized blood vessels. Representative images of four independent experiments are shown. (C) Projection view of confocal images of the trunk region in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) embryos (at 32 and 50 hpf as indicated at the left) injected with Qdot 655 (white) into the heart to visualize perfused vessels. Left, GFP images (green); right, merged images (Qdot 655, white; GFP, green; Myr-mC, red). While a significant population of ECs of perfused vessels expresses GFP (white arrows), ECs of non-perfused vessels do not (magenta arrows). (D) Projection view of confocal images of the trunk region of fixed Tg(fli1:EGFP-YAP) embryos (at 27–50 hpf as indicated at the top) immunostained with anti-GFP antibody (green) together with DAPI (blue). White and orange arrowheads indicate EGFP-YAP in the cytoplasm and nucleus, respectively. (E) Graph shows percentage of the number of the ECs in which EGFP-YAP is excluded from the nucleus (N < C, white bars) and those in which EGFP-YAP is localized in the nucleus (N > C or N = C, black bars) at the indicated stages of the dorsal aorta (DA) and the arterial intersomitic vessels (aISVs) among the total number of observed ECs (indicated at the top) from 7 to 10 embryos. (F) Time-sequential two-photon images of ISVs in Tg(fli1:EGFP-YAP) embryos that were about to form lumen (from 37 hpf). Elapsed time (min) is indicated at the left. Yellow asterisks indicate newly formed lumens connecting to the circulation. White and orange arrowheads indicate EGFP-YAP in the cytoplasm and nucleus, respectively. Representative images of seven independent experiments are shown. Scale bars, 10 mm. See also Figure S2.
Developmental Cell 40, 523–536, March 27, 2017 527
Tg(fli1:EGFP-YAP);(fli1:H2B-mC) 29 hpf0 min
A
30 min
Figure 3. Flow Induces Nuclear Translocation of YAP
60 min
(A) Time-lapse confocal imaging of the onset of the circulation in the DA of Tg(fli1:EGFP-YAP); * (fli1:H2B-mC) embryos (from 29 hpf). To visualize EGFP-YAP/ the circulation, we injected Qdot 655 (white) into H2B-mC the heart just before imaging. Yellow asterisks indicate lumen in the DA. Elapsed time (min) Qdot is indicated at the top. White and orange arrowheads indicate EGFP-YAP (green) in the Static Shear C B cytoplasm and nucleus, respectively. H2B, hisYAP D ** tone H2B. (%) *** 60 (B) Percentage of ECs in the DA in which 1.6 50 EGFP-YAP translocated from ‘‘cytoplasm to 1.4 40 nuclei’’ or from ‘‘nuclei to cytoplasm’’ just after 1.2 30 the circulation. Localization change was exam1 ined between 20 and 30 min before the onset 20 0.8 0.6 YAP/DAPI of the circulation and 20–30 min after the 10 0.4 onset of the circulation visualized by Qdot 655 0 0.2 as in (A). Data obtained from at least ten cells 0 Static Shear of single DA of three embryos are expressed as (HPAEC) mean ± SD. (C) Human pulmonary artery endothelial cells (Zebrafish DA) HPAEC (HPAECs) cultured at high density (1,000–1,500 E F cells/mm2) under static conditions or after laminar *** * 2 3.5 shear stress at 15 dynes/cm2 for 10 min were ** 3 fixed and immunostained with anti-YAP antibody 1.5 NS 2.5 together with DAPI. YAP images and the merged ** NS 2 images (YAP, green; DAPI, blue) are shown. 1 1.5 NS NS (D) Quantification of nuclear relative to cyto1 0.5 plasmic fluorescent intensity of YAP in static or 0.5 sheared HPAECs examined in (C). Data are 0 0 mean ± SD (n = 3 independent experiments, in tic ear atic ear atic ear atic ear tic ear atic ear atic ear atic ear a a St Sh St Sh St Sh St Sh St Sh St Sh St Sh St Sh each of which >150 cells were measured). (E and F) HPAECs transfected with control siRNA, Control YAP WWTR1 YAP+WWTR1 Control YAP WWTR1 YAP+WWTR1 siRNA siRNA siRNA siRNA siRNA siRNA siRNA siRNA YAP siRNA, WWTR1 siRNA, or YAP + WWTR1 (HPAEC) (HPAEC) siRNAs were kept under static conditions or subjected to shear stress at 15 dynes/cm2 for 30 min. Relative expression levels of CTGF mRNA (E) and CYR61 mRNA (F) were analyzed by qPCR analyses. Data are normalized to the values in static control siRNAtransfected ECs. Data are mean ± SD (n R 3 independent experiments). *p < 0.05, **p < 0.01, ***p < 0.001; NS, not significant. Scale bars, 10 mm. See also Figure S3. EGFP-YAP
YAP Nucleus/Cytoplasm
CYR61 mRNA
CTGF mRNA
Localization change of EGFP-YAP after the oneset of blood flow C to yto N pla uc s l m N eus u C c yt le op us la to sm
DA
Yap1 is also changed in response to blood flow. Consistently in the ubiquitous TEAD reporter, GFP signals in the ISVs increased after circulation started (Figure S4G) and decreased after the cessation of blood flow (Figure S4H), suggesting that two TEAD reporters behave similarly in ECs in response to blood flow. Flow Induces Nuclear Translocation of YAP in a Manner Independent of Hippo Signaling We next examined the molecular mechanism by which flow induces the nuclear translocation of YAP using HPAECs. First, we explored whether Hippo signaling is involved in the shear stress-induced YAP translocation. We found that phosphorylation of YAP on Ser127, a key target of LATS1/2, was not affected by shear stress (Figure S5A). In addition, LATS1/2 phosphorylation by MST1/2 kinases was unchanged after shear stress (Figures S5B and S5C). We then examined the effects of depletion of LATS1/2 on the shear stress-mediated YAP regulation. In static ECs, knockdown of LATS1/2 resulted in nuclear localization of YAP and CTGF mRNA expression, suggesting that the Hippo pathway effectively inhibits YAP in static ECs (Figures S5D–S5G). Of note, shear stress induced nuclear translocation 528 Developmental Cell 40, 523–536, March 27, 2017
of YAP and subsequent CTGF mRNA expression even in the absence of LATS1/2 (Figures S5D–S5G). These results indicate that Hippo signaling is not involved in flow-induced nuclear translocation of YAP. Shear Stress-Induced Nuclear Translocation of YAP Is Associated with F-Actin Reorganization YAP localization is regulated by the actin cytoskeleton independently of Hippo signaling (Aragona et al., 2013; Calvo et al., 2013; Dupont et al., 2011; Feng et al., 2014). Therefore, we examined the F-actin-mediated YAP regulation upon shear stress. Remarkably, shear stress led to an enhancement of cortical actin bundles along cell-cell boundaries where vascular endothelial cadherin (VE-cadherin) accumulated, rather than in the central region of the cells (Figures 5A and 5B). Furthermore, we detected the accumulation of monophosphorylated myosin regulatory light chain (pRLC) on the cortical actin bundles in ECs exposed to shear stress (Figure 5C). Blebbistatin, an inhibitor of non-muscle myosin II (NM-II) ATPase, blocked shear stress-induced YAP translocation (Figures S5H and S5I). These results suggest that the actomyosin cytoskeleton is involved in nuclear translocation of YAP in the cells, in which cortical actin
B Localization of EGFP-YAP
A Tg(fli1:EGFP-YAP);(fli1:H2B-mC) 56 hpf 20 min after Before cessation of BF treatment (Nifedipine)
N C or N = C
C
Figure 4. Blood Flow Regulates Yap1 Localization Tg(fli1:EGFP-YAP);(fli1:H2B-mC) 56 hpf20 min after Before After restart cessation of BF treatment of BF (BDM)
EGFP-YAP
(49)
Relative GFP intensity (normalized by Myr-mC)
EGFP-YAP/H2B-mC
(49)
tre Bef a or Af te tme e of r ce nt BF ss (B atio Af DM n te ) r of res BF ta rt
Localization of EGFP-YAP
EGFP-YAP/H2B-mC
EGFP-YAP
(A) Time-sequential confocal images of Tg(fli1: EGFP-YAP);(fli1:H2B-mC) embryos before treat80 ment (56 hpf) and 20 min after cessation of blood flow (BF) by nifedipine treatment. EGFP-YAP was 60 translocated from the nucleus (orange arrow40 heads) to the cytoplasm (white arrowheads) after 20 ISV cessation of BF. 0 e n ISV (B) Graph shows percentage of the number of the or ent atio e) f in s Be tm ECs in which EGFP-YAP is excluded from the a es dip rt e er c ife nucleus (N < C, white bars) and those in which t (N f A F B EGFP-YAP is localized in the nucleus (N > C or D f o N = C, black bars) among the total number of (%) (66) (66) (66) observed ECs (indicated at the top) in ISVs of 100 Tg(fli1:EGFP-YAP);(fli1:H2B-mC) embryos before 80 treatment (56 hpf) and 20–30 min after cessation of 60 BF by nifedipine. 40 (C) Similarly to (A), the images of the embryo before 20 treatment, 20 min after cessation of BF by 3-bu0 tanedione monoxime (BDM) treatment, and 2 hr after restart of BF by washing out BDM. EGFPYAP was translocated from the nucleus (orange arrowheads) to the cytoplasm (white arrowheads) after cessation of BF and relocated to the nucleus E Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) (orange arrowheads) after the restart of BF. 56 hpfGFP Myr-mC (D) Similarly to (B), the number of the ECs having F EGFP-YAP in the nucleus or cytoplasm was quantified before and after the treatment with BDM ** 1.5 Before as indicated at the bottom. treatment (E) Projection of confocal stack fluorescence im1 ages of the ISVs in Tg(fli1:Gal4db-TEAD2DN-2AmC);(UAS:GFP);(fli1:Myr-mC) embryos at 56 hpf 0.5 (before treatment) and 10 hr after cessation of BF by nifedipine treatment. GFP images (left) and 0 10h after Myr-mC images (right) are shown. To avoid the cessation of BF Before 10h after bleaching of the fluorescent protein, we performed (Nifedipine) treatment cessation confocal imaging at two time points (before treatof BF ment and 10 hr after) with minimum laser power using the GaAsP detector. Arrows indicate GFPpositive ECs. (F) Fluorescent intensities of GFP in individual ISVs were quantified before treatment and 10 hr after cessation of BF by nifedipine, as observed in (E). The intensity of GFP in ECs was normalized by that of mCherry (see STAR Methods). Fifteen ISVs of three embryos were analyzed. **p < 0.01. Scale bars, 10 mm. See also Figure S4. (%) 100
bundling is enhanced in response to shear stress. Consistently, the cortical actin bundles were rarely seen in ECs sheared for 6 hr and 24 hr, in which nuclear translocation was not enhanced, whereas thinner stress fibers were increased in the center of these cells (Figure S3D). Angiomotins Regulate Nuclear Translocation of YAP in Response to Shear Stress We hypothesized that AMOT might determine the localization of YAP, because AMOT is known to inhibit nuclear localization of YAP via a direct interaction (Chan et al., 2011; Mana-Capelli et al., 2014; Zhao et al., 2011). Binding of AMOT to YAP was confirmed in ECs (Figures S6A and S6B). We then examined the effect of overexpression of EGFP-AMOT on translocation of YAP in ECs exposed to shear stress and found that overexpressed EGFP-AMOT inhibited shear stress-induced nuclear translocation of YAP (Figures 6A and 6B). Competitive binding of YAP and F-actin to AMOT determines the localization of YAP (Feng et al., 2014; Mana-Capelli et al., 2014). We assumed
that YAP released from AMOT-YAP complex enters the nuclei upon shear stress when AMOT binds to cortical F-actin. To examine this idea, we first observed localization of endogenous AMOT before and after shear stress. Our confocal and superresolution imaging revealed that AMOT was preferentially colocalized with the enhanced cortical actin bundles after shear stress (Figures 6C, S6C, and S6D), suggesting that shear stress promotes binding of AMOT to the cortical F-actin bundles. Next, we examined AMOT-YAP binding before and after shear stress by coimmunoprecipitation analyses using two independent antibodies. Coimmunoprecipitation analyses revealed that endogenous YAP bound to AMOT in static ECs (Figures 6D and 6E). Upon shear stress, the AMOT-YAP binding was markedly reduced (Figures 6D–6F), suggesting that YAP is released from AMOT in response to shear stress. AMOT, AMOTL1, and AMOTL2, which constitute the AMOT family, bind to and negatively regulate YAP (Chan et al., 2011; Wang et al., 2011; Zhao et al., 2011). HPAECs expressed all AMOT family members (Figure S6E). Single inhibition of AMOT, Developmental Cell 40, 523–536, March 27, 2017 529
A
Static F-actin
Shear
C
Static pRLC (Ser19)
F-actin VE-cad/YAP/ F-actin
pRLC/F-actin/ VE-cad
HPAEC
Fluorescence intensity
Fluorescence intensity
B
Static 1 F-actin 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25 30 1 0.8 0.6 0.4 0.2 0 0
VE-cadherin
Shear 1 F-actin 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25 30 (μm)
1 0.8 0.6 0.4 0.2 0 5 10 15 20 25 30 0
VE-cadherin
5 10 15 20 25 30 (μm)
AMOTL1, or AMOTL2 significantly enhanced expression of a YAP target gene, CTGF (although the effect of AMOTL1 knockdown was relatively weak; Figure S6F), suggesting that all AMOT family members function as negative regulators of YAP in HPAECs. Therefore, we performed triple knockdown using their siRNAs (Figure S6E). Knockdown of AMOTs resulted in nuclear translocation of YAP even in static ECs (Figures 6G and 6H). In the ECs depleted of AMOTs, shear stress induced neither nuclear localization of YAP nor CTGF mRNA expression (Figures 6G, 6H, and S6G), suggesting that nuclear accumulation of YAP depends upon AMOTs. We further tested whether AMOTs regulate the localization of YAP indirectly by modulating the actin cytoskeleton, because AMOTs modulate actin fiber formation in ECs (Ernkvist et al., 2006). Knockdown of AMOTs did not significantly affect F-actin bundling (Figure S6H), suggesting that the effects of AMOTs knockdown on the localization of YAP are not primarily due to the alteration of F-actin structures. Taken together, these results suggest the following model. YAP is kept in the cytoplasm, in part, by binding to AMOT in static ECs, is released from AMOT that preferentially binds to cortical actin bundles upon shear stress, and thereafter enters the nucleus to promote TEADdependent transcription (Figure 6I). To test whether AMOT family members also control YAP localization in ECs in vivo, we investigated the effects of loss of AMOT family in zebrafish. We examined amotl2afu45 mutant fish, because Amotl2a negatively regulates Yap1 in the lateral line primordium of zebrafish (Agarwala et al., 2015). In the EC-specific TEAD reporter fish embryos with amotl2afu45 allele exhibited ectopic GFP expression in the developing ISVs, which was rarely detected in the wild-type embryos (Figures 6J and S6I). This 530 Developmental Cell 40, 523–536, March 27, 2017
Shear
Figure 5. Flow Induces Reorganization of F-Actin Accompanied by Nuclear Translocation of YAP (A) HPAECs under static conditions or after subjected to shear stress at 15 dynes/cm2 for 10 min were immunostained with anti-VE-cadherin and anti-YAP antibodies and stained with rhodaminephalloidin (F-actin). F-actin images (upper) and the merged images (lower; VE-cadherin, red; YAP, green; F-actin, blue) are shown. (B) Fluorescence intensity of F-actin or VE-cadherin signal in (A) was scanned across cell-cell boundaries (dotted lines). Nine different cell-cell boundaries were measured (shown in different colors). Graphs are representative of five independent experiments. (C) HPAECs under static conditions or after being subjected to shear stress were immunostained with anti-pRLC (phosphorylated myosin regulatory light chain) on Ser19 (pRLC (Ser19)) and anti-VEcadherin antibodies and stained with rhodaminephalloidin. pRLC images (top), F-actin images (middle), and the merged images (bottom; pRLC, green; F-actin, red; VE-cadherin, blue) are shown. Scale bars, 10 mm. See also Figure S5.
result suggests that the AMOT family is required for inhibiting nuclear translocation of Yap1 of ECs in unlumenized vessels in vivo. The GFP signals within the DA and PCV of these reporter embryos with amotl2afu45 were greater than those in the control (Figure 6J), although these vessels were perfused at 30 hpf. Therefore, blood flow might partly cancel the inhibitory activity of Amotl2a toward Yap1 in large vessels. Yap1 Is Required for the Maintenance of Blood Vessels in Zebrafish Finally, we explored the function of Yap1 in vascular development and maintenance by analyzing yap1ncv101 null mutants. The yap1ncv101 null mutants were morphologically normal at least until 7 dpf (Figure S1E), as recently reported (Agarwala et al., 2015), and exhibited normal blood vasculature formation (Figure 7A). However, we noticed vessel regression in yap1ncv101 mutant larvae. From 4.5 to 6.5 dpf, yap1ncv101 homozygous mutant larvae exhibited more frequent lumen stenosis and subsequent vessel retraction in the DLAVs than the wild-type larvae (Figures 7B and 7C). In the hindbrain, the CCtA underwent more vessel stenosis in the mutants at 4 dpf than in the control (Figures 7D and 7E). We also observed distorted blood vessels whereby the width of vessels became irregular in the CCtA, MMCtA (Figure S7A), and ISVs (data not shown) of yap1ncv101 mutant fish. Consequently, vascular networks became sparse in the DLAVs (Figure 7B) and in the CCtA of yap1ncv101 mutant larvae (Figures S7B and S7C). Cessation of blood flow also resulted in lumen stenosis in the DLAVs (Figure 7F). These results suggest that Yap1 might be required for the maintenance of vascular lumen in the presence of blood flow in these vessels. Furthermore, we observed ectopic sprouts and ectopic connections especially in the anterior ISVs and LDA of yap1 mutant fish (Figures 7G–7L), highlighting another important function of Yap1 in vessel
Static
A YAP
Shear
B
EGFP-AMOT
EGFP
YAP Nucleus/Cytoplasm
GFP/YAP1/DAPI GFP/YAP/DAPI
(Super resolution) G 1
Static
(Confocal) AMOT/F-actin 1
2 2
3 4 4
St
ati
c
r ea Sh (kDa) 150
IP: AMOT YAP Ab (Mouse) YAP
75 150
Input AMOT
c
ati
E
St
IP: AMOT YAP Ab (Rabbit) YAP
e Sh
ar (kDa) 150 75
Static Shear
F NS
**
**
2
Static YAP/DAPI
NS
Shear
I
Static AMOT
1.5
Shear stress
AMOT
YAP
1
?
YAP AMOT
AMOT
0.5 0
J
150
Input AMOT
1.4 1.2 1 0.8 0.6 0.4 0.2 0
H YAP Nucleus/Cytoplasm
D
Relative intensity
r r ic ic at h e a t a t h e a S St S S EGFP EGFP-AMOT
AMOTs Triple siRNA
Shear
3
YAP
*** NS
HPAEC Control siRNA
C
*** 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
Nucleus
tic ear tatic hear Sta Sh S S Control AMOTs triple siRNA siRNA
YAP
YAP
TEAD
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT amotl2afu45 30 hpf
GFP
NS
GFP/ Myr-mC AMOT YAP IP: YAP Ab
AMOT Input
Figure 6. Angiomotins Are Involved in the Regulation of Nuclear Translocation of YAP Induced by Shear Stress (A) HPAECs transfected with EGFP or EGFP-AMOT were kept under static conditions or subjected to shear stress (15 dynes/cm2, 10 min) and immunostained with anti-YAP and anti-GFP antibodies together with DAPI. YAP images (left) and the merged images (right; EGFP, green; YAP, red; DAPI, blue) are shown. Yellow arrowheads indicate EGFP-expressing cells. (B) Quantification of nuclear fluorescence intensity of YAP relative to that of cytoplasm in EGFP- or EGFP-AMOT-expressing HPAECs as in (A) (n = 3 independent experiments, in each of which >20 EGFP-expressing cells measured). (C) HPAECs under static conditions or after shear stress were immunostained with anti-AMOT antibody and stained with rhodamine-phalloidin (F-actin). Superresolution images (right) were acquired in the boxed regions of confocal fluorescence images (left). In the right panels, the merged images (left; AMOT, green; F-actin, red) and AMOT images (right: green) are shown. Representative images of two independent experiments are shown. (D and E) Lysates of static or sheared HPAECs were immunoprecipitated with mouse anti-YAP (D) or rabbit anti-YAP antibody (E). Coprecipitated endogenous AMOT (p130) was detected by immunoblotting with anti-AMOT antibody. Similar results were obtained in three independent experiments using each antibody. (legend continued on next page)
Developmental Cell 40, 523–536, March 27, 2017 531
stabilization. Yap1-dependent transcription of the TEAD reporter fish remained positive in the DLAVs, ISVs, CCtA, and MCtA, where Yap1 affected vessel stability at least until 6–7 dpf (Figure S7D). We assumed that the flow pattern might determine the transient and sustained nuclear localization of Yap1. As our results using cultured ECs demonstrated, Yap1 transiently entered the nucleus in response to laminar shear stress. However, defects of blood vessels were found later in vivo. Recently, Wang et al. (2016) reported that nuclear localization of YAP/TAZ is induced by 24 hr of disturbed flow. Therefore, we investigated the flow pattern in the DLAV where sustained Yap1-dependent transcription was observed and in the DA where transient Yap1-dependent transcription was observed (Figure S7D). The flow in the DLAV was disturbed (Movie S3), whereas that in the DA was laminar (Movie S4). These results suggest that the flow pattern might regulate the localization of Yap1 in vivo. We then examined the effects of gain-of-function of Yap1 on vascular development. In the lats1 and lats2 double MO oligonucleotides, in which GFP signals of ubiquitous TEAD reporter were increased (Figures S1G and S1H), sprouting, elongation, and lumenization of the ISVs occurred normally (Figures S7E and S7F). In addition, expression of EGFP-tagged Yap1-5SA, a nuclear localized form of zebrafish Yap1 that mimics Yap1 activation (Chiba et al., 2016), did not affect vessel sprouting (data not shown) and lumen formation (Figure S7G). Thus, we could not detect any obvious effects of Yap1 gains of function on vascular development. We then examined whether nuclear Yap1 drives lumen formation in the absence of blood flow. When cardiac contraction and blood flow were blocked by knockdown of cardiac troponin T type A (tnnt2a) using MO, lumen formation was impaired in the ISVs (Figure S7H) as reported previously (Montero-Balaguer et al., 2009; Wang et al., 2010). Expression of EGFP-Yap1-5SA did not induce lumen formation in the closed ISVs of these morphants (Figure S7H), suggesting that nuclear Yap1 is not sufficient to drive lumen formation. Finally, we tested whether Wwtr1 might have a redundant role in vascular development in yap1ncv101 mutants by examining the phenotypes of embryos from incrosses of double-heterozygous yap1ncv101/+:wwtr1ncv114/+ mutant fish. Double-homozygous yap1ncv101:wwtr1ncv114 mutant embryos died until 32 hpf before the circulation, exhibiting severe developmental defects (Figures S7I). In these mutants, formation of the axial vessels (the DA and PCV) were completely abrogated (Figure S7J). Developmental defects of yap1ncv101:wwtr1ncv114/+ mutant em-
bryos were milder than those of yap1ncv101:wwtr1ncv114 mutant embryos (Figure S7I). Although these embryos exhibited normal patterning of blood vessels including the DA, PCV, ISVs, and DLAVs (Figure S7J), they did not have circulation (Figure S7L) due to the cardia bifida (Figures S7K and S7L). Therefore, it is technically difficult to examine the functional redundancy of Wwtr1 in flow-regulated processes using these mutants. DISCUSSION In the present study, we developed three types of Tg fish to monitor Yap1 regulation in ECs of living zebrafish. Whereas ubiquitous TEAD reporter and EC-specific TEAD reporter can indirectly reflect transcriptional activity of Yap1 or Taz through TEAD as GFP expression, Tg(fli1:EGFP-YAP) fish directly mimic localization of Yap1 in ECs. By using these Tg fish, we revealed that Yap1 responded to blood flow in ECs. Because YAP functions in multiple organs and tissues (Piccolo et al., 2014), these Tg fish will become a powerful tool to investigate the regulation of Yap1. Yap1 responds to blood flow in vivo. While blood flow generates mechanical stimuli including shear stress and mechanical strain (Hahn and Schwartz, 2009), blood flow transports multiple molecules that might affect Yap1. However, it is technically difficult to separate these factors in vivo. Considering that YAP is shown to respond to various mechanical forces as reported by the studies using cultured cells (Aragona et al., 2013; BenhamPyle et al., 2015; Calvo et al., 2013; Codelia et al., 2014; Dupont et al., 2011; Sabine et al., 2015; Wada et al., 2011), we used cultured ECs to try to render the ECs exposed only to shear stress and revealed that YAP responded to laminar shear stress. Therefore, at least shear stress induced by blood flow might potentially regulate the localization of Yap1 in vivo. We revealed flow-dependent nuclear translocation of Yap1 in lumenized blood vessels. Choi et al. (2015) have recently observed nuclear localization of YAP in the angiogenic front of the mouse retina where flow is absent. We also detected flowindependent nuclear localization of Yap1 in vessel sprouts of the brain vessels, albeit weaker than that in lumenized vessels. Thus, YAP could be regulated in both flow-dependent and flow-independent manners in ECs. Even in the perfused vessels, TEAD reporter was not driven in some vessels. Therefore, blood flow might not be a sole determinant for nuclear localization of Yap1 in these ECs. Mechanical forces regulate YAP localization through both LATS-dependent (Codelia et al., 2014; Wada et al., 2011) and
(F) Total AMOT (Input) and the AMOT and YAP immunoprecipitated with rabbit anti-YAP antibody (IP: YAP Ab) in static or sheared HPAECs as in (E) were analyzed. The relative intensity was calculated by the intensity of the band of immunoprecipitated AMOT or YAP by anti-YAP antibody in the static or sheared HPAECs (n = 3 independent experiments). (G) HPAECs transfected with control siRNA or AMOT + AMOTL1 + AMOTL2 siRNAs (AMOTs triple siRNAs) were kept under static conditions or subjected to shear stress (15 dynes/cm2, 10 min) and immunostained with anti-YAP antibody together with DAPI. (H) Quantification of nuclear fluorescence intensity of YAP relative to that of cytoplasm as in (G) (n = 3 independent experiments, in each of which >100 cells were measured). (I) A schematic representation of how YAP translocates into the nucleus in response to shear stress. In static ECs YAP is kept in the cytoplasm, at least in part by binding to AMOT. Upon shear stress, a significant population of AMOT preferentially binds to the increased levels of cortical actin bundles. By direct binding to F-actin or by other unknown mechanism, AMOT releases YAP. Released YAP then enters into the nucleus to promote TEAD-dependent transcription. (J) Projection view of confocal stack fluorescence images of the trunk region in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT (left) and homozygous amotl2afu45 mutant embryos (right) at 30 hpf. Upper panels, GFP images; lower panels, merged images (GFP, green; Myr-mC, red). Arrows indicate ectopic GFP expression in the developing ISVs. Representative images of three independent experiments are shown. Data are means ± SD in (B), (F), and (H). **p < 0.01, ***p < 0.001; NS, not significant. Scale bars, 10 mm. See also Figure S6.
532 Developmental Cell 40, 523–536, March 27, 2017
A
B Tg(fli1:EGFP)
D Tg(fli1:EGFP) 4 dpf
yap1ncv101
yap1ncv101/+
WT
DLAV ISV DA PCV
Tg(fli1:EGFP) 31 hpf WT
yap1ncv101
CCtA
yap1ncv101
WT
F
4.5 dpf
Tg(fli1:EGFP) 5 dpf
(Cross section)
Normal blood flow 0h
5 dpf 5.5 dpf
14 h
6 dpf Cessation of blood flow
0h
E
0
on sis on sis no tracti teno tracti e t S Re S Re
14 h
**
10
H
5 0
WT yap1ncv101 Tg(fli1:EGFP) 3 dpf WT
WT yap1ncv101/+ yap1ncv101
1 0
Ectopic sprout
yap1ncv101
WT
WT
LDA
yap1
ncv101
J Embryos with ectopic sprouts from the LDA
I Tg(fli1:EGFP) 32 hpf
K Tg(fli1:EGFP) 3.5 dpf
(%) 60
WT
*
50 40 30
LDA
20 10 0
WT
yap1ncv101
(Ectopic connection)
yap1ncv101
L ncv101
yap1
Embryos with ectopic connections in the LDA
(Ectopic sptout)
*
**
5 4 3 2
Ectopic connection
1 0.5
** 15
Ectopic sprout
1.5
Ectopic connection
**
Events/embryo (Anterior 14 ISVs)
G
** 2
Stenosis in CCtA /embryo
C
The number of events /somite (4.5-6.5 dpf)
6.5 dpf
(%) 100
**
80 60 40 20 0
WT
yap1ncv101
Figure 7. Yap1 Is Required for Vessel Maintenance (A) Projection view of confocal stack fluorescence images of Tg(fli1:EGFP) WT (left) embryos with WT allele (left) and yap1ncv101 mutant allele (right) fixed at 31 hpf. Note the overall normal vascular formation in homozygous mutants. (B) Projection view of confocal images of the DLAVs in Tg(fli1:EGFP) larvae with WT (left) and yap1ncv101 allele (right) taken every 12 hr from 4.5 dpf to 6.5 dpf. White and yellow arrows indicate blood vessels exhibiting lumen stenosis and EC retraction, respectively. (C) Quantitative analyses of incidence of the DLAVs showing lumen stenosis and EC retraction at a single somite level from 4.5 to 6.5 dpf as in (B). Each dot represents the value for an embryo. For each embryo, the number of the events at six to eight somite levels were counted and then divided by the total number of somite levels observed. Horizontal lines represent mean ± SD. (D) Projection view of confocal images of the hindbrain region in Tg(fli1:EGFP) larvae with WT allele (left), heterozygous yap1ncv101/+ allele (middle), and yap1ncv101 allele (right) at 4 dpf. Dorsal view. Dashed circles indicate lumen stenosis in the CCtA. (E) Quantification of the number of blood vessels showing lumen stenosis in the CCtA of WT, yap1ncv101/+, or yap1ncv101 larvae at 4 dpf as observed in (D). Each dot represents the number of stenoses found in an embryo. Horizontal lines represent mean ± SD (n R 10 independent experiments). (legend continued on next page)
Developmental Cell 40, 523–536, March 27, 2017 533
LATS-independent pathways (Calvo et al., 2013; Dupont et al., 2011). Our findings indicate that YAP responds to shear stress in a LATS-independent pathway, since shear stress induced nuclear translocation of YAP even in the absence of LATS1/2. Instead, we revealed that YAP entered the nucleus by dissociating from AMOT under shear stress. Upon shear stress, cortical actin bundling was enhanced along cell-cell junctions. Given that AMOT preferentially localized with the enhanced cortical actin in our experiments and that YAP and F-actin compete with each other for binding to AMOT (Feng et al., 2014; Mana-Capelli et al., 2014), an increased binding of AMOT to the enhanced cortical actin would trigger YAP release. Mechanical forces often involve modulation of the actin cytoskeleton (Aragona et al., 2013; Calvo et al., 2013; Dupont et al., 2011). It would be interesting to test whether other external forces might also affect YAP localization by affecting the binding between YAP and AMOT or other AMOT family members. There is a difference in the duration of YAP responses to flow between in vitro and in vivo. While nuclear translocation of YAP by laminar shear stress was transient in HPAECs, Yap1-dependent transcription of TEAD reporter fish was sustained at least until 6–7 dpf in the DLAVs, ISVs, and CCtA. These differences between transient nuclear localization of YAP in vitro and sustained nuclear localization of Yap1 in vivo could be explained by the flow patterns. Laminar shear stress transiently induces activation of nuclear factor kB, reactive oxygen species production, and expression of proinflammatory genes, while disturbed flow keeps those in a sustained manner (Hahn and Schwartz, 2009). A recent report by Wang et al. (2016) demonstrates that disturbed but not laminar flow for 12 and 24 hr induces nuclear localization of YAP/TAZ. Consistently, 48 hr of oscillatory shear stress enhances nuclear localization of YAP/TAZ in cultured lymphatic ECs (LECs) (Sabine et al., 2015). In these LECs, thick cortical actin fibers, similar to what we observed in the sheared HPAECs, are induced (Sabine et al., 2015). Thus, some types of disturbed flow could induce sustained nuclear translocation of YAP in ECs, while laminar shear stress does so transiently. Therefore, flow patterns might determine the localization of Yap1/YAP both in vitro and in vivo. Homozygous yap1ncv101 mutants did not show any cardia bifida, while we reported cardia bifida in yap1 MO-injected embryos (Fukui et al., 2014). Here, we have demonstrated that double-homozygous yap1ncv101:wwtr1ncv114 mutant embryos and yap1ncv101:wwtr1ncv114/+ mutant embryos exhibited cardia bifida
(Figures S7K and S7L), suggesting that Wwtr1 functions redundantly with Yap1 to inhibit cardia bifida when Yap1 is depleted. In general, the discrepancy between MO injection and mutants is thought to be due to off-target or non-off-target effects (Kok et al., 2015; Rossi et al., 2015). Therefore, we consider two possibilities to explain this case. One possibility is that yap1 MO might induce cardia bifida by blocking both Yap1 and other off-target genes that might affect Wwtr1 activity. The other is that Wwtr1 might compensate for Yap1 in yap1ncv101 mutants, but not in yap1 morphants. Consistent with the latter hypothesis, upregulation of total Wwtr1 protein is reported in yap1 mutants (Miesfeld et al., 2015). Further studies are needed to completely solve the discrepancy between Yap1 morphant and mutant. Yap1 is important for the maintenance of blood vessels. Since yap1 mutant larvae exhibited enhanced lumen stenosis in the DLAVs and CCtA, Yap1 is required for the maintenance of the lumen structure in some blood vessels. Blood flow is important for the maintenance of lumenized blood vessels (Chen et al., 2012; Meeson et al., 1996; Wang et al., 2010). We also revealed that cessation of blood flow resulted in lumen stenosis in the DLAVs of zebrafish larvae. Therefore, we assumed that Yap1 might be involved in the flow-mediated lumen maintenance. A recent report showed that YAP is required for generating actomyosin-mediated tissue tension to define proper tissue shape in medaka and zebrafish (Porazinski et al., 2015). Yap1 in ECs might be important for generating mechanical tensions to maintain EC shape in forming vascular lumen. On the other hand, Yap1 is also important for keeping the appropriate shape and width in some vessels including the CCtA, MMCtA, and ISVs. Future studies are needed to elucidate the mechanisms by which Yap1 stabilizes lumenized blood vessels in response to blood flow. In conclusion, we have delineated a novel regulation of YAP in ECs by blood flow, which might be involved in vessel maintenance, and have uncovered a molecular mechanism by which shear stress induces nuclear translocation of YAP (Figure 6I). STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d
KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING
(F) Projection view of confocal stack fluorescence images of the DLAVs in Tg(fli1:EGFP) larvae (5 dpf) at the indicated time after cessation of blood flow by BDM treatment or without treatment. Transverse sections at the dashed lines are shown to the right. Arrows indicate blood vessels showing lumen stenosis. (G) Projection view of confocal images of the anterior trunk ISVs in Tg(fli1:EGFP) larvae with WT allele (left) and yap1ncv101 allele (right) at 3 dpf. White and yellow arrowheads indicate ISVs exhibiting ectopic sprouts and ectopic connections, respectively. (H) Quantification of the number of ectopic sprouts from the ISVs and ectopic connections in the ISVs within 14 ISVs of anterior trunk for each embryo at 3 dpf as in (G). Each dot represents the value for an embryo. Horizontal lines represent mean ± SD (n = 12 independent experiments). (I) Projection view of confocal images of the LDA in Tg(fli1:EGFP) embryos with WT allele (left) and yap1ncv101 allele (right) at 32 hpf. Dorsal view. White arrowheads indicate ectopic sprouts from the LDA. (J) Graph shows the percentage of the embryos with ectopic sprouts from the LDA at 31–32 hpf as in (I). Data are mean ± SD (n = 3 independent experiments, in each of which R9 embryos were measured). (K) Projection view of confocal images of the LDA in Tg(fli1:EGFP) larvae with WT allele (left) and yap1ncv101 allele (right) at 3.5 dpf. Dorsal view. Yellow arrowheads indicate ectopic connections in the LDA. (L) Graph shows the percentage of the embryos with ectopic connections in the LDA at 3.5 dpf as in (K). Data are mean ± SD (n = 3 independent experiments, in each of which >8 embryos were measured). *p < 0.05, **p < 0.01. Scale bars, 10 mm. See also Figure S7.
534 Developmental Cell 40, 523–536, March 27, 2017
d
d
d
EXPERIMENTAL MODEL AND SUBJECT DETAILS B Zebrafish B Cell Culture METHOD DETAILS B Plasmids B Transgenic Zebrafish Lines B Image Acquisition, Processing, and Quantification Using Microscopes B Microinjections of Morpholino Oligonucleotides (MOs) B Knockout Fish by Transcription Activator-like Effector Nuclease (TALEN) ncv101 B Phenotypic Analyses of yap1 , wwtr1ncv114, and fu45 Mutants amotl2a B FACS B RT-PCR and Quantitative Real-Time PCR (qPCR) Analyses B Transfection, Shear Stress, and siRNA-Mediated Protein Knockdown B Immunofluorescence B Immunoprecipitation and Western Blot Analysis QUANTIFICATION AND STATISTICAL ANALYSIS B Measurements of GFP Intensity in EC-Specific TEAD Reporter B Measurements of Nuclear/Cytoplasmic Ratio of YAP B Statistical Analysis
SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures, one table, and four movies and can be found with this article online at http://dx.doi.org/10.1016/j. devcel.2017.02.019. AUTHOR CONTRIBUTIONS
Ando, J., and Yamamoto, K. (2013). Flow detection and calcium signalling in vascular endothelial cells. Cardiovasc. Res. 99, 260–268. Aragona, M., Panciera, T., Manfrin, A., Giulitti, S., Michielin, F., Elvassore, N., Dupont, S., and Piccolo, S. (2013). A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154, 1047–1059. Asakawa, K., Suster, M.L., Mizusawa, K., Nagayoshi, S., Kotani, T., Urasaki, A., Kishimoto, Y., Hibi, M., and Kawakami, K. (2008). Genetic dissection of neural circuits by Tol2 transposon-mediated Gal4 gene and enhancer trapping in zebrafish. Proc. Natl. Acad. Sci. USA 105, 1255–1260. Avruch, J., Zhou, D., Fitamant, J., Bardeesy, N., Mou, F., and Barrufet, L.R. (2012). Protein kinases of the Hippo pathway: regulation and substrates. Semin. Cell Dev. Biol. 23, 770–784. Bao, Y., Nakagawa, K., Yang, Z., Ikeda, M., Withanage, K., Ishigami-Yuasa, M., Okuno, Y., Hata, S., Nishina, H., and Hata, Y. (2011). A cell-based assay to screen stimulators of the Hippo pathway reveals the inhibitory effect of dobutamine on the YAP-dependent gene transcription. J. Biochem. 150, 199–208. Benham-Pyle, B.W., Pruitt, B.L., and Nelson, W.J. (2015). Cell adhesion. Mechanical strain induces E-cadherin-dependent Yap1 and beta-catenin activation to drive cell cycle entry. Science 348, 1024–1027. Betz, C., Lenard, A., Belting, H.G., and Affolter, M. (2016). Cell behaviors and dynamics during angiogenesis. Development 143, 2249–2260. Bussmann, J., Wolfe, S.A., and Siekmann, A.F. (2011). Arterial-venous network formation during brain vascularization involves hemodynamic regulation of chemokine signaling. Development 138, 1717–1726. Calvo, F., Ege, N., Grande-Garcia, A., Hooper, S., Jenkins, R.P., Chaudhry, S.I., Harrington, K., Williamson, P., Moeendarbary, E., Charras, G., et al. (2013). Mechanotransduction and YAP-dependent matrix remodelling is required for the generation and maintenance of cancer-associated fibroblasts. Nat. Cell Biol. 15, 637–646. Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F. (2011). Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res. 39, e82.
H.N. performed the majority of experiments. K.Y. provided a method for shear stress experiments; K.T. and H.F. developed Tg fish. S.A., K.A., T.M., E.S., H.-G.B., M.A., and V.L. developed mutant fish. K.Y. and Y.Y. supported the experiments. H.N., S.F., and N.M. analyzed results. H.N. and N.M. designed the project and wrote the manuscript. H.-G.B., M.A., and V.L. revised the manuscript.
Chan, S.W., Lim, C.J., Chong, Y.F., Pobbati, A.V., Huang, C., and Hong, W. (2011). Hippo pathway-independent restriction of TAZ and YAP by angiomotin. J. Biol. Chem. 286, 7018–7026.
ACKNOWLEDGMENTS
Chen, Q., Jiang, L., Li, C., Hu, D., Bu, J.W., Cai, D., and Du, J.L. (2012). Haemodynamics-driven developmental pruning of brain vasculature in zebrafish. PLoS Biol. 10, e1001374.
We are grateful to M. Sone, T. Babazono, W. Koeda, K. Hiratomi, E. Okamoto, H. Toyoshima, and M. Ueda for excellent technical assistance, K. Shioya for excellent fish care, and J.S. Gutkind for helpful advice. This work was supported in part by grants from JSPS KAKENHI (No. 16H02618 to N.M.; No. 25871232 to H.N.); AMED-CREST (No. 13414779 to N.M.); the Takeda Science Foundation (to N.M.); the Ichiro Kanehara Foundation, the Kanae Foundation for the Promotion of Medical Science, the Uehara Memorial Foundation, the Japan Foundation for Applied Enzymology, and the Japan Heart Foundation (to H.N.). Received: September 14, 2016 Revised: January 16, 2017 Accepted: February 24, 2017 Published: March 27, 2017 REFERENCES Agarwala, S., Duquesne, S., Liu, K., Boehm, A., Grimm, L., Link, S., Konig, S., Eimer, S., Ronneberger, O., and Lecaudey, V. (2015). Amotl2a interacts with the Hippo effector Yap1 and the Wnt/beta-catenin effector Lef1 to control tissue size in zebrafish. Elife 4, e08201.
Chen, C.H., Sun, Y.H., Pei, D.S., and Zhu, Z.Y. (2009). Comparative expression of zebrafish lats1 and lats2 and their implication in gastrulation movements. Dev. Dyn. 238, 2850–2859.
Cheung, A., Dantzig, J.A., Hollingworth, S., Baylor, S.M., Goldman, Y.E., Mitchison, T.J., and Straight, A.F. (2002). A small-molecule inhibitor of skeletal muscle myosin II. Nat. Cell Biol. 4, 83–88. Chiba, A., Watanabe-Takano, H., Terai, K., Fukui, H., Miyazaki, T., Uemura, M., Hashimoto, H., Hibi, M., Fukuhara, S., and Mochizuki, N. (2016). Osteocrin, a peptide secreted from the heart and other tissues, contributes to cranial osteogenesis and chondrogenesis in zebrafish. Development 144, 334–344. Chiu, J.J., and Chien, S. (2011). Effects of disturbed flow on vascular endothelium: pathophysiological basis and clinical perspectives. Physiol. Rev. 91, 327–387. Choi, H.J., Zhang, H., Park, H., Choi, K.S., Lee, H.W., Agrawal, V., Kim, Y.M., and Kwon, Y.G. (2015). Yes-associated protein regulates endothelial cell contact-mediated expression of angiopoietin-2. Nat. Commun. 6, 6943. Codelia, V.A., Sun, G., and Irvine, K.D. (2014). Regulation of YAP by mechanical strain through Jnk and Hippo signaling. Curr. Biol. 24, 2012–2017. Cui, Y., Hameed, F.M., Yang, B., Lee, K., Pan, C.Q., Park, S., and Sheetz, M. (2015). Cyclic stretching of soft substrates induces spreading and growth. Nat. Commun. 6, 6333.
Developmental Cell 40, 523–536, March 27, 2017 535
Dupont, S., Morsut, L., Aragona, M., Enzo, E., Giulitti, S., Cordenonsi, M., Zanconato, F., Le, D.J., Forcato, M., Bicciato, S., et al. (2011). Role of YAP/ TAZ in mechanotransduction. Nature 474, 179–183.
Montero-Balaguer, M., Swirsding, K., Orsenigo, F., Cotelli, F., Mione, M., and Dejana, E. (2009). Stable vascular connections and remodeling require full expression of VE-cadherin in zebrafish embryos. PLoS One 4, e5772.
Eilken, H.M., and Adams, R.H. (2010). Dynamics of endothelial cell behavior in sprouting angiogenesis. Curr. Opin. Cell Biol. 22, 617–625.
Morin-Kensicki, E.M., Boone, B.N., Howell, M., Stonebraker, J.R., Teed, J., Alb, J.G., Magnuson, T.R., O’Neal, W., and Milgram, S.L. (2006). Defects in yolk sac vasculogenesis, chorioallantoic fusion, and embryonic axis elongation in mice with targeted disruption of Yap65. Mol. Cell. Biol. 26, 77–87.
Ernkvist, M., Aase, K., Ukomadu, C., Wohlschlegel, J., Blackman, R., Veitonmaki, N., Bratt, A., Dutta, A., and Holmgren, L. (2006). p130-angiomotin associates to actin and controls endothelial cell shape. FEBS J. 273, 2000–2011. Feng, X., Degese, M.S., Iglesias-Bartolome, R., Vaque, J.P., Molinolo, A.A., Rodrigues, M., Zaidi, M.R., Ksander, B.R., Merlino, G., Sodhi, A., et al. (2014). Hippo-independent activation of YAP by the GNAQ uveal melanoma oncogene through a trio-regulated rho GTPase signaling circuitry. Cancer Cell 25, 831–845. Franco, C.A., Jones, M.L., Bernabeu, M.O., Geudens, I., Mathivet, T., Rosa, A., Lopes, F.M., Lima, A.P., Ragab, A., Collins, R.T., et al. (2015). Dynamic endothelial cell rearrangements drive developmental vessel regression. PLoS Biol. 13, e1002125. Freund, J.B., Goetz, J.G., Hill, K.L., and Vermot, J. (2012). Fluid flows and forces in development: functions, features and biophysical principles. Development 139, 1229–1245. Fukui, H., Terai, K., Nakajima, H., Chiba, A., Fukuhara, S., and Mochizuki, N. (2014). S1P-Yap1 signaling regulates endoderm formation required for cardiac precursor cell migration in zebrafish. Dev. Cell 31, 128–136. Geudens, I., and Gerhardt, H. (2011). Coordinating cell behaviour during blood vessel formation. Development 138, 4569–4583. Hahn, C., and Schwartz, M.A. (2009). Mechanotransduction in vascular physiology and atherogenesis. Nat. Rev. Mol. Cell Biol. 10, 53–62. Herbert, S.P., and Stainier, D.Y. (2011). Molecular control of endothelial cell behaviour during blood vessel morphogenesis. Nat. Rev. Mol. Cell Biol. 12, 551–564. Herwig, L., Blum, Y., Krudewig, A., Ellertsdottir, E., Lenard, A., Belting, H.G., and Affolter, M. (2011). Distinct cellular mechanisms of blood vessel fusion in the zebrafish embryo. Curr. Biol. 21, 1942–1948. Kok, F.O., Shin, M., Ni, C.W., Gupta, A., Grosse, A.S., van Impel, A., Kirchmaier, B.C., Peterson-Maduro, J., Kourkoulis, G., Male, I., et al. (2015). Reverse genetic screening reveals poor correlation between morpholinoinduced and mutant phenotypes in zebrafish. Dev. Cell 32, 97–108. Kwon, H.B., Fukuhara, S., Asakawa, K., Ando, K., Kashiwada, T., Kawakami, K., Hibi, M., Kwon, Y.G., Kim, K.W., Alitalo, K., et al. (2013). The parallel growth of motoneuron axons with the dorsal aorta depends on Vegfc/Vegfr3 signaling in zebrafish. Development 140, 4081–4090. Langheinrich, U., Vacun, G., and Wagner, T. (2003). Zebrafish embryos express an orthologue of HERG and are sensitive toward a range of QTprolonging drugs inducing severe arrhythmia. Toxicol. Appl. Pharmacol. 193, 370–382.
Ota, M., and Sasaki, H. (2008). Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling. Development 135, 4059–4069. Piccolo, S., Dupont, S., and Cordenonsi, M. (2014). The biology of YAP/TAZ: hippo signaling and beyond. Physiol. Rev. 94, 1287–1312. Porazinski, S., Wang, H., Asaoka, Y., Behrndt, M., Miyamoto, T., Morita, H., Hata, S., Sasaki, T., Krens, S.F., Osada, Y., et al. (2015). YAP is essential for tissue tension to ensure vertebrate 3D body shape. Nature 521, 217–221. Rossi, A., Kontarakis, Z., Gerri, C., Nolte, H., Holper, S., Kruger, M., and Stainier, D.Y. (2015). Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature 524, 230–233. Sabine, A., Bovay, E., Demir, C.S., Kimura, W., Jaquet, M., Agalarov, Y., Zangger, N., Scallan, J.P., Graber, W., Gulpinar, E., et al. (2015). FOXC2 and fluid shear stress stabilize postnatal lymphatic vasculature. J. Clin. Invest. 125, 3861–3877. Sakurai, A., Fukuhara, S., Yamagishi, A., Sako, K., Kamioka, Y., Masuda, M., Nakaoka, Y., and Mochizuki, N. (2006). MAGI-1 is required for Rap1 activation upon cell-cell contact and for enhancement of vascular endothelial cadherinmediated cell adhesion. Mol. Biol. Cell 17, 966–976. Serluca, F.C., Drummond, I.A., and Fishman, M.C. (2002). Endothelial signaling in kidney morphogenesis: a role for hemodynamic forces. Curr. Biol. 12, 492–497. Uemura, M., Nagasawa, A., and Terai, K. (2016). Yap/Taz transcriptional activity in endothelial cells promotes intramembranous ossification via the BMP pathway. Sci. Rep. 6, 27473. Wada, K., Itoga, K., Okano, T., Yonemura, S., and Sasaki, H. (2011). Hippo pathway regulation by cell morphology and stress fibers. Development 138, 3907–3914. Wang, Y., Kaiser, M.S., Larson, J.D., Nasevicius, A., Clark, K.J., Wadman, S.A., Roberg-Perez, S.E., Ekker, S.C., Hackett, P.B., McGrail, M., et al. (2010). Moesin1 and Ve-cadherin are required in endothelial cells during in vivo tubulogenesis. Development 137, 3119–3128. Wang, W., Huang, J., and Chen, J. (2011). Angiomotin-like proteins associate with and negatively regulate YAP1. J. Biol. Chem. 286, 4364–4370. Wang, K.C., Yeh, Y.T., Nguyen, P., Limqueco, E., Lopez, J., Thorossian, S., Guan, K.L., Li, Y.J., and Chien, S. (2016). Flow-dependent YAP/TAZ activities regulate endothelial phenotypes and atherosclerosis. Proc. Natl. Acad. Sci. USA 113, 11525–11530.
Lawson, N.D., and Weinstein, B.M. (2002). In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 248, 307–318.
Yamamoto, K., Shimizu, N., Obi, S., Kumagaya, S., Taketani, Y., Kamiya, A., and Ando, J. (2007). Involvement of cell surface ATP synthase in flow-induced ATP release by vascular endothelial cells. Am. J. Physiol. Heart Circ. Physiol. 293, H1646–H1653.
Lucitti, J.L., Jones, E.A., Huang, C., Chen, J., Fraser, S.E., and Dickinson, M.E. (2007). Vascular remodeling of the mouse yolk sac requires hemodynamic force. Development 134, 3317–3326.
Yokota, Y., Nakajima, H., Wakayama, Y., Muto, A., Kawakami, K., Fukuhara, S., and Mochizuki, N. (2015). Endothelial Ca2+ oscillations reflect VEGFR signaling-regulated angiogenic capacity in vivo. Elife 4, e08817.
Mana-Capelli, S., Paramasivam, M., Dutta, S., and McCollum, D. (2014). Angiomotins link F-actin architecture to Hippo pathway signaling. Mol. Biol. Cell 25, 1676–1685.
Yu, F.X., and Guan, K.L. (2013). The Hippo pathway: regulators and regulations. Genes Dev. 27, 355–371.
Meeson, A., Palmer, M., Calfon, M., and Lang, R. (1996). A relationship between apoptosis and flow during programmed capillary regression is revealed by vital analysis. Development 122, 3929–3938. Miesfeld, J.B., Gestri, G., Clark, B.S., Flinn, M.A., Poole, R.J., Bader, J.R., Besharse, J.C., Wilson, S.W., and Link, B.A. (2015). Yap and Taz regulate retinal pigment epithelial cell fate. Development 142, 3021–3032.
536 Developmental Cell 40, 523–536, March 27, 2017
Zhao, B., Li, L., Lu, Q., Wang, L.H., Liu, C.Y., Lei, Q., and Guan, K.L. (2011). Angiomotin is a novel Hippo pathway component that inhibits YAP oncoprotein. Genes Dev. 25, 51–63. Zygmunt, T., Gay, C.M., Blondelle, J., Singh, M.K., Flaherty, K.M., Means, P.C., Herwig, L., Krudewig, A., Belting, H.G., Affolter, M., et al. (2011). Semaphorin-PlexinD1 signaling limits angiogenic potential via the VEGF decoy receptor sFlt1. Dev. Cell 21, 301–314.
STAR+METHODS KEY RESOURCES TABLE
REAGENT or RESOURCE
SOURCE
IDENTIFIER
Mouse anti-YAP
Santa Cruz Biotechnology, Inc
Cat#sc-101199; RRID: AB_1131430
Rabbit anti-YAP
Cell Signaling Technology
Cat#4912; RRID: AB_2218911
Rabbit anti-YAP (Figure 1D for Western blot; Figure 6E for immunoprecipitation)
Novus Biologicals
Cat#NB110-58358; RRID: AB_1850761
Antibodies
Rabbit anti-phosphorylated YAP on Ser127
Cell Signaling Technology
Cat#4911; RRID: AB_2218913
Rabbit anti-LATS1
Cell Signaling Technology
Cat#3477; RRID: AB_2133513
Rabbit anti-LATS2
Cell Signaling Technology
Cat#5888
Rabbit anti-phospho-LATS1/LATS2 on Thr1079
Cell Signaling Technology
Cat#8654; RRID: AB_10971635
Rabbit anti-VE-cadherin
Cell Signaling Technology
Cat#2500; RRID: AB_10839118
Rabbit anti-phospho-RLC on Ser19
Cell Signaling Technology
Cat#3671; RRID: AB_330249
Mouse anti-TAZ (WWTR1)
BD Bioscience
Cat#560235; RRID: AB_1645338
Rabbit anti-AMOT
Abcam
Cat#ab117776; RRID: AB_10898815
Mouse anti-beta-actin
Sigma-Aldrich
Cat#A5441; RRID: AB_476744
Rabbit anti-GFP
Sakurai et al., 2006
N/A
Blebbistatin
Sigma-Aldrich
Cat#B0560
2,3-Butanedione monoxime (BDM)
Sigma-Aldrich
Cat#B0753-25G
Nifedipine
Sigma-Aldrich
Cat#N7634-1G
Chemicals, Peptides, and Recombinant Proteins
Qtracker 655 (Qdot)
Thermo Fisher
Cat#Q21021MP
TRIzol reagent
Thermo Fisher
Cat#15596018
EGM-2
Lonza
Cat#CC-4176
ViaFect transfection reagent
Promega
Cat#E4981
Lipofectamine RNAi MAX reagent
Thermo Fisher
Cat#13778075
Alexa Fluor 633 phalloidin
Thermo Fisher
Cat#A22284
Protease inhibitor cocktail
Nacalai Tesque
Cat#25955-24
Protein A–Sepharose
Sigma-Aldrich
Cat#GE17-0780-01
4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI)
Thermo Fisher
Cat#D1306
Critical Commercial Assays mMESSAGE mMACHINE SP6 Transcription Kit
Thermo Fisher
Cat#AM1340
mMESSAGE mMACHINE T3 Transcription Kit
Thermo Fisher
Cat#AM1348
SuperScript III
Thermo Fisher
Cat#18080044
QuantiFast SYBR Green RT-PCR kit
Qiagen
Cat#204154
NucleoSpin RNA XS kit
Macherey-Nagel
Cat#740902.50
Experimental Models: Cell Lines Human pulmonary artery endothelial cells (HPAEC)
Lonza
Cat#CC-2530
Human umbilical vein endothelial cells (HUVEC)
Thermo Fisher
Cat#C0035C
This paper
N/A
Experimental Models: Organisms/Strains Zebrafish: Tg(fli1:EGFP-YAP)ncv35 ncv36
This paper
N/A
Zebrafish: Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mC)ncv12
Fukui et al., 2014
N/A
Zebrafish: Tg(fli1:Myr-mC)ncv1
Kwon et al., 2013
N/A
Zebrafish: Tg(fli1:H2B-mC)ncv31
Yokota et al., 2015
N/A
Zebrafish: Tg(myl7:NLS-tdEosFP)ncv10
Fukui et al., 2014
N/A
Zebrafish: Tg(fli1:Gal4db-TEAD2DN-2A-mC)
(Continued on next page)
Developmental Cell 40, 523–536.e1–e6, March 27, 2017 e1
Continued REAGENT or RESOURCE
SOURCE
IDENTIFIER
Zebrafish: Tg(fli1:EGFP)y1
Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002)
N/A
Zebrafish: Tg(UAS:GFP)
Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008)
N/A
Zebrafish: Tg(fli1:Gal4FF)
Zygmunt et al., 2011
N/A
Zebrafish: Tg(huC:GFP)
Kwon et al., 2013
N/A
Zebrafish: yap1ncv101
This paper
N/A
Zebrafish: wwtr1ncv114
This paper
N/A
Zebrafish: amotl2afu45
Agarwala et al., 2015
N/A
Primers for RT-PCR and qPCR analyses, see Table S1
This paper
N/A
Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG
This paper
N/A
Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC
This paper
N/A
Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC
This paper
N/A
Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC
This paper
N/A
Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG
This paper
N/A
Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC
This paper
N/A
Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA
Gene Tools
ZFIN: ZDB-MRPHLNO-041116-4
Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT
Gene Tools
ZFIN: ZDB-MRPHLNO-100415-2
Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT
Gene Tools
ZFIN: ZDB-MRPHLNO-100415-4
Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA
Gene Tools
ZFIN: ZDB-MRPHLNO-060317-4
siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi)
This paper; Thermo Fisher
N/A
Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA)
Thermo Fisher
Cat#12935300
Oligonucleotides
siRNA targeting WWTR1 (Silencer Select siRNA)
Thermo Fisher
Cat#4392420
Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA)
Thermo Fisher
Cat#4390843
siRNA targeting LATS1 (MISSION siRNA)
Sigma-Aldrich
Cat#SIHK1041
siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA)
This paper; Sigma-Aldrich
N/A
Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control)
Sigma-Aldrich
Cat#SIC001
siRNA targeting AMOT (SMARTpool)
Dharmacon
Cat#E-015417
siRNA targeting AMOTL1 (SMARTpool)
Dharmacon
Cat# E-017595
siRNA targeting AMOTL2 (SMARTpool)
Dharmacon
Cat#E-013232
Control siRNA for AMOTs siRNAs (Non-target control SMARTpool)
Dharmacon
Cat#D-001910
Recombinant DNA RCIscript-GoldyTALEN vector
Addgene
Cat#38142
UAS:EGFP-Yap1-5SA plasmid
Chiba et al., 2016
N/A (Continued on next page)
e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017
Continued REAGENT or RESOURCE
SOURCE
IDENTIFIER
FV10-ASW4.2 viewer
Olympus
http://www.olympus-lifescience.com/ en/downloads/
IMARIS 8.4.1
Bitplane AG
http://www.bitplane.com/imaris/imaris
DP2-BSW
Olympus
http://www.olympus-lifescience.com/ en/support/downloads/dp2-bsw_ ver0201_step/
MetaMorph 7.8.0.0
Molecular Devices
https://www.moleculardevices.com/ systems/metamorph-research-imaging
GraphPad Prism 5
GraphPad
https://www.graphpad.com/scientificsoftware/prism/E
Software and Algorithms
CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents can be directed to and will be fulfilled by the Lead Contact, Naoki Mochizuki ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Zebrafish Zebrafish (Danio rerio) were maintained and bred under standard conditions. Embryos and larvae were staged by hpf or dpf at 28oC. The experiments using zebrafish were approved by the animal committee of the National Cerebral and Cardiovascular Center (No. 14005 and No. 15010) and performed according to our institutional regulation. Cell Culture HPAECs (Lonza) and HUVECs (Thermo Fisher) were cultured on 1% gelatin-coated dish in endothelial cell growth medium (EGM-2, Lonza) and used for the experiment before passage 9. The cells were maintained in 5% CO2 at 37oC. METHOD DETAILS Plasmids cDNA fragments encoding human YAP and angiomotin (AMOT) were amplified by PCR and subcloned into pEGFP-C1 vectors (Takara Bio Inc.) to generate the expression plasmids. Then, EGFP-YAP cDNA was subcloned into the pTol2-fli1 vector (Kwon et al., 2013) to generate the pTol2-fli1:EGFP-YAP plasmid. Human TEAD2 lacking amino-terminus (1-113 a.a.) fused with Gal4 DNA binding domain followed by 2A mCherry (Fukui et al., 2014) was also subcloned into the pTol2-fli1 vector to generate the pTol2-fli1:Gal4db-TEAD2DN-2A-mC. UAS:EGFP-Yap1-5SA plasmid, in which Ser21, Ser69, Ser87, Ser119, and Ser335 of zebrafish Yap1, are all replaced with Ala, was used (Chiba et al., 2016). Transgenic Zebrafish Lines To generate Tg(fli1:EGFP-YAP)ncv35 and Tg(fli1:Gal4db-TEAD2DN-2A-mC)ncv36 zebrafish lines, the corresponding Tol2-based plasmid DNA (25 pg) was microinjected along with Tol2 transposase mRNA (25 pg) into one-cell stage embryos of AB zebrafish. Tol2 transposase mRNAs were in vitro transcribed with SP6 RNA polymerase from NotI-linearised pCS-TP vector using the mMESSAGE mMACHINE kit (Thermo Fisher). The embryos were raised to adulthood and crossed with wild-type AB to identify germline transmitting founder fishes. Throughout the text, all Tg lines used in this study are simply described without their line numbers. For example, Tg(fli1:EGFP-YAP)ncv35 is abbreviated to Tg(fli1:EGFP-YAP). Image Acquisition, Processing, and Quantification Using Microscopes The zebrafish embryos were mounted in 1% low-melting agarose poured on a 35-mm-diameter glass-base dish (Asahi Techno Glass), as previously described (Kwon et al., 2013). Confocal images were taken with a FluoView FV1000 or FV1200 confocal upright microscope system (Olympus) equipped with water-immersion XLUMPlan FL N 20x/1.00 NA and LUMPlanFL N 40x/0.80 NA objective lenses (Olympus) and a multi-alkali or GaAsP photomultiplier tube regulated with FluoView ASW software (Olympus). The 405 nm, 473 nm, 559 nm, and 635 nm laser lines were used. Images were acquired sequentially to avoid cross-detection of the fluorescent signals. Two-photon images were taken with a FluoView FV1000MPE multiphoton upright microscope system (Olympus) equipped with a water immersion XLPlan N 25x/1.05 NA objective lens (Olympus) with 920 or 950 nm excitation wavelength. Image files were processed and analyzed with FV10-ASW4.2 viewer (Olympus) and IMARIS 8.4.1 software (Bitplane AG). Stereomicroscopic images Developmental Cell 40, 523–536.e1–e6, March 27, 2017 e3
were taken with a SZX16 stereomicroscope with DP2-BSW software (Olympus). Super-resolution fluorescence images were taken with a SD-OSR microscope system (Olympus) equipped with silicone-immersion UPLSAPO100XS100x/1.35 NA objective lens, a CSU-W1 scan unit (Yokogawa), and an ORCA-Flash 4.0 CMOS camera (Hamamatsu). The microscope and image acquisition were controlled by MetaMorph software (Molecular Devices). The 488 nm and 561 nm laser lines were used. After taking a confocal image in a wider field using this system, a part of the field was rescanned to acquire a super-resolution image, as shown in Figure 6C. High-speed movie images of zebrafish blood flow were taken at 590 frames per second (fps) with cell motion system SI8000 (Sony). Just before the imaging, 1 mm beads were injected into the heart of zebrafish larvae. Images were acquired with SI8000 View Software (Sony) and analyzed with SI8000R Analyzer Software (Sony). Microinjections of Morpholino Oligonucleotides (MOs) For MO-mediated knockdown, embryos were injected at one-cell or two-cell stage with control MO (Gene Tools), 1.2 ng of lats1 translation blocking MO, 1.2 ng of lats2 translation blocking MO, 2 ng of cardiac troponin T type 2a (tnnt2a) translation blocking MO. lats1 MO and lats2 MO have previously been validated (Chen et al., 2009). Knockout Fish by Transcription Activator-like Effector Nuclease (TALEN) TALENs targeting yap1 (Figure S1B) and wwtr1 (Figure S1D) were designed using TAL Effector Nucleotide Targeter 2.0 (https:// tale-nt.cac.cornell.edu/node/add/talen-old) and were assembled via the Golden Gate method (Cermak et al., 2011). TALEN repeat variable di-residues (RVDs) were cloned into an RCIscript-GoldyTALEN vector (Addgene). yap1 and wwtr1 TALEN mRNAs were in vitro transcribed from SacI-linearized expression plasmids with T3 RNA polymerase using a mMessage mMachine mRNA kit (Thermo Fisher). Embryos, injected with 30-60 pg of the TALEN mRNAs at one-cell stage, were raised to adulthood and crossed with wild-type AB to identify germline-mutated founders. Screening for founders was conducted by genomic PCR and subsequent sequencing using the following primer sets: 5’- TCCTTCGCAAGGCTTGGATAATTG -3’ and 5’- TTGTCTGGAGTGGGACTTTGGCTC -3’ for yap1; 5’- GGACGAAAAACAGGAAAAGTTC -3’ and 5’- ACTGCGGCATATCCTTGTTC -3’ for wwtr1. By sequencing the PCR products, we identified the yap1ncv101 allele harboring a 25 nucleotide (nt) deletion in the first exon (Figure S1B), and the wwtr1ncv114 allele harboring an 8 nt deletion in the first exon (Figure S1D). For the genotyping of the mutants, PCR analyses of genomic DNAs were routinely performed using the same primer set (see Figure S1C for yap1ncv101 mutants). Phenotypic Analyses of yap1ncv101, wwtr1ncv114, and amotl2afu45 Mutants To analyze the phenotype of yap1ncv101 and wwtr1ncv114 mutants, fixed or living zebrafish were observed. In Figures 7A, S7B, and S7C, embryos or larvae derived from heterozygous yap1ncv101 carriers were fixed with PBS containing 4% paraformaldehyde (PFA) over-night at 4 oC; their tails were removed with dissecting scissors and used for genomic DNA isolation and genotype analysis. Genotypically identified WT and homozygous yap1ncv101 mutants were then observed using confocal microscopy. In the other figures, genotype analyses were performed after observing living embryos or larvae. For the analyses of amotl2afu45 mutant zebrafish (Agarwala et al., 2015), embryos from incrosses of heterozygous amotl2afu45 mutants were observed using confocal microscopy and genotyped by genomic PCR and subsequent sequencing of the PCR products using the following primer set: 5’- CAAGCACCTCGTCACAATG -3’ and 5’- CACTGTAGCTGTCCACTTCTC -3’. FACS Tg(fli1:EGFP) and Tg(huC:GFP) embryos at 2 dpf were digested by incubating with 5 mg/ml trypsin in PBS as previously described (Kwon et al., 2013). The dissociated cells were sorted by a FACS Aria III Cell Sorter (BD Bioscience) according to GFP fluorescence. The GFP-positive cells sorted by FACS were subjected to qPCR analyses. RT-PCR and Quantitative Real-Time PCR (qPCR) Analyses Total RNAs from zebrafish whole embryos, EGFP-positive ECs isolated from the Tg(fli1:EGFP) embryos, and GFP-positive pan neurons isolated from Tg(huC:GFP) embryos were purified using NucleoSpin RNA XS kit (Macherey-Nagel) following the manufacturer’s instruction. Total RNAs from HPAECs were purified using TRIzol reagent (Thermo Fisher) following the manufacturer’s instruction. For RT-PCR analyses, total RNA from HPAECs was reverse-transcribed by random hexamer primers using Superscript III (Thermo Fisher) according to the manufacturer’s instruction. PCR was performed using the gene-specific primers as listed in Table S1. For qPCR analyses, reverse transcription and PCR were performed with QuantiFast SYBR Green RT-PCR kit (Qiagen) in Mastercycler Realplex (Eppendorf) using the gene-specific primers as listed in Table S1. The qPCR results were normalized to ef1a expression in zebrafish samples and to HPRT1 expression in HPAECs. Transfection, Shear Stress, and siRNA-Mediated Protein Knockdown HPAECs were transfected with plasmid DNA using ViaFect transfection reagent (Promega). After 6-12 h of transfection, the cells were replated to a 1% gelatin-coated glass plate, cultured for additional 24-48 h, and used for the shear stress experiments.
e4 Developmental Cell 40, 523–536.e1–e6, March 27, 2017
We performed shear stress experiments in high cell density (1000-1500 cells/mm2). We simultaneously split the same number of HPAECs to keep the equal cell density between static and sheared conditions in every experiment. Even at high cell density, HPAECs did not always become homogeneously confluent. Therefore, we observed cells at the region where cell density was relatively higher than the periphery, in order to minimize variations in cell density. A parallel plate-type apparatus was used to apply laminar shear stress to HPAECs (Yamamoto et al., 2007). Briefly, one side of the flow chamber consisted of a 1% gelatin-coated glass plate, on which the cultured HPAECs rested, and the other side consisted of a polycarbonate plate. Their flat surfaces were held 200 mm apart with a Teflon gasket. The chamber was provided with an entrance and an exit for the fluid, and the entrance was connected to an upper reservoir with a silicone tube. The exit was open to a lower reservoir. The flow was driven by a roller/tube pump. The fluid (endothelial cell growth medium) passed from the upper reservoir through the flow chamber into the lower reservoir. Experiments were performed at 37oC with 5% CO2 in an incubator. The intensity of the shear stress (t, dynes/cm2) acting on the EC layer was calculated by using the formula t = 6mQ/a2b, where m is the viscosity of the perfusate (poise), Q is the flow volume (ml/s), and a and b are the cross-sectional dimensions of the flow path (cm). siRNAs targeting the genes indicated were purchased as follows: WWTR1 (TAZ) (Silencer Select siRNA, 4392420), negative control siRNA (Silencer Select siRNA, 4392420), YAP (Stealth RNAi, 5’- CCAUGACUCAGGAUGGAGAAAUUUA -3’), and negative control siRNA (Stealth RNAi, 12935300) from Thermo Fisher; LATS1 (MISSION siRNA, SIHK1041) (Feng et al., 2014), LATS2 (MISSION siRNA, 5’- CUACUCGCCAUACGCCUUUdTdT -3’), and negative control siRNA (MISSION siRNA, SIC001) from SigmaAldrich; AMOT (SMARTpool, E-015417) (Feng et al., 2014; Mana-Capelli et al., 2014), AMOTL1 (SMARTpool, E-017595) (Feng et al., 2014; Mana-Capelli et al., 2014), AMOTL2 (SMARTpool, E-013232)(Feng et al., 2014; Mana-Capelli et al., 2014), and negative control siRNA (SMARTpool, D-001910) from Dharmacon. HPAECs were transfected using Lipofectamine RNAi MAX reagent (Thermo Fisher) according to manufacturer’s instructions, using 15 nM of YAP siRNA, 12.5 nM of TAZ siRNA, 20 nM of LATS1 siRNA, 10 nM of LATS2 siRNA, 20 nM of AMOT siRNA, 4 nM of AMOTL1 siRNA, and 20 nM of AMOTL2 siRNA. For shear stress experiments, the cells were replated to a 1% gelatin-coated glass plate after 6-12 h of transfection, cultured for additional 48-72 h, and used for the experiments. Immunofluorescence HPAECs cultured on gelatin-coated 35-mm glass-base dish (Asahi Techno Glass) and glass plate were fixed with 1 or 4% PFA in PBS for 10 min at RT. The fixed cells were then permeabilized with 0.2% Triton X-100 in PBS for 10 min and blocked with 3% BSA in PBS for 30 min at RT. Thereafter, the cells were incubated with the indicated antibodies in 3% BSA in PBS for 1.5 h at 37oC. Protein reacting with antibody was visualized with species-matched Alexa Fluor 488- or Alexa Fluor 546-labeled secondary antibodies (1:200, Thermo Fisher). To visualize F-actin and cell nuclei, the cells were stained with Alexa Fluor 633 phalloidin (1:300) and DAPI (1:500), respectively. Fluorescence images were taken with a confocal microscope (FluoView FV1000, Olympus) equipped with water-immersion XLUMPlan FL N 20x/1.00 NA and LUMPlanFL N 40x/0.80 NA objective lenses (Olympus). Immunoprecipitation and Western Blot Analysis HPAECs were washed with ice-cold PBS, lysed at 4 oC in lysis buffer containing 1% Nonidet P-40, 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 3 mM EDTA , 2 mM dithiothreitol, 1 mM Na3VO4, and a protease inhibitor cocktail (1:100, Nacalai Tesque) and centrifuged at 20,000 x g for 15 min. For immunoprecipitation, the supernatants were incubated with mouse or rabbit anti-YAP antibody for 1 h at 4 oC, followed by incubation with protein A–Sepharose beads (Sigma-Aldrich) for 1.5 h. The precipitates were then washed three times with wash buffer containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 2 mM dithiothreitol. The immunoprecipitates and aliquots of total cellular lysates were subjected to Western blot analysis with the indicated antibodies. Chemiluminescence signals were detected using ImageQuant LAS 4000 mini (GE Healthcare) and quantified using ImageQuant TL software (GE Healthcare). After removing chorionic membrane and yolk sac, wild-type or homozygous yap1ncv101 mutant embryos were directly lysed in 1 x SDS sample buffer and subjected to Western blot analysis with a rabbit anti-YAP antibody (Novus Biologicals) recognizing zebrafish Yap1 and with an anti-b-actin antibody. QUANTIFICATION AND STATISTICAL ANALYSIS Measurements of GFP Intensity in EC-Specific TEAD Reporter To quantify relative GFP intensity of individual ISV in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) embryos, 3D-rendered confocal stack fluorescence images of GFP and mCherry in the trunk regions were acquired using confocal microscopy in the same acquisition condition. Individual GFP-expressing ISV was manually cropped using IMARIS 8.4.1 software. Among the cropped area, GFP-positive voxels where GFP fluorescence intensity was above an appropriate threshold were selected as region of interest (ROI). Then, mean fluorescence intensity of GFP and mCherry within the ROI was calculated. Relative GFP intensity was determined in individual ISV by dividing the mean GFP fluorescence intensity by the mean mCherry fluorescence intensity.
Developmental Cell 40, 523–536.e1–e6, March 27, 2017 e5
Measurements of Nuclear/Cytoplasmic Ratio of YAP Quantification of nuclear/cytoplasmic ratio of YAP in individual EC was performed with MetaMorph software (Molecular Devices) by analyzing single confocal slices taken within the central region of the cells stained with anti-YAP antibody (Alexa Fluor 488) and DAPI. We defined a region of interest (ROI) kept at constant size (7-10 mm in diameter) both in the nucleus and in the cytoplasm and measured the mean fluorescence intensity of YAP staining within the ROI. We then calculated the intensity ratio after subtracting the background from both the nuclear and cytoplasmic intensities. Fluorescence intensities of F-actin and VE-cadherin were measured on the fluorescence images of the cells stained with Alexa Fluor 633 phalloidin (F-actin) and anti-VE-cadherin antibody (Alexa Fluor 546) using the line scan function in MetaMorph software (Molecular Devices). Statistical Analysis Data were analyzed using GraphPad Prism software or Excel and were presented as mean ± s.d. Sample numbers and experimental repeats were indicated in figure legends. Statistical significance for paired samples was determined using Student’s t test. Data were considered statistically significant if P < 0.05.
e6 Developmental Cell 40, 523–536.e1–e6, March 27, 2017
Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance Graphical Abstract
Authors Hiroyuki Nakajima, Kimiko Yamamoto, Sobhika Agarwala, ..., Markus Affolter, Virginie Lecaudey, Naoki Mochizuki
Correspondence [email protected]
In Brief Nakajima et al. monitor the spatiotemporal localization and transcriptional activity of Yap1 in ECs of living zebrafish and reveal that blood flow regulates localization of Yap1 through mechanotransduction signaling.
Highlights d
Transcriptional activity and localization of Yap1 is monitored in zebrafish ECs
d
Blood flow regulates localization of endothelial Yap1 in vivo
d
Shear stress enhances nuclear import of YAP through regulation of F-actin and AMOT
d
Yap1 contributes to vessel maintenance in zebrafish
Nakajima et al., 2017, Developmental Cell 40, 523–536 March 27, 2017 ª 2017 Elsevier Inc. http://dx.doi.org/10.1016/j.devcel.2017.02.019
Developmental Cell
Article Flow-Dependent Endothelial YAP Regulation Contributes to Vessel Maintenance Hiroyuki Nakajima,1 Kimiko Yamamoto,2 Sobhika Agarwala,3 Kenta Terai,4 Hajime Fukui,1 Shigetomo Fukuhara,5 Koji Ando,1 Takahiro Miyazaki,1 Yasuhiro Yokota,1 Etienne Schmelzer,6 Heinz-Georg Belting,6 Markus Affolter,6 Virginie Lecaudey,7 and Naoki Mochizuki1,8,9,* 1Department of Cell Biology, National Cerebral and Cardiovascular Center Research Institute, 5-7-1 Fujishirodai, Suita, Osaka 565-8565, Japan 2Laboratory of System Physiology, Department of Biomedical Engineering, Graduate School of Medicine, University of Tokyo, Tokyo 113-0033, Japan 3Developmental Biology, SFB850, Institute for Biology I, Albert Ludwigs University of Freiburg, 79104 Freiburg, Germany 4Department of Pathology and Biology of Diseases, Graduate School of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606-8315, Japan 5Department of Molecular Pathophysiology, Nippon Medical School, Kawasaki, Kanagawa 211-8533, Japan 6Biozentrum der Universita €t Basel, Klingelbergstrasse 50/70, 4056 Basel, Switzerland 7Department of Developmental Biology of Vertebrates, Institute for Cell Biology and Neurosciences, Goethe University of Frankfurt, 60438 Frankfurt, Germany 8AMED-CREST, National Cerebral and Cardiovascular Center, 5-7-1, Suita, Osaka 565-8565, Japan 9Lead Contact *Correspondence: [email protected] http://dx.doi.org/10.1016/j.devcel.2017.02.019
SUMMARY
Endothelial cells (ECs) line the inside of blood vessels and respond to mechanical cues generated by blood flow. Mechanical stimuli regulate the localization of YAP by reorganizing the actin cytoskeleton. Here we demonstrate blood-flow-mediated regulation of endothelial YAP in vivo. We indirectly monitored transcriptional activity of Yap1 (zebrafish YAP) and its spatiotemporal localization in living zebrafish and found that Yap1 entered the nucleus and promoted transcription in response to blood flow. In cultured human ECs, laminar shear stress induced nuclear import of YAP and its transcriptional activity in a manner independent of Hippo signaling. We uncovered a molecular mechanism by which flow induced the nuclear translocation of YAP through the regulation of filamentous actin and angiomotin. Yap1 mutant zebrafish showed a defect in vascular stability, indicating an essential role for Yap1 in blood vessels. Our data imply that endothelial Yap1 functions in response to flow to maintain blood vessels.
INTRODUCTION Blood vessel networks mainly form by angiogenesis during vertebrate embryogenesis. Angiogenesis involves the sprouting of new vessels from the pre-existing vessels and the eventual fusion of new sprouts to form a vascular loop that circulates blood, nutrients, and waste products (Eilken and Adams, 2010; Geudens and Gerhardt, 2011; Herbert and Stainier, 2011). Blood vessels are lumenized by changing endothelial cell (EC) shape
and rearranging cell-cell junctions (Betz et al., 2016). These lumenized blood vessels are either maintained or remodeled during tissue or organ growth. Vascular remodeling, which includes alterations of the distribution and diameter, allows vessels to meet the demand of tissues so that they receive adequate perfusion with maximal efficiency (Freund et al., 2012; Hahn and Schwartz, 2009). During maintenance and remodeling, ECs lining the inner surface of blood vessels directly sense the blood flow as mechanical stimuli and exhibit a variety of responses (Chen et al., 2012; Franco et al., 2015; Lucitti et al., 2007). The EC responses to flow are essential to maintain vessel homeostasis by regulating vascular tone, blood pressure, and vascular permeability (Ando and Yamamoto, 2013; Chiu and Chien, 2011; Hahn and Schwartz, 2009). The flow-mediated mechanical stimuli are indispensable for the maintenance of lumenized blood vessels (Chen et al., 2012; Meeson et al., 1996; Wang et al., 2010). ECs sense two types of mechanical stimuli from the blood flow: one is shear stress, the frictional force tangential to ECs; the other is mechanical strain, the force perpendicular to the direction of flow, related to rhythmic heart beating (Hahn and Schwartz, 2009). Extensive studies using cultured ECs provide much information about shear stress-induced multiple mechanotransduction signals but less information about straininduced mechanotransduction (Ando and Yamamoto, 2013; Hahn and Schwartz, 2009). Shear stress causes changes in EC morphology and promotes gene expression through the activation of a variety of transcription factors (Chiu and Chien, 2011). However, how flow-mediated signals are regulated in living animals remains elusive. YAP, a final effector molecule downstream of Hippo signaling (Yu and Guan, 2013), has been identified as a mechanotransducer of various external or internal mechanical forces involving the actin cytoskeleton (Piccolo et al., 2014). YAP is a transcription cofactor that shuttles between the cytoplasm and the
Developmental Cell 40, 523–536, March 27, 2017 ª 2017 Elsevier Inc. 523
A Tg(eef1a1l1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP) B Tg(eef1a1l1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP); Ubiquitous TEAD reporter
eef1a1l1 Gal4db TeadΔN 2A UAS
GFP
mC
(fli1:Myr-mC) (Hindbrain) GFP
pA
pA
Nuclear Yap1 (-)
52-56 hpf
Myr-mC
GFP/Myr-mC
CCtA
Nuclear Yap1 (+)
Yap1 Nucleus TeadΔN
GFP(+)
Gal4db
GFP
UAS
Yap1
TeadΔN
GFP(-)
Gal4db
GFP
UAS
GFP
Myr-mC GFP/Myr-mC PCS
MMCtA
(Trunk) GFP
Myr-mC
DA
ISV
DLAV
PCV
GFP/ Myr-mC GFP
(Eye)
Myr-mC OV
(Pharyngeal arch)
GFP
AA1
1
442
zYap1 (WT) TBD N
Yap1
WW
AD C
Taget for TALEN
1 ncv101
WW
23
(25 nt deletion) Stop
D
WT yap1 Yap1
β-actin
ncv101
75 (kDa)
* ~65 kDa
GFP/Myr-mC
C
GFP/Myr-mC E Tg(eef1a1l1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP); (fli1:Myr-mC) 55 hpf (Hindbrain) wwtr1ncv114 WT yap1ncv101
CCtA
37
Figure 1. Monitoring Transcriptional Activity of Yap1 Indirectly in Endothelial Cells of Living Zebrafish (A) (Upper) The constructs used to monitor Yap1 responses ubiquitously by eef1a1l1 promoter (ubiquitous TEAD reporter). (Lower) Schematic illustration explains how the system works. In this Tg system, a fusion protein containing Gal4db-TEAD2DN, 2A peptide, and mCherry (mC) was ubiquitously expressed under the control of eef1a1l1 promoter. Gal4db-TEAD2DN is a Gal4 driver, in which a truncated form of human TEAD2 lacking the DNA-binding domain (TEAD2DN) is fused to the DNA-binding domain of Gal4 (Gal4db), whereas UAS-GFP is a responder transgene, in which GFP gene was placed downstream of UAS, the Gal4 recognition sequence. Upon nuclear translocation of Yap1, it binds to Gal4db-TEAD2DN in the nucleus, thereby inducing GFP expression via the Gal4-UAS system. This reporter reflects the interaction between endogenous Yap1 (or Wwtr1) and exogenously expressed Gal4db-TEAD2DN in the nucleus. pA, polyadenylation signal; UAS, upstream activation sequence. (B) Projection view of confocal stack fluorescence images of Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) embryos (52–56 hr post fertilization [hpf]). Images of hindbrain. Dorsal view, anterior to the top. Images of trunk, eye, and pharyngeal arch. Lateral view, anterior to the left. GFP images (green), mC images (red), and the merged images are shown. Arrows indicate GFP signal-positive ECs of lumenized blood vessels. Arrowheads indicate a vessel sprout showing GFP signals. (C) Schematic illustration of wild-type (WT) Yap1 and truncated Yap1ncv101 resulting from 25 nucleotides deletion in the exon1 of yap1ncv101 allele. TBD, TEADbinding domain; WW, WW domain; AD, transcriptional activation domain. (legend continued on next page)
524 Developmental Cell 40, 523–536, March 27, 2017
nucleus where it associates with TEA domain (TEAD) family members. The mechanical forces, which are generated by extracellular matrix rigidity (Calvo et al., 2013; Dupont et al., 2011), cell strain (Aragona et al., 2013; Benham-Pyle et al., 2015; Codelia et al., 2014; Cui et al., 2015), and cell shape (Dupont et al., 2011; Wada et al., 2011), control nuclear translocation of YAP through the modulation of filamentous actin (F-actin) structures, although the molecular mechanisms have not been fully elucidated in vivo. In contrast, canonical Hippo signaling negatively regulates YAP by inducing nuclear export of YAP. In the Hippo signaling cascade, MST1/2 kinases phosphorylate and activate LATS1/2 kinases, which in turn directly phosphorylate YAP, thereby exporting YAP from the nucleus (Avruch et al., 2012; Yu and Guan, 2013). It is not fully determined whether classical Hippo signaling and mechanotransduction signaling cooperatively or independently regulate the localization of YAP (Calvo et al., 2013; Codelia et al., 2014; Dupont et al., 2011; Wada et al., 2011). YAP-deficient mice show defects in the formation of the vasculature of the yolk sac (Morin-Kensicki et al., 2006). In addition, vascular density is significantly decreased in mouse retinas injected with YAP small interfering RNA (siRNA) (Choi et al., 2015), indicating an essential role for YAP in angiogenesis. However, the mechanism underlying the determination of YAP localization during developmental angiogenesis is unknown. Whereas YAP and its paralog WWTR1 (TAZ) are reported to respond to disturbed flow in lymphatic ECs in vitro (Sabine et al., 2015), whether it is regulated by blood flow in vivo has not been elucidated. In this study, we examined the flow-regulated localization of YAP both in vivo using zebrafish embryo and in vitro using cultured ECs. We monitored spatiotemporal localization and transcriptional activity of Yap1, a zebrafish ortholog of mammalian YAP, in ECs of living zebrafish and found that Yap1 is regulated by blood flow. In cultured ECs, shear stress induced nuclear translocation of YAP in a manner independent of Hippo signaling. The flow-induced reorganization of F-actin was associated with nuclear localization of YAP that was released from angiomotin (AMOT). Moreover, we demonstrate the requirement of Yap1 in the maintenance of blood vessels. RESULTS Monitoring Transcriptional Activity of YAP Indirectly in ECs of Living Zebrafish Yap1-regulated transcription depends upon its translocation to the cell nucleus. To monitor Yap1-dependent transcription in vivo, we developed a transgenic (Tg) zebrafish line, Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mCherry (mC));(UAS:GFP), hereafter called ‘‘ubiquitous TEAD reporter Tg,’’ that could indi-
rectly monitor the transcriptional activity of Yap1 or Wwtr1 (Taz) ubiquitously (Figure 1A) (Fukui et al., 2014). In this reporter system, nuclear translocated Yap1 or Wwtr1 drives GFP expression via the Gal4/UAS system in the whole body under eef1a1l1 promoter (for details see legend of Figure 1). By crossing this ubiquitous TEAD reporter fish with Tg(fli1:Myristoylated (Myr)-mC) that labels ECs with Myr-mC, we found that GFP-positive cells were detected in mC-positive ECs at 2 days post fertilization (dpf), including cells in the optic vessels (OV) of the eyes; in the mandibular arch (AA1) of the pharyngeal arch; the cerebellar central artery (CCtA), middle mesencephalic central artery (MMCtA), and posterior communicating segment (PCS) in the hindbrain; and in the intersomitic vessels (ISVs), dorsal aorta (DA), posterior cardinal vein (PCV), and the dorsal longitudinal anastomotic vessels (DLAVs) in the trunk vasculature (Figure 1B). We confirmed that fluorescence of mC of Tg(eef1a1l1:Gal4dbTEAD2DN-2A-mC) was negligibly faint compared with that of Myr-mC of Tg(fli1:Myr-mC) (Figure S1A). GFP expression was weaker in sprouting vessels than in lumenized vessels in the brain (Figure 1B, arrowheads). Besides blood vessels, GFP-positive cells were also detected in the heart (Fukui et al., 2014) and notochord, where YAP-TEAD signals are active in mice (Ota and Sasaki, 2008). To examine whether the TEAD reporter fish reflects the transcriptional activity of Yap1 or Wwtr1, we generated their loss-offunction alleles, yap1ncv101 and wwtr1ncv114, by using transcription activator-like effector nucleases (TALENs) (Figures 1C and S1B–S1D). In homozygous yap1ncv101 mutants that lacked Yap1 protein (about 65 kDa as reported by Miesfeld et al., 2015) (Figure 1D), the GFP signals were hardly detected in ECs (Figure 1E). In contrast, the GFP signals in ECs were not significantly affected in homozygous wwtr1ncv114 mutants (Figure 1E). These results suggest that the reporter signals mainly reflect the transcriptional activation of Yap1, but not Wwtr1, in ECs. We confirmed that these effects in yap1ncv101 mutants were not due to the secondary effects by changing heart function and blood flow. Although yap1 morpholino (MO)-injected embryos exhibit cardia bifida (Fukui et al., 2014), homozygous yap1ncv101 mutants did not show any cardia bifida (0/61) and had normal blood flow (Figures S1E and S1F; Movies S1 and S2). To test whether this reporter system responds to an increase in nuclear Yap1 or Wwtr1, we examined the effects of knockdown of lats1 and lats2 using MO oligonucleotides on GFP expression (Chen et al., 2009). In lats1 and lats2 double morphants, GFP signals of the ubiquitous TEAD reporter were markedly enhanced in both ECs and non-ECs (Figures S1G and S1H), suggesting that this TEAD reporter system faithfully responds to an increase in nuclear Yap1 or Wwtr1. Collectively, our TEAD reporter system points to transcriptionally active Yap1 in ECs in vivo.
(D) Lysates from WT and homozygous yap1ncv101 mutant embryos were subjected to western blot analyses with anti-Yap1 and anti-b-actin antibodies. Arrow indicates Yap1. Asterisk indicates non-specific band. (E) Projection view of confocal stack fluorescence images of the hindbrain in Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT (left), homozygous yap1ncv101 mutant (middle), and wwtr1ncv114 mutant (right) embryos at 55 hpf. Upper panels, GFP images (green); lower panels, merged images (GFP, green; Myr-mC, red). Representative images of three independent experiments are shown. CCtA, cerebellar central artery; MMCtA, middle mesencephalic central artery; PCS, posterior communicating segment; ISV, intersomitic vessel; DA, dorsal aorta; PCV, posterior cardinal vein; DLAV, dorsal longitudinal anastomotic vessel; OV, optic vessel; AA1, mandibular arch. Scale bars, 10 mm. See also Figure S1; Movies S1 and S2.
Developmental Cell 40, 523–536, March 27, 2017 525
Activation of Yap1-Dependent Transcription Occurs in Perfused Vessels The results obtained from ubiquitous TEAD reporter Tg suggested the role for Yap1 in ECs and prompted us to examine the expression of Yap1 in zebrafish ECs. qPCR analyses revealed that yap1 mRNA was expressed in ECs isolated from embryos of a transgenic Tg(fli1:EGFP) line, in which EGFP expression was driven by the endothelial specific promoter fli1 (Figure S2A). To more specifically monitor Yap1/TEAD-dependent transcription in ECs in vivo, we developed Tg(fli1:Gal4db-TEAD2DN2A-mC);(UAS:GFP) fish, hereafter called ‘‘EC-specific TEAD reporter Tg,’’ in which Yap1- or Wwtr1-dependent transcription of GFP was monitored exclusively in the ECs under the fli1 promoter (Figure 2A) (Uemura et al., 2016). Similar to ubiquitous TEAD reporter (Figure 1), GFP-positive cells were found in various types of blood vessels at 2 dpf, including the ISVs, DA, PCV, and DLAVs in the trunk vasculature; the CCtA, MMCtA, and PCS in the hindbrain; the LDA and OV in the head; and the AA1 of the pharyngeal arch (Figures 2B and S2B). GFP signals were hardly detected in the homozygous yap1ncv101 mutants (Figure 2B), indicating that this reporter also reflects Yap1-dependent transcription in ECs. Because two TEAD reporters behave similarly in ECs, we mainly used EC-specific TEAD reporter in the following experiments to clarify the regulation of Yap1 exclusively in ECs. Before or during the formation of the DA and PCV (24 hr post fertilization [hpf]), we rarely detected GFP-positive cells in the trunk vasculature. GFP signals were detected in the DA and PCV, but not in the ISVs and DLAVs, at 32 hpf (Figure 2C, 32 hpf). The DA and PCV but not the ISVs and DLAVs were lumenized and perfused at 32 hpf when we visualized vessel perfusion by injecting Qdot into the heart (Figure 2C, 32 hpf). In contrast, after the ISVs and DLAVs were lumenized and perfused, GFP signals started to be detected (Figure 2C: Trunk, 50 hpf). In the hindbrain, GFP signals were not detected in the developing non-perfused CCtA (Figure S2C: 42 hpf, red arrows), but detected in perfused CCtA (Figure S2C: 52 hpf, white arrows). These results suggest that Yap1-dependent transcription starts especially in perfused blood vessels. Nuclear Localization of Yap1 in ECs Is Related to Lumenization of Blood Vessels To monitor localization of Yap1 directly, we developed the third Tg fish, Tg(fli1:EGFP-YAP), which expressed EGFPtagged human YAP specifically in ECs. EGFP-YAP behaves similarly to endogenous YAP (Bao et al., 2011). Using the fixed Tg embryos, we first studied whether EGFP-YAP is in the cytoplasm or in the nuclei by staining nuclei with DAPI. EGFP-YAP was in the cytoplasm in ECs of the DA and ISVs before the lumen had formed (Figures 2D and 2E; 25–28 hpf). In contrast, EGFP-YAP was in the nuclei of the DA and ISVs after a continuous lumen was established (Figures 2D and 2E; 35–36 hpf in the DA, 50–52 hpf in the ISVs). To examine when EGFP-YAP enters the nucleus, we time-lapse imaged the embryos during lumen formation of ISVs using a two-photon microscope. EGFP-YAP was mostly in the cytoplasm before or just after lumen formation and then translocated into the nucleus of ECs of lumenized ISVs (Figure 2F, see the left and right among the three ISVs). EGFP-YAP often 526 Developmental Cell 40, 523–536, March 27, 2017
shuttled between the nucleus and the cytoplasm even after lumen formation (Figure S2D). These results suggest that lumenization triggers the nuclear translocation of EGFP-YAP in living animals. Flow Induces Nuclear Translocation of YAP Blood flow is necessary to form a continuous lumen (Herwig et al., 2011; Montero-Balaguer et al., 2009). To examine the effect of blood flow on the localization of Yap1, we visualized blood flow by Qdot in the Tg(fli1:EGFP-YAP) (Figure 3A). We simultaneously marked EC nuclei in living zebrafish, by crossing the Tg(fli1:EGFP-YAP) line with a Tg line, Tg(fli1:H2B-mC), in which EC nuclei were labeled by histone H2B-mC. The circulation started in the DA around 29 hpf under our experimental conditions. Before circulation, EGFP-YAP was excluded from the nuclei even in the lumenized DA (Figure 3A). After the circulation started, EGFP-YAP translocated into the nuclei in some ECs of the DA (Figures 3A and 3B), indicating that blood flow rather than lumen formation per se induces the translocation of EGFP-YAP into the nuclei. We then investigated whether YAP can respond to mechanical stimuli generated by blood flow using cultured human pulmonary artery ECs (HPAECs). We found that YAP was significantly accumulated in the nucleus of the EC after 10 min of laminar shear stress (Figures 3C and 3D). The mRNA expression of YAP/TAZ target genes, CTGF and CYR61, were enhanced by shear stress in a manner dependent on YAP but not Wwtr1 (Figures 3E, 3F, and S3A), suggesting that nuclear translocated YAP in sheared ECs functioned as a coactivator. Laminar shear stress also induced YAP nuclear translocation in human umbilical vein ECs (Figures S3B and S3C). Thus, YAP serves as a mechanotransducer that responds to flow in vascular ECs. YAP accumulated in the nuclei in response to shear stress within 10 min. However, YAP was excluded from the nuclei after 6 hr or 24 hr of shear stress (Figures S3D and S3E). Consistently, CTGF mRNA expression increased within 1 hr and decreased below the basal level after 6 hr of shear stress (Figure S3F). Thus, YAP at least responds to laminar shear stress transiently. Blood Flow Is Important for Nuclear Localization of Yap1 To examine whether blood flow is required for nuclear localization of Yap1 in vivo, we stopped blood flow by using nifedipine and 2,3-butanedione monoxime (BDM), both of which can stop the heart beating in zebrafish (Serluca et al., 2002; Bussmann et al., 2011). Nifedipine is a Ca2+ channel blocker that inhibits cardiomyocyte contractility (Langheinrich et al., 2003), whereas BDM is a small-molecule myosin ATPase inhibitor that targets muscle myosin II (Cheung et al., 2002). After cessation of blood flow by either nifedipine or BDM treatment, EGFP-YAP was rapidly exported from the nuclei to the cytoplasm of ECs in the ISVs, DA, and DLAVs (Figures 4A–4D and S4A–S4D). Once flow resumed after the washout of BDM, EGFP-YAP re-entered the nucleus of these vessels (Figures 4C, 4D, S4B, and S4D). These results indicate that blood flow is important for nuclear localization of EGFP-YAP. In the EC-specific TEAD reporter fish, Yap1-dependent GFP expression was significantly reduced after cessation of blood flow by both nifedipine (Figures 4E and 4F) and BDM (Figures S4E and S4F), confirming that the localization of endogenous
A
D Tg(fli1:EGFP-YAP) EGFP-YAP/DAPI
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP) EC-specific TEAD reporter
fli1 UAS
Gal4db TeadΔN 2A GFP
mC
27 hpf
50 hpf
pA
pA ISV
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP); (fli1:Myr-mC)
B
50 hpf
yap1ncv101
WT
28 hpf
36 hpf
GFP
DA
GFP/ Myr-mC
ISV DA PCV
C
(%) (219) (92) (57) (33) 100
Localization of EGFP-YAP
E DLAV
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP);(fli1:Myr-mC) GFP
Qdot/GFP/Myr-mC
F
80 60 40
N
20 0
f f f f hp hp hp hp 2 6 8 8 5 3 2 2 50 25 35 25 DA (a)ISV
Tg(fli1:EGFP-YAP) 37 hpf0
32 hpf
20
40
50 hpf
*
*
60 (min)
Figure 2. Yap1/TEAD-Dependent Transcription Becomes Active in Perfused Vessels (A) The constructs used to monitor Yap1 responses in EC by using fli1 promoter (EC-specific TEAD reporter). (B) Projection view of confocal stack fluorescence images of the trunk region in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT (left) and homozygous yap1ncv101 mutant embryos (right) at 50 hpf. Lateral views, anterior to the left. Upper panels, GFP images (green); lower panels, merged images (GFP, green; Myr-mC, red). White arrows indicate GFP signal-positive ECs of lumenized blood vessels. Representative images of four independent experiments are shown. (C) Projection view of confocal images of the trunk region in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) embryos (at 32 and 50 hpf as indicated at the left) injected with Qdot 655 (white) into the heart to visualize perfused vessels. Left, GFP images (green); right, merged images (Qdot 655, white; GFP, green; Myr-mC, red). While a significant population of ECs of perfused vessels expresses GFP (white arrows), ECs of non-perfused vessels do not (magenta arrows). (D) Projection view of confocal images of the trunk region of fixed Tg(fli1:EGFP-YAP) embryos (at 27–50 hpf as indicated at the top) immunostained with anti-GFP antibody (green) together with DAPI (blue). White and orange arrowheads indicate EGFP-YAP in the cytoplasm and nucleus, respectively. (E) Graph shows percentage of the number of the ECs in which EGFP-YAP is excluded from the nucleus (N < C, white bars) and those in which EGFP-YAP is localized in the nucleus (N > C or N = C, black bars) at the indicated stages of the dorsal aorta (DA) and the arterial intersomitic vessels (aISVs) among the total number of observed ECs (indicated at the top) from 7 to 10 embryos. (F) Time-sequential two-photon images of ISVs in Tg(fli1:EGFP-YAP) embryos that were about to form lumen (from 37 hpf). Elapsed time (min) is indicated at the left. Yellow asterisks indicate newly formed lumens connecting to the circulation. White and orange arrowheads indicate EGFP-YAP in the cytoplasm and nucleus, respectively. Representative images of seven independent experiments are shown. Scale bars, 10 mm. See also Figure S2.
Developmental Cell 40, 523–536, March 27, 2017 527
Tg(fli1:EGFP-YAP);(fli1:H2B-mC) 29 hpf0 min
A
30 min
Figure 3. Flow Induces Nuclear Translocation of YAP
60 min
(A) Time-lapse confocal imaging of the onset of the circulation in the DA of Tg(fli1:EGFP-YAP); * (fli1:H2B-mC) embryos (from 29 hpf). To visualize EGFP-YAP/ the circulation, we injected Qdot 655 (white) into H2B-mC the heart just before imaging. Yellow asterisks indicate lumen in the DA. Elapsed time (min) Qdot is indicated at the top. White and orange arrowheads indicate EGFP-YAP (green) in the Static Shear C B cytoplasm and nucleus, respectively. H2B, hisYAP D ** tone H2B. (%) *** 60 (B) Percentage of ECs in the DA in which 1.6 50 EGFP-YAP translocated from ‘‘cytoplasm to 1.4 40 nuclei’’ or from ‘‘nuclei to cytoplasm’’ just after 1.2 30 the circulation. Localization change was exam1 ined between 20 and 30 min before the onset 20 0.8 0.6 YAP/DAPI of the circulation and 20–30 min after the 10 0.4 onset of the circulation visualized by Qdot 655 0 0.2 as in (A). Data obtained from at least ten cells 0 Static Shear of single DA of three embryos are expressed as (HPAEC) mean ± SD. (C) Human pulmonary artery endothelial cells (Zebrafish DA) HPAEC (HPAECs) cultured at high density (1,000–1,500 E F cells/mm2) under static conditions or after laminar *** * 2 3.5 shear stress at 15 dynes/cm2 for 10 min were ** 3 fixed and immunostained with anti-YAP antibody 1.5 NS 2.5 together with DAPI. YAP images and the merged ** NS 2 images (YAP, green; DAPI, blue) are shown. 1 1.5 NS NS (D) Quantification of nuclear relative to cyto1 0.5 plasmic fluorescent intensity of YAP in static or 0.5 sheared HPAECs examined in (C). Data are 0 0 mean ± SD (n = 3 independent experiments, in tic ear atic ear atic ear atic ear tic ear atic ear atic ear atic ear a a St Sh St Sh St Sh St Sh St Sh St Sh St Sh St Sh each of which >150 cells were measured). (E and F) HPAECs transfected with control siRNA, Control YAP WWTR1 YAP+WWTR1 Control YAP WWTR1 YAP+WWTR1 siRNA siRNA siRNA siRNA siRNA siRNA siRNA siRNA YAP siRNA, WWTR1 siRNA, or YAP + WWTR1 (HPAEC) (HPAEC) siRNAs were kept under static conditions or subjected to shear stress at 15 dynes/cm2 for 30 min. Relative expression levels of CTGF mRNA (E) and CYR61 mRNA (F) were analyzed by qPCR analyses. Data are normalized to the values in static control siRNAtransfected ECs. Data are mean ± SD (n R 3 independent experiments). *p < 0.05, **p < 0.01, ***p < 0.001; NS, not significant. Scale bars, 10 mm. See also Figure S3. EGFP-YAP
YAP Nucleus/Cytoplasm
CYR61 mRNA
CTGF mRNA
Localization change of EGFP-YAP after the oneset of blood flow C to yto N pla uc s l m N eus u C c yt le op us la to sm
DA
Yap1 is also changed in response to blood flow. Consistently in the ubiquitous TEAD reporter, GFP signals in the ISVs increased after circulation started (Figure S4G) and decreased after the cessation of blood flow (Figure S4H), suggesting that two TEAD reporters behave similarly in ECs in response to blood flow. Flow Induces Nuclear Translocation of YAP in a Manner Independent of Hippo Signaling We next examined the molecular mechanism by which flow induces the nuclear translocation of YAP using HPAECs. First, we explored whether Hippo signaling is involved in the shear stress-induced YAP translocation. We found that phosphorylation of YAP on Ser127, a key target of LATS1/2, was not affected by shear stress (Figure S5A). In addition, LATS1/2 phosphorylation by MST1/2 kinases was unchanged after shear stress (Figures S5B and S5C). We then examined the effects of depletion of LATS1/2 on the shear stress-mediated YAP regulation. In static ECs, knockdown of LATS1/2 resulted in nuclear localization of YAP and CTGF mRNA expression, suggesting that the Hippo pathway effectively inhibits YAP in static ECs (Figures S5D–S5G). Of note, shear stress induced nuclear translocation 528 Developmental Cell 40, 523–536, March 27, 2017
of YAP and subsequent CTGF mRNA expression even in the absence of LATS1/2 (Figures S5D–S5G). These results indicate that Hippo signaling is not involved in flow-induced nuclear translocation of YAP. Shear Stress-Induced Nuclear Translocation of YAP Is Associated with F-Actin Reorganization YAP localization is regulated by the actin cytoskeleton independently of Hippo signaling (Aragona et al., 2013; Calvo et al., 2013; Dupont et al., 2011; Feng et al., 2014). Therefore, we examined the F-actin-mediated YAP regulation upon shear stress. Remarkably, shear stress led to an enhancement of cortical actin bundles along cell-cell boundaries where vascular endothelial cadherin (VE-cadherin) accumulated, rather than in the central region of the cells (Figures 5A and 5B). Furthermore, we detected the accumulation of monophosphorylated myosin regulatory light chain (pRLC) on the cortical actin bundles in ECs exposed to shear stress (Figure 5C). Blebbistatin, an inhibitor of non-muscle myosin II (NM-II) ATPase, blocked shear stress-induced YAP translocation (Figures S5H and S5I). These results suggest that the actomyosin cytoskeleton is involved in nuclear translocation of YAP in the cells, in which cortical actin
B Localization of EGFP-YAP
A Tg(fli1:EGFP-YAP);(fli1:H2B-mC) 56 hpf 20 min after Before cessation of BF treatment (Nifedipine)
N
C
Figure 4. Blood Flow Regulates Yap1 Localization Tg(fli1:EGFP-YAP);(fli1:H2B-mC) 56 hpf20 min after Before After restart cessation of BF treatment of BF (BDM)
EGFP-YAP
(49)
Relative GFP intensity (normalized by Myr-mC)
EGFP-YAP/H2B-mC
(49)
tre Bef a or Af te tme e of r ce nt BF ss (B atio Af DM n te ) r of res BF ta rt
Localization of EGFP-YAP
EGFP-YAP/H2B-mC
EGFP-YAP
(A) Time-sequential confocal images of Tg(fli1: EGFP-YAP);(fli1:H2B-mC) embryos before treat80 ment (56 hpf) and 20 min after cessation of blood flow (BF) by nifedipine treatment. EGFP-YAP was 60 translocated from the nucleus (orange arrow40 heads) to the cytoplasm (white arrowheads) after 20 ISV cessation of BF. 0 e n ISV (B) Graph shows percentage of the number of the or ent atio e) f in s Be tm ECs in which EGFP-YAP is excluded from the a es dip rt e er c ife nucleus (N < C, white bars) and those in which t (N f A F B EGFP-YAP is localized in the nucleus (N > C or D f o N = C, black bars) among the total number of (%) (66) (66) (66) observed ECs (indicated at the top) in ISVs of 100 Tg(fli1:EGFP-YAP);(fli1:H2B-mC) embryos before 80 treatment (56 hpf) and 20–30 min after cessation of 60 BF by nifedipine. 40 (C) Similarly to (A), the images of the embryo before 20 treatment, 20 min after cessation of BF by 3-bu0 tanedione monoxime (BDM) treatment, and 2 hr after restart of BF by washing out BDM. EGFPYAP was translocated from the nucleus (orange arrowheads) to the cytoplasm (white arrowheads) after cessation of BF and relocated to the nucleus E Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) (orange arrowheads) after the restart of BF. 56 hpfGFP Myr-mC (D) Similarly to (B), the number of the ECs having F EGFP-YAP in the nucleus or cytoplasm was quantified before and after the treatment with BDM ** 1.5 Before as indicated at the bottom. treatment (E) Projection of confocal stack fluorescence im1 ages of the ISVs in Tg(fli1:Gal4db-TEAD2DN-2AmC);(UAS:GFP);(fli1:Myr-mC) embryos at 56 hpf 0.5 (before treatment) and 10 hr after cessation of BF by nifedipine treatment. GFP images (left) and 0 10h after Myr-mC images (right) are shown. To avoid the cessation of BF Before 10h after bleaching of the fluorescent protein, we performed (Nifedipine) treatment cessation confocal imaging at two time points (before treatof BF ment and 10 hr after) with minimum laser power using the GaAsP detector. Arrows indicate GFPpositive ECs. (F) Fluorescent intensities of GFP in individual ISVs were quantified before treatment and 10 hr after cessation of BF by nifedipine, as observed in (E). The intensity of GFP in ECs was normalized by that of mCherry (see STAR Methods). Fifteen ISVs of three embryos were analyzed. **p < 0.01. Scale bars, 10 mm. See also Figure S4. (%) 100
bundling is enhanced in response to shear stress. Consistently, the cortical actin bundles were rarely seen in ECs sheared for 6 hr and 24 hr, in which nuclear translocation was not enhanced, whereas thinner stress fibers were increased in the center of these cells (Figure S3D). Angiomotins Regulate Nuclear Translocation of YAP in Response to Shear Stress We hypothesized that AMOT might determine the localization of YAP, because AMOT is known to inhibit nuclear localization of YAP via a direct interaction (Chan et al., 2011; Mana-Capelli et al., 2014; Zhao et al., 2011). Binding of AMOT to YAP was confirmed in ECs (Figures S6A and S6B). We then examined the effect of overexpression of EGFP-AMOT on translocation of YAP in ECs exposed to shear stress and found that overexpressed EGFP-AMOT inhibited shear stress-induced nuclear translocation of YAP (Figures 6A and 6B). Competitive binding of YAP and F-actin to AMOT determines the localization of YAP (Feng et al., 2014; Mana-Capelli et al., 2014). We assumed
that YAP released from AMOT-YAP complex enters the nuclei upon shear stress when AMOT binds to cortical F-actin. To examine this idea, we first observed localization of endogenous AMOT before and after shear stress. Our confocal and superresolution imaging revealed that AMOT was preferentially colocalized with the enhanced cortical actin bundles after shear stress (Figures 6C, S6C, and S6D), suggesting that shear stress promotes binding of AMOT to the cortical F-actin bundles. Next, we examined AMOT-YAP binding before and after shear stress by coimmunoprecipitation analyses using two independent antibodies. Coimmunoprecipitation analyses revealed that endogenous YAP bound to AMOT in static ECs (Figures 6D and 6E). Upon shear stress, the AMOT-YAP binding was markedly reduced (Figures 6D–6F), suggesting that YAP is released from AMOT in response to shear stress. AMOT, AMOTL1, and AMOTL2, which constitute the AMOT family, bind to and negatively regulate YAP (Chan et al., 2011; Wang et al., 2011; Zhao et al., 2011). HPAECs expressed all AMOT family members (Figure S6E). Single inhibition of AMOT, Developmental Cell 40, 523–536, March 27, 2017 529
A
Static F-actin
Shear
C
Static pRLC (Ser19)
F-actin VE-cad/YAP/ F-actin
pRLC/F-actin/ VE-cad
HPAEC
Fluorescence intensity
Fluorescence intensity
B
Static 1 F-actin 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25 30 1 0.8 0.6 0.4 0.2 0 0
VE-cadherin
Shear 1 F-actin 0.8 0.6 0.4 0.2 0 0 5 10 15 20 25 30 (μm)
1 0.8 0.6 0.4 0.2 0 5 10 15 20 25 30 0
VE-cadherin
5 10 15 20 25 30 (μm)
AMOTL1, or AMOTL2 significantly enhanced expression of a YAP target gene, CTGF (although the effect of AMOTL1 knockdown was relatively weak; Figure S6F), suggesting that all AMOT family members function as negative regulators of YAP in HPAECs. Therefore, we performed triple knockdown using their siRNAs (Figure S6E). Knockdown of AMOTs resulted in nuclear translocation of YAP even in static ECs (Figures 6G and 6H). In the ECs depleted of AMOTs, shear stress induced neither nuclear localization of YAP nor CTGF mRNA expression (Figures 6G, 6H, and S6G), suggesting that nuclear accumulation of YAP depends upon AMOTs. We further tested whether AMOTs regulate the localization of YAP indirectly by modulating the actin cytoskeleton, because AMOTs modulate actin fiber formation in ECs (Ernkvist et al., 2006). Knockdown of AMOTs did not significantly affect F-actin bundling (Figure S6H), suggesting that the effects of AMOTs knockdown on the localization of YAP are not primarily due to the alteration of F-actin structures. Taken together, these results suggest the following model. YAP is kept in the cytoplasm, in part, by binding to AMOT in static ECs, is released from AMOT that preferentially binds to cortical actin bundles upon shear stress, and thereafter enters the nucleus to promote TEADdependent transcription (Figure 6I). To test whether AMOT family members also control YAP localization in ECs in vivo, we investigated the effects of loss of AMOT family in zebrafish. We examined amotl2afu45 mutant fish, because Amotl2a negatively regulates Yap1 in the lateral line primordium of zebrafish (Agarwala et al., 2015). In the EC-specific TEAD reporter fish embryos with amotl2afu45 allele exhibited ectopic GFP expression in the developing ISVs, which was rarely detected in the wild-type embryos (Figures 6J and S6I). This 530 Developmental Cell 40, 523–536, March 27, 2017
Shear
Figure 5. Flow Induces Reorganization of F-Actin Accompanied by Nuclear Translocation of YAP (A) HPAECs under static conditions or after subjected to shear stress at 15 dynes/cm2 for 10 min were immunostained with anti-VE-cadherin and anti-YAP antibodies and stained with rhodaminephalloidin (F-actin). F-actin images (upper) and the merged images (lower; VE-cadherin, red; YAP, green; F-actin, blue) are shown. (B) Fluorescence intensity of F-actin or VE-cadherin signal in (A) was scanned across cell-cell boundaries (dotted lines). Nine different cell-cell boundaries were measured (shown in different colors). Graphs are representative of five independent experiments. (C) HPAECs under static conditions or after being subjected to shear stress were immunostained with anti-pRLC (phosphorylated myosin regulatory light chain) on Ser19 (pRLC (Ser19)) and anti-VEcadherin antibodies and stained with rhodaminephalloidin. pRLC images (top), F-actin images (middle), and the merged images (bottom; pRLC, green; F-actin, red; VE-cadherin, blue) are shown. Scale bars, 10 mm. See also Figure S5.
result suggests that the AMOT family is required for inhibiting nuclear translocation of Yap1 of ECs in unlumenized vessels in vivo. The GFP signals within the DA and PCV of these reporter embryos with amotl2afu45 were greater than those in the control (Figure 6J), although these vessels were perfused at 30 hpf. Therefore, blood flow might partly cancel the inhibitory activity of Amotl2a toward Yap1 in large vessels. Yap1 Is Required for the Maintenance of Blood Vessels in Zebrafish Finally, we explored the function of Yap1 in vascular development and maintenance by analyzing yap1ncv101 null mutants. The yap1ncv101 null mutants were morphologically normal at least until 7 dpf (Figure S1E), as recently reported (Agarwala et al., 2015), and exhibited normal blood vasculature formation (Figure 7A). However, we noticed vessel regression in yap1ncv101 mutant larvae. From 4.5 to 6.5 dpf, yap1ncv101 homozygous mutant larvae exhibited more frequent lumen stenosis and subsequent vessel retraction in the DLAVs than the wild-type larvae (Figures 7B and 7C). In the hindbrain, the CCtA underwent more vessel stenosis in the mutants at 4 dpf than in the control (Figures 7D and 7E). We also observed distorted blood vessels whereby the width of vessels became irregular in the CCtA, MMCtA (Figure S7A), and ISVs (data not shown) of yap1ncv101 mutant fish. Consequently, vascular networks became sparse in the DLAVs (Figure 7B) and in the CCtA of yap1ncv101 mutant larvae (Figures S7B and S7C). Cessation of blood flow also resulted in lumen stenosis in the DLAVs (Figure 7F). These results suggest that Yap1 might be required for the maintenance of vascular lumen in the presence of blood flow in these vessels. Furthermore, we observed ectopic sprouts and ectopic connections especially in the anterior ISVs and LDA of yap1 mutant fish (Figures 7G–7L), highlighting another important function of Yap1 in vessel
Static
A YAP
Shear
B
EGFP-AMOT
EGFP
YAP Nucleus/Cytoplasm
GFP/YAP1/DAPI GFP/YAP/DAPI
(Super resolution) G 1
Static
(Confocal) AMOT/F-actin 1
2 2
3 4 4
St
ati
c
r ea Sh (kDa) 150
IP: AMOT YAP Ab (Mouse) YAP
75 150
Input AMOT
c
ati
E
St
IP: AMOT YAP Ab (Rabbit) YAP
e Sh
ar (kDa) 150 75
Static Shear
F NS
**
**
2
Static YAP/DAPI
NS
Shear
I
Static AMOT
1.5
Shear stress
AMOT
YAP
1
?
YAP AMOT
AMOT
0.5 0
J
150
Input AMOT
1.4 1.2 1 0.8 0.6 0.4 0.2 0
H YAP Nucleus/Cytoplasm
D
Relative intensity
r r ic ic at h e a t a t h e a S St S S EGFP EGFP-AMOT
AMOTs Triple siRNA
Shear
3
YAP
*** NS
HPAEC Control siRNA
C
*** 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
Nucleus
tic ear tatic hear Sta Sh S S Control AMOTs triple siRNA siRNA
YAP
YAP
TEAD
Tg(fli1:Gal4db-TEAD2ΔN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT amotl2afu45 30 hpf
GFP
NS
GFP/ Myr-mC AMOT YAP IP: YAP Ab
AMOT Input
Figure 6. Angiomotins Are Involved in the Regulation of Nuclear Translocation of YAP Induced by Shear Stress (A) HPAECs transfected with EGFP or EGFP-AMOT were kept under static conditions or subjected to shear stress (15 dynes/cm2, 10 min) and immunostained with anti-YAP and anti-GFP antibodies together with DAPI. YAP images (left) and the merged images (right; EGFP, green; YAP, red; DAPI, blue) are shown. Yellow arrowheads indicate EGFP-expressing cells. (B) Quantification of nuclear fluorescence intensity of YAP relative to that of cytoplasm in EGFP- or EGFP-AMOT-expressing HPAECs as in (A) (n = 3 independent experiments, in each of which >20 EGFP-expressing cells measured). (C) HPAECs under static conditions or after shear stress were immunostained with anti-AMOT antibody and stained with rhodamine-phalloidin (F-actin). Superresolution images (right) were acquired in the boxed regions of confocal fluorescence images (left). In the right panels, the merged images (left; AMOT, green; F-actin, red) and AMOT images (right: green) are shown. Representative images of two independent experiments are shown. (D and E) Lysates of static or sheared HPAECs were immunoprecipitated with mouse anti-YAP (D) or rabbit anti-YAP antibody (E). Coprecipitated endogenous AMOT (p130) was detected by immunoblotting with anti-AMOT antibody. Similar results were obtained in three independent experiments using each antibody. (legend continued on next page)
Developmental Cell 40, 523–536, March 27, 2017 531
stabilization. Yap1-dependent transcription of the TEAD reporter fish remained positive in the DLAVs, ISVs, CCtA, and MCtA, where Yap1 affected vessel stability at least until 6–7 dpf (Figure S7D). We assumed that the flow pattern might determine the transient and sustained nuclear localization of Yap1. As our results using cultured ECs demonstrated, Yap1 transiently entered the nucleus in response to laminar shear stress. However, defects of blood vessels were found later in vivo. Recently, Wang et al. (2016) reported that nuclear localization of YAP/TAZ is induced by 24 hr of disturbed flow. Therefore, we investigated the flow pattern in the DLAV where sustained Yap1-dependent transcription was observed and in the DA where transient Yap1-dependent transcription was observed (Figure S7D). The flow in the DLAV was disturbed (Movie S3), whereas that in the DA was laminar (Movie S4). These results suggest that the flow pattern might regulate the localization of Yap1 in vivo. We then examined the effects of gain-of-function of Yap1 on vascular development. In the lats1 and lats2 double MO oligonucleotides, in which GFP signals of ubiquitous TEAD reporter were increased (Figures S1G and S1H), sprouting, elongation, and lumenization of the ISVs occurred normally (Figures S7E and S7F). In addition, expression of EGFP-tagged Yap1-5SA, a nuclear localized form of zebrafish Yap1 that mimics Yap1 activation (Chiba et al., 2016), did not affect vessel sprouting (data not shown) and lumen formation (Figure S7G). Thus, we could not detect any obvious effects of Yap1 gains of function on vascular development. We then examined whether nuclear Yap1 drives lumen formation in the absence of blood flow. When cardiac contraction and blood flow were blocked by knockdown of cardiac troponin T type A (tnnt2a) using MO, lumen formation was impaired in the ISVs (Figure S7H) as reported previously (Montero-Balaguer et al., 2009; Wang et al., 2010). Expression of EGFP-Yap1-5SA did not induce lumen formation in the closed ISVs of these morphants (Figure S7H), suggesting that nuclear Yap1 is not sufficient to drive lumen formation. Finally, we tested whether Wwtr1 might have a redundant role in vascular development in yap1ncv101 mutants by examining the phenotypes of embryos from incrosses of double-heterozygous yap1ncv101/+:wwtr1ncv114/+ mutant fish. Double-homozygous yap1ncv101:wwtr1ncv114 mutant embryos died until 32 hpf before the circulation, exhibiting severe developmental defects (Figures S7I). In these mutants, formation of the axial vessels (the DA and PCV) were completely abrogated (Figure S7J). Developmental defects of yap1ncv101:wwtr1ncv114/+ mutant em-
bryos were milder than those of yap1ncv101:wwtr1ncv114 mutant embryos (Figure S7I). Although these embryos exhibited normal patterning of blood vessels including the DA, PCV, ISVs, and DLAVs (Figure S7J), they did not have circulation (Figure S7L) due to the cardia bifida (Figures S7K and S7L). Therefore, it is technically difficult to examine the functional redundancy of Wwtr1 in flow-regulated processes using these mutants. DISCUSSION In the present study, we developed three types of Tg fish to monitor Yap1 regulation in ECs of living zebrafish. Whereas ubiquitous TEAD reporter and EC-specific TEAD reporter can indirectly reflect transcriptional activity of Yap1 or Taz through TEAD as GFP expression, Tg(fli1:EGFP-YAP) fish directly mimic localization of Yap1 in ECs. By using these Tg fish, we revealed that Yap1 responded to blood flow in ECs. Because YAP functions in multiple organs and tissues (Piccolo et al., 2014), these Tg fish will become a powerful tool to investigate the regulation of Yap1. Yap1 responds to blood flow in vivo. While blood flow generates mechanical stimuli including shear stress and mechanical strain (Hahn and Schwartz, 2009), blood flow transports multiple molecules that might affect Yap1. However, it is technically difficult to separate these factors in vivo. Considering that YAP is shown to respond to various mechanical forces as reported by the studies using cultured cells (Aragona et al., 2013; BenhamPyle et al., 2015; Calvo et al., 2013; Codelia et al., 2014; Dupont et al., 2011; Sabine et al., 2015; Wada et al., 2011), we used cultured ECs to try to render the ECs exposed only to shear stress and revealed that YAP responded to laminar shear stress. Therefore, at least shear stress induced by blood flow might potentially regulate the localization of Yap1 in vivo. We revealed flow-dependent nuclear translocation of Yap1 in lumenized blood vessels. Choi et al. (2015) have recently observed nuclear localization of YAP in the angiogenic front of the mouse retina where flow is absent. We also detected flowindependent nuclear localization of Yap1 in vessel sprouts of the brain vessels, albeit weaker than that in lumenized vessels. Thus, YAP could be regulated in both flow-dependent and flow-independent manners in ECs. Even in the perfused vessels, TEAD reporter was not driven in some vessels. Therefore, blood flow might not be a sole determinant for nuclear localization of Yap1 in these ECs. Mechanical forces regulate YAP localization through both LATS-dependent (Codelia et al., 2014; Wada et al., 2011) and
(F) Total AMOT (Input) and the AMOT and YAP immunoprecipitated with rabbit anti-YAP antibody (IP: YAP Ab) in static or sheared HPAECs as in (E) were analyzed. The relative intensity was calculated by the intensity of the band of immunoprecipitated AMOT or YAP by anti-YAP antibody in the static or sheared HPAECs (n = 3 independent experiments). (G) HPAECs transfected with control siRNA or AMOT + AMOTL1 + AMOTL2 siRNAs (AMOTs triple siRNAs) were kept under static conditions or subjected to shear stress (15 dynes/cm2, 10 min) and immunostained with anti-YAP antibody together with DAPI. (H) Quantification of nuclear fluorescence intensity of YAP relative to that of cytoplasm as in (G) (n = 3 independent experiments, in each of which >100 cells were measured). (I) A schematic representation of how YAP translocates into the nucleus in response to shear stress. In static ECs YAP is kept in the cytoplasm, at least in part by binding to AMOT. Upon shear stress, a significant population of AMOT preferentially binds to the increased levels of cortical actin bundles. By direct binding to F-actin or by other unknown mechanism, AMOT releases YAP. Released YAP then enters into the nucleus to promote TEAD-dependent transcription. (J) Projection view of confocal stack fluorescence images of the trunk region in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) WT (left) and homozygous amotl2afu45 mutant embryos (right) at 30 hpf. Upper panels, GFP images; lower panels, merged images (GFP, green; Myr-mC, red). Arrows indicate ectopic GFP expression in the developing ISVs. Representative images of three independent experiments are shown. Data are means ± SD in (B), (F), and (H). **p < 0.01, ***p < 0.001; NS, not significant. Scale bars, 10 mm. See also Figure S6.
532 Developmental Cell 40, 523–536, March 27, 2017
A
B Tg(fli1:EGFP)
D Tg(fli1:EGFP) 4 dpf
yap1ncv101
yap1ncv101/+
WT
DLAV ISV DA PCV
Tg(fli1:EGFP) 31 hpf WT
yap1ncv101
CCtA
yap1ncv101
WT
F
4.5 dpf
Tg(fli1:EGFP) 5 dpf
(Cross section)
Normal blood flow 0h
5 dpf 5.5 dpf
14 h
6 dpf Cessation of blood flow
0h
E
0
on sis on sis no tracti teno tracti e t S Re S Re
14 h
**
10
H
5 0
WT yap1ncv101 Tg(fli1:EGFP) 3 dpf WT
WT yap1ncv101/+ yap1ncv101
1 0
Ectopic sprout
yap1ncv101
WT
WT
LDA
yap1
ncv101
J Embryos with ectopic sprouts from the LDA
I Tg(fli1:EGFP) 32 hpf
K Tg(fli1:EGFP) 3.5 dpf
(%) 60
WT
*
50 40 30
LDA
20 10 0
WT
yap1ncv101
(Ectopic connection)
yap1ncv101
L ncv101
yap1
Embryos with ectopic connections in the LDA
(Ectopic sptout)
*
**
5 4 3 2
Ectopic connection
1 0.5
** 15
Ectopic sprout
1.5
Ectopic connection
**
Events/embryo (Anterior 14 ISVs)
G
** 2
Stenosis in CCtA /embryo
C
The number of events /somite (4.5-6.5 dpf)
6.5 dpf
(%) 100
**
80 60 40 20 0
WT
yap1ncv101
Figure 7. Yap1 Is Required for Vessel Maintenance (A) Projection view of confocal stack fluorescence images of Tg(fli1:EGFP) WT (left) embryos with WT allele (left) and yap1ncv101 mutant allele (right) fixed at 31 hpf. Note the overall normal vascular formation in homozygous mutants. (B) Projection view of confocal images of the DLAVs in Tg(fli1:EGFP) larvae with WT (left) and yap1ncv101 allele (right) taken every 12 hr from 4.5 dpf to 6.5 dpf. White and yellow arrows indicate blood vessels exhibiting lumen stenosis and EC retraction, respectively. (C) Quantitative analyses of incidence of the DLAVs showing lumen stenosis and EC retraction at a single somite level from 4.5 to 6.5 dpf as in (B). Each dot represents the value for an embryo. For each embryo, the number of the events at six to eight somite levels were counted and then divided by the total number of somite levels observed. Horizontal lines represent mean ± SD. (D) Projection view of confocal images of the hindbrain region in Tg(fli1:EGFP) larvae with WT allele (left), heterozygous yap1ncv101/+ allele (middle), and yap1ncv101 allele (right) at 4 dpf. Dorsal view. Dashed circles indicate lumen stenosis in the CCtA. (E) Quantification of the number of blood vessels showing lumen stenosis in the CCtA of WT, yap1ncv101/+, or yap1ncv101 larvae at 4 dpf as observed in (D). Each dot represents the number of stenoses found in an embryo. Horizontal lines represent mean ± SD (n R 10 independent experiments). (legend continued on next page)
Developmental Cell 40, 523–536, March 27, 2017 533
LATS-independent pathways (Calvo et al., 2013; Dupont et al., 2011). Our findings indicate that YAP responds to shear stress in a LATS-independent pathway, since shear stress induced nuclear translocation of YAP even in the absence of LATS1/2. Instead, we revealed that YAP entered the nucleus by dissociating from AMOT under shear stress. Upon shear stress, cortical actin bundling was enhanced along cell-cell junctions. Given that AMOT preferentially localized with the enhanced cortical actin in our experiments and that YAP and F-actin compete with each other for binding to AMOT (Feng et al., 2014; Mana-Capelli et al., 2014), an increased binding of AMOT to the enhanced cortical actin would trigger YAP release. Mechanical forces often involve modulation of the actin cytoskeleton (Aragona et al., 2013; Calvo et al., 2013; Dupont et al., 2011). It would be interesting to test whether other external forces might also affect YAP localization by affecting the binding between YAP and AMOT or other AMOT family members. There is a difference in the duration of YAP responses to flow between in vitro and in vivo. While nuclear translocation of YAP by laminar shear stress was transient in HPAECs, Yap1-dependent transcription of TEAD reporter fish was sustained at least until 6–7 dpf in the DLAVs, ISVs, and CCtA. These differences between transient nuclear localization of YAP in vitro and sustained nuclear localization of Yap1 in vivo could be explained by the flow patterns. Laminar shear stress transiently induces activation of nuclear factor kB, reactive oxygen species production, and expression of proinflammatory genes, while disturbed flow keeps those in a sustained manner (Hahn and Schwartz, 2009). A recent report by Wang et al. (2016) demonstrates that disturbed but not laminar flow for 12 and 24 hr induces nuclear localization of YAP/TAZ. Consistently, 48 hr of oscillatory shear stress enhances nuclear localization of YAP/TAZ in cultured lymphatic ECs (LECs) (Sabine et al., 2015). In these LECs, thick cortical actin fibers, similar to what we observed in the sheared HPAECs, are induced (Sabine et al., 2015). Thus, some types of disturbed flow could induce sustained nuclear translocation of YAP in ECs, while laminar shear stress does so transiently. Therefore, flow patterns might determine the localization of Yap1/YAP both in vitro and in vivo. Homozygous yap1ncv101 mutants did not show any cardia bifida, while we reported cardia bifida in yap1 MO-injected embryos (Fukui et al., 2014). Here, we have demonstrated that double-homozygous yap1ncv101:wwtr1ncv114 mutant embryos and yap1ncv101:wwtr1ncv114/+ mutant embryos exhibited cardia bifida
(Figures S7K and S7L), suggesting that Wwtr1 functions redundantly with Yap1 to inhibit cardia bifida when Yap1 is depleted. In general, the discrepancy between MO injection and mutants is thought to be due to off-target or non-off-target effects (Kok et al., 2015; Rossi et al., 2015). Therefore, we consider two possibilities to explain this case. One possibility is that yap1 MO might induce cardia bifida by blocking both Yap1 and other off-target genes that might affect Wwtr1 activity. The other is that Wwtr1 might compensate for Yap1 in yap1ncv101 mutants, but not in yap1 morphants. Consistent with the latter hypothesis, upregulation of total Wwtr1 protein is reported in yap1 mutants (Miesfeld et al., 2015). Further studies are needed to completely solve the discrepancy between Yap1 morphant and mutant. Yap1 is important for the maintenance of blood vessels. Since yap1 mutant larvae exhibited enhanced lumen stenosis in the DLAVs and CCtA, Yap1 is required for the maintenance of the lumen structure in some blood vessels. Blood flow is important for the maintenance of lumenized blood vessels (Chen et al., 2012; Meeson et al., 1996; Wang et al., 2010). We also revealed that cessation of blood flow resulted in lumen stenosis in the DLAVs of zebrafish larvae. Therefore, we assumed that Yap1 might be involved in the flow-mediated lumen maintenance. A recent report showed that YAP is required for generating actomyosin-mediated tissue tension to define proper tissue shape in medaka and zebrafish (Porazinski et al., 2015). Yap1 in ECs might be important for generating mechanical tensions to maintain EC shape in forming vascular lumen. On the other hand, Yap1 is also important for keeping the appropriate shape and width in some vessels including the CCtA, MMCtA, and ISVs. Future studies are needed to elucidate the mechanisms by which Yap1 stabilizes lumenized blood vessels in response to blood flow. In conclusion, we have delineated a novel regulation of YAP in ECs by blood flow, which might be involved in vessel maintenance, and have uncovered a molecular mechanism by which shear stress induces nuclear translocation of YAP (Figure 6I). STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d
KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING
(F) Projection view of confocal stack fluorescence images of the DLAVs in Tg(fli1:EGFP) larvae (5 dpf) at the indicated time after cessation of blood flow by BDM treatment or without treatment. Transverse sections at the dashed lines are shown to the right. Arrows indicate blood vessels showing lumen stenosis. (G) Projection view of confocal images of the anterior trunk ISVs in Tg(fli1:EGFP) larvae with WT allele (left) and yap1ncv101 allele (right) at 3 dpf. White and yellow arrowheads indicate ISVs exhibiting ectopic sprouts and ectopic connections, respectively. (H) Quantification of the number of ectopic sprouts from the ISVs and ectopic connections in the ISVs within 14 ISVs of anterior trunk for each embryo at 3 dpf as in (G). Each dot represents the value for an embryo. Horizontal lines represent mean ± SD (n = 12 independent experiments). (I) Projection view of confocal images of the LDA in Tg(fli1:EGFP) embryos with WT allele (left) and yap1ncv101 allele (right) at 32 hpf. Dorsal view. White arrowheads indicate ectopic sprouts from the LDA. (J) Graph shows the percentage of the embryos with ectopic sprouts from the LDA at 31–32 hpf as in (I). Data are mean ± SD (n = 3 independent experiments, in each of which R9 embryos were measured). (K) Projection view of confocal images of the LDA in Tg(fli1:EGFP) larvae with WT allele (left) and yap1ncv101 allele (right) at 3.5 dpf. Dorsal view. Yellow arrowheads indicate ectopic connections in the LDA. (L) Graph shows the percentage of the embryos with ectopic connections in the LDA at 3.5 dpf as in (K). Data are mean ± SD (n = 3 independent experiments, in each of which >8 embryos were measured). *p < 0.05, **p < 0.01. Scale bars, 10 mm. See also Figure S7.
534 Developmental Cell 40, 523–536, March 27, 2017
d
d
d
EXPERIMENTAL MODEL AND SUBJECT DETAILS B Zebrafish B Cell Culture METHOD DETAILS B Plasmids B Transgenic Zebrafish Lines B Image Acquisition, Processing, and Quantification Using Microscopes B Microinjections of Morpholino Oligonucleotides (MOs) B Knockout Fish by Transcription Activator-like Effector Nuclease (TALEN) ncv101 B Phenotypic Analyses of yap1 , wwtr1ncv114, and fu45 Mutants amotl2a B FACS B RT-PCR and Quantitative Real-Time PCR (qPCR) Analyses B Transfection, Shear Stress, and siRNA-Mediated Protein Knockdown B Immunofluorescence B Immunoprecipitation and Western Blot Analysis QUANTIFICATION AND STATISTICAL ANALYSIS B Measurements of GFP Intensity in EC-Specific TEAD Reporter B Measurements of Nuclear/Cytoplasmic Ratio of YAP B Statistical Analysis
SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures, one table, and four movies and can be found with this article online at http://dx.doi.org/10.1016/j. devcel.2017.02.019. AUTHOR CONTRIBUTIONS
Ando, J., and Yamamoto, K. (2013). Flow detection and calcium signalling in vascular endothelial cells. Cardiovasc. Res. 99, 260–268. Aragona, M., Panciera, T., Manfrin, A., Giulitti, S., Michielin, F., Elvassore, N., Dupont, S., and Piccolo, S. (2013). A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154, 1047–1059. Asakawa, K., Suster, M.L., Mizusawa, K., Nagayoshi, S., Kotani, T., Urasaki, A., Kishimoto, Y., Hibi, M., and Kawakami, K. (2008). Genetic dissection of neural circuits by Tol2 transposon-mediated Gal4 gene and enhancer trapping in zebrafish. Proc. Natl. Acad. Sci. USA 105, 1255–1260. Avruch, J., Zhou, D., Fitamant, J., Bardeesy, N., Mou, F., and Barrufet, L.R. (2012). Protein kinases of the Hippo pathway: regulation and substrates. Semin. Cell Dev. Biol. 23, 770–784. Bao, Y., Nakagawa, K., Yang, Z., Ikeda, M., Withanage, K., Ishigami-Yuasa, M., Okuno, Y., Hata, S., Nishina, H., and Hata, Y. (2011). A cell-based assay to screen stimulators of the Hippo pathway reveals the inhibitory effect of dobutamine on the YAP-dependent gene transcription. J. Biochem. 150, 199–208. Benham-Pyle, B.W., Pruitt, B.L., and Nelson, W.J. (2015). Cell adhesion. Mechanical strain induces E-cadherin-dependent Yap1 and beta-catenin activation to drive cell cycle entry. Science 348, 1024–1027. Betz, C., Lenard, A., Belting, H.G., and Affolter, M. (2016). Cell behaviors and dynamics during angiogenesis. Development 143, 2249–2260. Bussmann, J., Wolfe, S.A., and Siekmann, A.F. (2011). Arterial-venous network formation during brain vascularization involves hemodynamic regulation of chemokine signaling. Development 138, 1717–1726. Calvo, F., Ege, N., Grande-Garcia, A., Hooper, S., Jenkins, R.P., Chaudhry, S.I., Harrington, K., Williamson, P., Moeendarbary, E., Charras, G., et al. (2013). Mechanotransduction and YAP-dependent matrix remodelling is required for the generation and maintenance of cancer-associated fibroblasts. Nat. Cell Biol. 15, 637–646. Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F. (2011). Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res. 39, e82.
H.N. performed the majority of experiments. K.Y. provided a method for shear stress experiments; K.T. and H.F. developed Tg fish. S.A., K.A., T.M., E.S., H.-G.B., M.A., and V.L. developed mutant fish. K.Y. and Y.Y. supported the experiments. H.N., S.F., and N.M. analyzed results. H.N. and N.M. designed the project and wrote the manuscript. H.-G.B., M.A., and V.L. revised the manuscript.
Chan, S.W., Lim, C.J., Chong, Y.F., Pobbati, A.V., Huang, C., and Hong, W. (2011). Hippo pathway-independent restriction of TAZ and YAP by angiomotin. J. Biol. Chem. 286, 7018–7026.
ACKNOWLEDGMENTS
Chen, Q., Jiang, L., Li, C., Hu, D., Bu, J.W., Cai, D., and Du, J.L. (2012). Haemodynamics-driven developmental pruning of brain vasculature in zebrafish. PLoS Biol. 10, e1001374.
We are grateful to M. Sone, T. Babazono, W. Koeda, K. Hiratomi, E. Okamoto, H. Toyoshima, and M. Ueda for excellent technical assistance, K. Shioya for excellent fish care, and J.S. Gutkind for helpful advice. This work was supported in part by grants from JSPS KAKENHI (No. 16H02618 to N.M.; No. 25871232 to H.N.); AMED-CREST (No. 13414779 to N.M.); the Takeda Science Foundation (to N.M.); the Ichiro Kanehara Foundation, the Kanae Foundation for the Promotion of Medical Science, the Uehara Memorial Foundation, the Japan Foundation for Applied Enzymology, and the Japan Heart Foundation (to H.N.). Received: September 14, 2016 Revised: January 16, 2017 Accepted: February 24, 2017 Published: March 27, 2017 REFERENCES Agarwala, S., Duquesne, S., Liu, K., Boehm, A., Grimm, L., Link, S., Konig, S., Eimer, S., Ronneberger, O., and Lecaudey, V. (2015). Amotl2a interacts with the Hippo effector Yap1 and the Wnt/beta-catenin effector Lef1 to control tissue size in zebrafish. Elife 4, e08201.
Chen, C.H., Sun, Y.H., Pei, D.S., and Zhu, Z.Y. (2009). Comparative expression of zebrafish lats1 and lats2 and their implication in gastrulation movements. Dev. Dyn. 238, 2850–2859.
Cheung, A., Dantzig, J.A., Hollingworth, S., Baylor, S.M., Goldman, Y.E., Mitchison, T.J., and Straight, A.F. (2002). A small-molecule inhibitor of skeletal muscle myosin II. Nat. Cell Biol. 4, 83–88. Chiba, A., Watanabe-Takano, H., Terai, K., Fukui, H., Miyazaki, T., Uemura, M., Hashimoto, H., Hibi, M., Fukuhara, S., and Mochizuki, N. (2016). Osteocrin, a peptide secreted from the heart and other tissues, contributes to cranial osteogenesis and chondrogenesis in zebrafish. Development 144, 334–344. Chiu, J.J., and Chien, S. (2011). Effects of disturbed flow on vascular endothelium: pathophysiological basis and clinical perspectives. Physiol. Rev. 91, 327–387. Choi, H.J., Zhang, H., Park, H., Choi, K.S., Lee, H.W., Agrawal, V., Kim, Y.M., and Kwon, Y.G. (2015). Yes-associated protein regulates endothelial cell contact-mediated expression of angiopoietin-2. Nat. Commun. 6, 6943. Codelia, V.A., Sun, G., and Irvine, K.D. (2014). Regulation of YAP by mechanical strain through Jnk and Hippo signaling. Curr. Biol. 24, 2012–2017. Cui, Y., Hameed, F.M., Yang, B., Lee, K., Pan, C.Q., Park, S., and Sheetz, M. (2015). Cyclic stretching of soft substrates induces spreading and growth. Nat. Commun. 6, 6333.
Developmental Cell 40, 523–536, March 27, 2017 535
Dupont, S., Morsut, L., Aragona, M., Enzo, E., Giulitti, S., Cordenonsi, M., Zanconato, F., Le, D.J., Forcato, M., Bicciato, S., et al. (2011). Role of YAP/ TAZ in mechanotransduction. Nature 474, 179–183.
Montero-Balaguer, M., Swirsding, K., Orsenigo, F., Cotelli, F., Mione, M., and Dejana, E. (2009). Stable vascular connections and remodeling require full expression of VE-cadherin in zebrafish embryos. PLoS One 4, e5772.
Eilken, H.M., and Adams, R.H. (2010). Dynamics of endothelial cell behavior in sprouting angiogenesis. Curr. Opin. Cell Biol. 22, 617–625.
Morin-Kensicki, E.M., Boone, B.N., Howell, M., Stonebraker, J.R., Teed, J., Alb, J.G., Magnuson, T.R., O’Neal, W., and Milgram, S.L. (2006). Defects in yolk sac vasculogenesis, chorioallantoic fusion, and embryonic axis elongation in mice with targeted disruption of Yap65. Mol. Cell. Biol. 26, 77–87.
Ernkvist, M., Aase, K., Ukomadu, C., Wohlschlegel, J., Blackman, R., Veitonmaki, N., Bratt, A., Dutta, A., and Holmgren, L. (2006). p130-angiomotin associates to actin and controls endothelial cell shape. FEBS J. 273, 2000–2011. Feng, X., Degese, M.S., Iglesias-Bartolome, R., Vaque, J.P., Molinolo, A.A., Rodrigues, M., Zaidi, M.R., Ksander, B.R., Merlino, G., Sodhi, A., et al. (2014). Hippo-independent activation of YAP by the GNAQ uveal melanoma oncogene through a trio-regulated rho GTPase signaling circuitry. Cancer Cell 25, 831–845. Franco, C.A., Jones, M.L., Bernabeu, M.O., Geudens, I., Mathivet, T., Rosa, A., Lopes, F.M., Lima, A.P., Ragab, A., Collins, R.T., et al. (2015). Dynamic endothelial cell rearrangements drive developmental vessel regression. PLoS Biol. 13, e1002125. Freund, J.B., Goetz, J.G., Hill, K.L., and Vermot, J. (2012). Fluid flows and forces in development: functions, features and biophysical principles. Development 139, 1229–1245. Fukui, H., Terai, K., Nakajima, H., Chiba, A., Fukuhara, S., and Mochizuki, N. (2014). S1P-Yap1 signaling regulates endoderm formation required for cardiac precursor cell migration in zebrafish. Dev. Cell 31, 128–136. Geudens, I., and Gerhardt, H. (2011). Coordinating cell behaviour during blood vessel formation. Development 138, 4569–4583. Hahn, C., and Schwartz, M.A. (2009). Mechanotransduction in vascular physiology and atherogenesis. Nat. Rev. Mol. Cell Biol. 10, 53–62. Herbert, S.P., and Stainier, D.Y. (2011). Molecular control of endothelial cell behaviour during blood vessel morphogenesis. Nat. Rev. Mol. Cell Biol. 12, 551–564. Herwig, L., Blum, Y., Krudewig, A., Ellertsdottir, E., Lenard, A., Belting, H.G., and Affolter, M. (2011). Distinct cellular mechanisms of blood vessel fusion in the zebrafish embryo. Curr. Biol. 21, 1942–1948. Kok, F.O., Shin, M., Ni, C.W., Gupta, A., Grosse, A.S., van Impel, A., Kirchmaier, B.C., Peterson-Maduro, J., Kourkoulis, G., Male, I., et al. (2015). Reverse genetic screening reveals poor correlation between morpholinoinduced and mutant phenotypes in zebrafish. Dev. Cell 32, 97–108. Kwon, H.B., Fukuhara, S., Asakawa, K., Ando, K., Kashiwada, T., Kawakami, K., Hibi, M., Kwon, Y.G., Kim, K.W., Alitalo, K., et al. (2013). The parallel growth of motoneuron axons with the dorsal aorta depends on Vegfc/Vegfr3 signaling in zebrafish. Development 140, 4081–4090. Langheinrich, U., Vacun, G., and Wagner, T. (2003). Zebrafish embryos express an orthologue of HERG and are sensitive toward a range of QTprolonging drugs inducing severe arrhythmia. Toxicol. Appl. Pharmacol. 193, 370–382.
Ota, M., and Sasaki, H. (2008). Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling. Development 135, 4059–4069. Piccolo, S., Dupont, S., and Cordenonsi, M. (2014). The biology of YAP/TAZ: hippo signaling and beyond. Physiol. Rev. 94, 1287–1312. Porazinski, S., Wang, H., Asaoka, Y., Behrndt, M., Miyamoto, T., Morita, H., Hata, S., Sasaki, T., Krens, S.F., Osada, Y., et al. (2015). YAP is essential for tissue tension to ensure vertebrate 3D body shape. Nature 521, 217–221. Rossi, A., Kontarakis, Z., Gerri, C., Nolte, H., Holper, S., Kruger, M., and Stainier, D.Y. (2015). Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature 524, 230–233. Sabine, A., Bovay, E., Demir, C.S., Kimura, W., Jaquet, M., Agalarov, Y., Zangger, N., Scallan, J.P., Graber, W., Gulpinar, E., et al. (2015). FOXC2 and fluid shear stress stabilize postnatal lymphatic vasculature. J. Clin. Invest. 125, 3861–3877. Sakurai, A., Fukuhara, S., Yamagishi, A., Sako, K., Kamioka, Y., Masuda, M., Nakaoka, Y., and Mochizuki, N. (2006). MAGI-1 is required for Rap1 activation upon cell-cell contact and for enhancement of vascular endothelial cadherinmediated cell adhesion. Mol. Biol. Cell 17, 966–976. Serluca, F.C., Drummond, I.A., and Fishman, M.C. (2002). Endothelial signaling in kidney morphogenesis: a role for hemodynamic forces. Curr. Biol. 12, 492–497. Uemura, M., Nagasawa, A., and Terai, K. (2016). Yap/Taz transcriptional activity in endothelial cells promotes intramembranous ossification via the BMP pathway. Sci. Rep. 6, 27473. Wada, K., Itoga, K., Okano, T., Yonemura, S., and Sasaki, H. (2011). Hippo pathway regulation by cell morphology and stress fibers. Development 138, 3907–3914. Wang, Y., Kaiser, M.S., Larson, J.D., Nasevicius, A., Clark, K.J., Wadman, S.A., Roberg-Perez, S.E., Ekker, S.C., Hackett, P.B., McGrail, M., et al. (2010). Moesin1 and Ve-cadherin are required in endothelial cells during in vivo tubulogenesis. Development 137, 3119–3128. Wang, W., Huang, J., and Chen, J. (2011). Angiomotin-like proteins associate with and negatively regulate YAP1. J. Biol. Chem. 286, 4364–4370. Wang, K.C., Yeh, Y.T., Nguyen, P., Limqueco, E., Lopez, J., Thorossian, S., Guan, K.L., Li, Y.J., and Chien, S. (2016). Flow-dependent YAP/TAZ activities regulate endothelial phenotypes and atherosclerosis. Proc. Natl. Acad. Sci. USA 113, 11525–11530.
Lawson, N.D., and Weinstein, B.M. (2002). In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 248, 307–318.
Yamamoto, K., Shimizu, N., Obi, S., Kumagaya, S., Taketani, Y., Kamiya, A., and Ando, J. (2007). Involvement of cell surface ATP synthase in flow-induced ATP release by vascular endothelial cells. Am. J. Physiol. Heart Circ. Physiol. 293, H1646–H1653.
Lucitti, J.L., Jones, E.A., Huang, C., Chen, J., Fraser, S.E., and Dickinson, M.E. (2007). Vascular remodeling of the mouse yolk sac requires hemodynamic force. Development 134, 3317–3326.
Yokota, Y., Nakajima, H., Wakayama, Y., Muto, A., Kawakami, K., Fukuhara, S., and Mochizuki, N. (2015). Endothelial Ca2+ oscillations reflect VEGFR signaling-regulated angiogenic capacity in vivo. Elife 4, e08817.
Mana-Capelli, S., Paramasivam, M., Dutta, S., and McCollum, D. (2014). Angiomotins link F-actin architecture to Hippo pathway signaling. Mol. Biol. Cell 25, 1676–1685.
Yu, F.X., and Guan, K.L. (2013). The Hippo pathway: regulators and regulations. Genes Dev. 27, 355–371.
Meeson, A., Palmer, M., Calfon, M., and Lang, R. (1996). A relationship between apoptosis and flow during programmed capillary regression is revealed by vital analysis. Development 122, 3929–3938. Miesfeld, J.B., Gestri, G., Clark, B.S., Flinn, M.A., Poole, R.J., Bader, J.R., Besharse, J.C., Wilson, S.W., and Link, B.A. (2015). Yap and Taz regulate retinal pigment epithelial cell fate. Development 142, 3021–3032.
536 Developmental Cell 40, 523–536, March 27, 2017
Zhao, B., Li, L., Lu, Q., Wang, L.H., Liu, C.Y., Lei, Q., and Guan, K.L. (2011). Angiomotin is a novel Hippo pathway component that inhibits YAP oncoprotein. Genes Dev. 25, 51–63. Zygmunt, T., Gay, C.M., Blondelle, J., Singh, M.K., Flaherty, K.M., Means, P.C., Herwig, L., Krudewig, A., Belting, H.G., Affolter, M., et al. (2011). Semaphorin-PlexinD1 signaling limits angiogenic potential via the VEGF decoy receptor sFlt1. Dev. Cell 21, 301–314.
STAR+METHODS KEY RESOURCES TABLE
REAGENT or RESOURCE
SOURCE
IDENTIFIER
Mouse anti-YAP
Santa Cruz Biotechnology, Inc
Cat#sc-101199; RRID: AB_1131430
Rabbit anti-YAP
Cell Signaling Technology
Cat#4912; RRID: AB_2218911
Rabbit anti-YAP (Figure 1D for Western blot; Figure 6E for immunoprecipitation)
Novus Biologicals
Cat#NB110-58358; RRID: AB_1850761
Antibodies
Rabbit anti-phosphorylated YAP on Ser127
Cell Signaling Technology
Cat#4911; RRID: AB_2218913
Rabbit anti-LATS1
Cell Signaling Technology
Cat#3477; RRID: AB_2133513
Rabbit anti-LATS2
Cell Signaling Technology
Cat#5888
Rabbit anti-phospho-LATS1/LATS2 on Thr1079
Cell Signaling Technology
Cat#8654; RRID: AB_10971635
Rabbit anti-VE-cadherin
Cell Signaling Technology
Cat#2500; RRID: AB_10839118
Rabbit anti-phospho-RLC on Ser19
Cell Signaling Technology
Cat#3671; RRID: AB_330249
Mouse anti-TAZ (WWTR1)
BD Bioscience
Cat#560235; RRID: AB_1645338
Rabbit anti-AMOT
Abcam
Cat#ab117776; RRID: AB_10898815
Mouse anti-beta-actin
Sigma-Aldrich
Cat#A5441; RRID: AB_476744
Rabbit anti-GFP
Sakurai et al., 2006
N/A
Blebbistatin
Sigma-Aldrich
Cat#B0560
2,3-Butanedione monoxime (BDM)
Sigma-Aldrich
Cat#B0753-25G
Nifedipine
Sigma-Aldrich
Cat#N7634-1G
Chemicals, Peptides, and Recombinant Proteins
Qtracker 655 (Qdot)
Thermo Fisher
Cat#Q21021MP
TRIzol reagent
Thermo Fisher
Cat#15596018
EGM-2
Lonza
Cat#CC-4176
ViaFect transfection reagent
Promega
Cat#E4981
Lipofectamine RNAi MAX reagent
Thermo Fisher
Cat#13778075
Alexa Fluor 633 phalloidin
Thermo Fisher
Cat#A22284
Protease inhibitor cocktail
Nacalai Tesque
Cat#25955-24
Protein A–Sepharose
Sigma-Aldrich
Cat#GE17-0780-01
4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI)
Thermo Fisher
Cat#D1306
Critical Commercial Assays mMESSAGE mMACHINE SP6 Transcription Kit
Thermo Fisher
Cat#AM1340
mMESSAGE mMACHINE T3 Transcription Kit
Thermo Fisher
Cat#AM1348
SuperScript III
Thermo Fisher
Cat#18080044
QuantiFast SYBR Green RT-PCR kit
Qiagen
Cat#204154
NucleoSpin RNA XS kit
Macherey-Nagel
Cat#740902.50
Experimental Models: Cell Lines Human pulmonary artery endothelial cells (HPAEC)
Lonza
Cat#CC-2530
Human umbilical vein endothelial cells (HUVEC)
Thermo Fisher
Cat#C0035C
This paper
N/A
Experimental Models: Organisms/Strains Zebrafish: Tg(fli1:EGFP-YAP)ncv35 ncv36
This paper
N/A
Zebrafish: Tg(eef1a1l1:Gal4db-TEAD2DN-2A-mC)ncv12
Fukui et al., 2014
N/A
Zebrafish: Tg(fli1:Myr-mC)ncv1
Kwon et al., 2013
N/A
Zebrafish: Tg(fli1:H2B-mC)ncv31
Yokota et al., 2015
N/A
Zebrafish: Tg(myl7:NLS-tdEosFP)ncv10
Fukui et al., 2014
N/A
Zebrafish: Tg(fli1:Gal4db-TEAD2DN-2A-mC)
(Continued on next page)
Developmental Cell 40, 523–536.e1–e6, March 27, 2017 e1
Continued REAGENT or RESOURCE
SOURCE
IDENTIFIER
Zebrafish: Tg(fli1:EGFP)y1
Dr. Nathan Lawson - University of Massachusetts Medical School (Lawson and Weinstein, 2002)
N/A
Zebrafish: Tg(UAS:GFP)
Dr. Koichi Kawakami - National Institute of Genetics, Japan (Asakawa et al., 2008)
N/A
Zebrafish: Tg(fli1:Gal4FF)
Zygmunt et al., 2011
N/A
Zebrafish: Tg(huC:GFP)
Kwon et al., 2013
N/A
Zebrafish: yap1ncv101
This paper
N/A
Zebrafish: wwtr1ncv114
This paper
N/A
Zebrafish: amotl2afu45
Agarwala et al., 2015
N/A
Primers for RT-PCR and qPCR analyses, see Table S1
This paper
N/A
Primer for genotyping: Zebrafish Yap1 Forward: TCCTTCGCAAGGCTTGGATAATTG
This paper
N/A
Primer for genotyping: Zebrafish Yap1 Reverse: TTGTCTGGAGTGGGACTTTGGCTC
This paper
N/A
Primer for genotyping: Zebrafish Wwtr1 Forward: GGACGAAAAACAGGAAAAGTTC
This paper
N/A
Primer for genotyping: Zebrafish Wwtr1 Reverse: ACTGCGGCATATCCTTGTTC
This paper
N/A
Primer for genotyping: Zebrafish Amotl2a Forward: CAAGCACCTCGTCACAATG
This paper
N/A
Primer for genotyping: Zebrafish Amotl2a Reverse: CACTGTAGCTGTCCACTTCTC
This paper
N/A
Morpholino: control MO (Standard control oligo): CCTCTTACCTCAGTTACAATTTATA
Gene Tools
ZFIN: ZDB-MRPHLNO-041116-4
Morpholino: lats1 MO: CCTCGGGTTTCTCGGCCCTCCTCAT
Gene Tools
ZFIN: ZDB-MRPHLNO-100415-2
Morpholino: lats2 MO: CATGAGTGAACTTGGCCTGTTTTCT
Gene Tools
ZFIN: ZDB-MRPHLNO-100415-4
Morpholino: tnnt2a MO: CATGTTTGCTCTGATCTGACACGCA
Gene Tools
ZFIN: ZDB-MRPHLNO-060317-4
siRNA targeting YAP: CCAUGACUCAGGAUGGAGAAAUUUA (Stealth RNAi)
This paper; Thermo Fisher
N/A
Control siRNA for YAP siRNA (Stealth RNAi negative control siRNA)
Thermo Fisher
Cat#12935300
Oligonucleotides
siRNA targeting WWTR1 (Silencer Select siRNA)
Thermo Fisher
Cat#4392420
Control siRNA for WWTR1 siRNA (Silencer Select negative control siRNA)
Thermo Fisher
Cat#4390843
siRNA targeting LATS1 (MISSION siRNA)
Sigma-Aldrich
Cat#SIHK1041
siRNA targeting LATS2: CUACUCGCCAUACGCCUUUdTdT (MISSION siRNA)
This paper; Sigma-Aldrich
N/A
Control siRNA for LATS1 and LATS2 siRNAs (MISSION siRNA negative control)
Sigma-Aldrich
Cat#SIC001
siRNA targeting AMOT (SMARTpool)
Dharmacon
Cat#E-015417
siRNA targeting AMOTL1 (SMARTpool)
Dharmacon
Cat# E-017595
siRNA targeting AMOTL2 (SMARTpool)
Dharmacon
Cat#E-013232
Control siRNA for AMOTs siRNAs (Non-target control SMARTpool)
Dharmacon
Cat#D-001910
Recombinant DNA RCIscript-GoldyTALEN vector
Addgene
Cat#38142
UAS:EGFP-Yap1-5SA plasmid
Chiba et al., 2016
N/A (Continued on next page)
e2 Developmental Cell 40, 523–536.e1–e6, March 27, 2017
Continued REAGENT or RESOURCE
SOURCE
IDENTIFIER
FV10-ASW4.2 viewer
Olympus
http://www.olympus-lifescience.com/ en/downloads/
IMARIS 8.4.1
Bitplane AG
http://www.bitplane.com/imaris/imaris
DP2-BSW
Olympus
http://www.olympus-lifescience.com/ en/support/downloads/dp2-bsw_ ver0201_step/
MetaMorph 7.8.0.0
Molecular Devices
https://www.moleculardevices.com/ systems/metamorph-research-imaging
GraphPad Prism 5
GraphPad
https://www.graphpad.com/scientificsoftware/prism/E
Software and Algorithms
CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents can be directed to and will be fulfilled by the Lead Contact, Naoki Mochizuki ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Zebrafish Zebrafish (Danio rerio) were maintained and bred under standard conditions. Embryos and larvae were staged by hpf or dpf at 28oC. The experiments using zebrafish were approved by the animal committee of the National Cerebral and Cardiovascular Center (No. 14005 and No. 15010) and performed according to our institutional regulation. Cell Culture HPAECs (Lonza) and HUVECs (Thermo Fisher) were cultured on 1% gelatin-coated dish in endothelial cell growth medium (EGM-2, Lonza) and used for the experiment before passage 9. The cells were maintained in 5% CO2 at 37oC. METHOD DETAILS Plasmids cDNA fragments encoding human YAP and angiomotin (AMOT) were amplified by PCR and subcloned into pEGFP-C1 vectors (Takara Bio Inc.) to generate the expression plasmids. Then, EGFP-YAP cDNA was subcloned into the pTol2-fli1 vector (Kwon et al., 2013) to generate the pTol2-fli1:EGFP-YAP plasmid. Human TEAD2 lacking amino-terminus (1-113 a.a.) fused with Gal4 DNA binding domain followed by 2A mCherry (Fukui et al., 2014) was also subcloned into the pTol2-fli1 vector to generate the pTol2-fli1:Gal4db-TEAD2DN-2A-mC. UAS:EGFP-Yap1-5SA plasmid, in which Ser21, Ser69, Ser87, Ser119, and Ser335 of zebrafish Yap1, are all replaced with Ala, was used (Chiba et al., 2016). Transgenic Zebrafish Lines To generate Tg(fli1:EGFP-YAP)ncv35 and Tg(fli1:Gal4db-TEAD2DN-2A-mC)ncv36 zebrafish lines, the corresponding Tol2-based plasmid DNA (25 pg) was microinjected along with Tol2 transposase mRNA (25 pg) into one-cell stage embryos of AB zebrafish. Tol2 transposase mRNAs were in vitro transcribed with SP6 RNA polymerase from NotI-linearised pCS-TP vector using the mMESSAGE mMACHINE kit (Thermo Fisher). The embryos were raised to adulthood and crossed with wild-type AB to identify germline transmitting founder fishes. Throughout the text, all Tg lines used in this study are simply described without their line numbers. For example, Tg(fli1:EGFP-YAP)ncv35 is abbreviated to Tg(fli1:EGFP-YAP). Image Acquisition, Processing, and Quantification Using Microscopes The zebrafish embryos were mounted in 1% low-melting agarose poured on a 35-mm-diameter glass-base dish (Asahi Techno Glass), as previously described (Kwon et al., 2013). Confocal images were taken with a FluoView FV1000 or FV1200 confocal upright microscope system (Olympus) equipped with water-immersion XLUMPlan FL N 20x/1.00 NA and LUMPlanFL N 40x/0.80 NA objective lenses (Olympus) and a multi-alkali or GaAsP photomultiplier tube regulated with FluoView ASW software (Olympus). The 405 nm, 473 nm, 559 nm, and 635 nm laser lines were used. Images were acquired sequentially to avoid cross-detection of the fluorescent signals. Two-photon images were taken with a FluoView FV1000MPE multiphoton upright microscope system (Olympus) equipped with a water immersion XLPlan N 25x/1.05 NA objective lens (Olympus) with 920 or 950 nm excitation wavelength. Image files were processed and analyzed with FV10-ASW4.2 viewer (Olympus) and IMARIS 8.4.1 software (Bitplane AG). Stereomicroscopic images Developmental Cell 40, 523–536.e1–e6, March 27, 2017 e3
were taken with a SZX16 stereomicroscope with DP2-BSW software (Olympus). Super-resolution fluorescence images were taken with a SD-OSR microscope system (Olympus) equipped with silicone-immersion UPLSAPO100XS100x/1.35 NA objective lens, a CSU-W1 scan unit (Yokogawa), and an ORCA-Flash 4.0 CMOS camera (Hamamatsu). The microscope and image acquisition were controlled by MetaMorph software (Molecular Devices). The 488 nm and 561 nm laser lines were used. After taking a confocal image in a wider field using this system, a part of the field was rescanned to acquire a super-resolution image, as shown in Figure 6C. High-speed movie images of zebrafish blood flow were taken at 590 frames per second (fps) with cell motion system SI8000 (Sony). Just before the imaging, 1 mm beads were injected into the heart of zebrafish larvae. Images were acquired with SI8000 View Software (Sony) and analyzed with SI8000R Analyzer Software (Sony). Microinjections of Morpholino Oligonucleotides (MOs) For MO-mediated knockdown, embryos were injected at one-cell or two-cell stage with control MO (Gene Tools), 1.2 ng of lats1 translation blocking MO, 1.2 ng of lats2 translation blocking MO, 2 ng of cardiac troponin T type 2a (tnnt2a) translation blocking MO. lats1 MO and lats2 MO have previously been validated (Chen et al., 2009). Knockout Fish by Transcription Activator-like Effector Nuclease (TALEN) TALENs targeting yap1 (Figure S1B) and wwtr1 (Figure S1D) were designed using TAL Effector Nucleotide Targeter 2.0 (https:// tale-nt.cac.cornell.edu/node/add/talen-old) and were assembled via the Golden Gate method (Cermak et al., 2011). TALEN repeat variable di-residues (RVDs) were cloned into an RCIscript-GoldyTALEN vector (Addgene). yap1 and wwtr1 TALEN mRNAs were in vitro transcribed from SacI-linearized expression plasmids with T3 RNA polymerase using a mMessage mMachine mRNA kit (Thermo Fisher). Embryos, injected with 30-60 pg of the TALEN mRNAs at one-cell stage, were raised to adulthood and crossed with wild-type AB to identify germline-mutated founders. Screening for founders was conducted by genomic PCR and subsequent sequencing using the following primer sets: 5’- TCCTTCGCAAGGCTTGGATAATTG -3’ and 5’- TTGTCTGGAGTGGGACTTTGGCTC -3’ for yap1; 5’- GGACGAAAAACAGGAAAAGTTC -3’ and 5’- ACTGCGGCATATCCTTGTTC -3’ for wwtr1. By sequencing the PCR products, we identified the yap1ncv101 allele harboring a 25 nucleotide (nt) deletion in the first exon (Figure S1B), and the wwtr1ncv114 allele harboring an 8 nt deletion in the first exon (Figure S1D). For the genotyping of the mutants, PCR analyses of genomic DNAs were routinely performed using the same primer set (see Figure S1C for yap1ncv101 mutants). Phenotypic Analyses of yap1ncv101, wwtr1ncv114, and amotl2afu45 Mutants To analyze the phenotype of yap1ncv101 and wwtr1ncv114 mutants, fixed or living zebrafish were observed. In Figures 7A, S7B, and S7C, embryos or larvae derived from heterozygous yap1ncv101 carriers were fixed with PBS containing 4% paraformaldehyde (PFA) over-night at 4 oC; their tails were removed with dissecting scissors and used for genomic DNA isolation and genotype analysis. Genotypically identified WT and homozygous yap1ncv101 mutants were then observed using confocal microscopy. In the other figures, genotype analyses were performed after observing living embryos or larvae. For the analyses of amotl2afu45 mutant zebrafish (Agarwala et al., 2015), embryos from incrosses of heterozygous amotl2afu45 mutants were observed using confocal microscopy and genotyped by genomic PCR and subsequent sequencing of the PCR products using the following primer set: 5’- CAAGCACCTCGTCACAATG -3’ and 5’- CACTGTAGCTGTCCACTTCTC -3’. FACS Tg(fli1:EGFP) and Tg(huC:GFP) embryos at 2 dpf were digested by incubating with 5 mg/ml trypsin in PBS as previously described (Kwon et al., 2013). The dissociated cells were sorted by a FACS Aria III Cell Sorter (BD Bioscience) according to GFP fluorescence. The GFP-positive cells sorted by FACS were subjected to qPCR analyses. RT-PCR and Quantitative Real-Time PCR (qPCR) Analyses Total RNAs from zebrafish whole embryos, EGFP-positive ECs isolated from the Tg(fli1:EGFP) embryos, and GFP-positive pan neurons isolated from Tg(huC:GFP) embryos were purified using NucleoSpin RNA XS kit (Macherey-Nagel) following the manufacturer’s instruction. Total RNAs from HPAECs were purified using TRIzol reagent (Thermo Fisher) following the manufacturer’s instruction. For RT-PCR analyses, total RNA from HPAECs was reverse-transcribed by random hexamer primers using Superscript III (Thermo Fisher) according to the manufacturer’s instruction. PCR was performed using the gene-specific primers as listed in Table S1. For qPCR analyses, reverse transcription and PCR were performed with QuantiFast SYBR Green RT-PCR kit (Qiagen) in Mastercycler Realplex (Eppendorf) using the gene-specific primers as listed in Table S1. The qPCR results were normalized to ef1a expression in zebrafish samples and to HPRT1 expression in HPAECs. Transfection, Shear Stress, and siRNA-Mediated Protein Knockdown HPAECs were transfected with plasmid DNA using ViaFect transfection reagent (Promega). After 6-12 h of transfection, the cells were replated to a 1% gelatin-coated glass plate, cultured for additional 24-48 h, and used for the shear stress experiments.
e4 Developmental Cell 40, 523–536.e1–e6, March 27, 2017
We performed shear stress experiments in high cell density (1000-1500 cells/mm2). We simultaneously split the same number of HPAECs to keep the equal cell density between static and sheared conditions in every experiment. Even at high cell density, HPAECs did not always become homogeneously confluent. Therefore, we observed cells at the region where cell density was relatively higher than the periphery, in order to minimize variations in cell density. A parallel plate-type apparatus was used to apply laminar shear stress to HPAECs (Yamamoto et al., 2007). Briefly, one side of the flow chamber consisted of a 1% gelatin-coated glass plate, on which the cultured HPAECs rested, and the other side consisted of a polycarbonate plate. Their flat surfaces were held 200 mm apart with a Teflon gasket. The chamber was provided with an entrance and an exit for the fluid, and the entrance was connected to an upper reservoir with a silicone tube. The exit was open to a lower reservoir. The flow was driven by a roller/tube pump. The fluid (endothelial cell growth medium) passed from the upper reservoir through the flow chamber into the lower reservoir. Experiments were performed at 37oC with 5% CO2 in an incubator. The intensity of the shear stress (t, dynes/cm2) acting on the EC layer was calculated by using the formula t = 6mQ/a2b, where m is the viscosity of the perfusate (poise), Q is the flow volume (ml/s), and a and b are the cross-sectional dimensions of the flow path (cm). siRNAs targeting the genes indicated were purchased as follows: WWTR1 (TAZ) (Silencer Select siRNA, 4392420), negative control siRNA (Silencer Select siRNA, 4392420), YAP (Stealth RNAi, 5’- CCAUGACUCAGGAUGGAGAAAUUUA -3’), and negative control siRNA (Stealth RNAi, 12935300) from Thermo Fisher; LATS1 (MISSION siRNA, SIHK1041) (Feng et al., 2014), LATS2 (MISSION siRNA, 5’- CUACUCGCCAUACGCCUUUdTdT -3’), and negative control siRNA (MISSION siRNA, SIC001) from SigmaAldrich; AMOT (SMARTpool, E-015417) (Feng et al., 2014; Mana-Capelli et al., 2014), AMOTL1 (SMARTpool, E-017595) (Feng et al., 2014; Mana-Capelli et al., 2014), AMOTL2 (SMARTpool, E-013232)(Feng et al., 2014; Mana-Capelli et al., 2014), and negative control siRNA (SMARTpool, D-001910) from Dharmacon. HPAECs were transfected using Lipofectamine RNAi MAX reagent (Thermo Fisher) according to manufacturer’s instructions, using 15 nM of YAP siRNA, 12.5 nM of TAZ siRNA, 20 nM of LATS1 siRNA, 10 nM of LATS2 siRNA, 20 nM of AMOT siRNA, 4 nM of AMOTL1 siRNA, and 20 nM of AMOTL2 siRNA. For shear stress experiments, the cells were replated to a 1% gelatin-coated glass plate after 6-12 h of transfection, cultured for additional 48-72 h, and used for the experiments. Immunofluorescence HPAECs cultured on gelatin-coated 35-mm glass-base dish (Asahi Techno Glass) and glass plate were fixed with 1 or 4% PFA in PBS for 10 min at RT. The fixed cells were then permeabilized with 0.2% Triton X-100 in PBS for 10 min and blocked with 3% BSA in PBS for 30 min at RT. Thereafter, the cells were incubated with the indicated antibodies in 3% BSA in PBS for 1.5 h at 37oC. Protein reacting with antibody was visualized with species-matched Alexa Fluor 488- or Alexa Fluor 546-labeled secondary antibodies (1:200, Thermo Fisher). To visualize F-actin and cell nuclei, the cells were stained with Alexa Fluor 633 phalloidin (1:300) and DAPI (1:500), respectively. Fluorescence images were taken with a confocal microscope (FluoView FV1000, Olympus) equipped with water-immersion XLUMPlan FL N 20x/1.00 NA and LUMPlanFL N 40x/0.80 NA objective lenses (Olympus). Immunoprecipitation and Western Blot Analysis HPAECs were washed with ice-cold PBS, lysed at 4 oC in lysis buffer containing 1% Nonidet P-40, 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 3 mM EDTA , 2 mM dithiothreitol, 1 mM Na3VO4, and a protease inhibitor cocktail (1:100, Nacalai Tesque) and centrifuged at 20,000 x g for 15 min. For immunoprecipitation, the supernatants were incubated with mouse or rabbit anti-YAP antibody for 1 h at 4 oC, followed by incubation with protein A–Sepharose beads (Sigma-Aldrich) for 1.5 h. The precipitates were then washed three times with wash buffer containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 2 mM dithiothreitol. The immunoprecipitates and aliquots of total cellular lysates were subjected to Western blot analysis with the indicated antibodies. Chemiluminescence signals were detected using ImageQuant LAS 4000 mini (GE Healthcare) and quantified using ImageQuant TL software (GE Healthcare). After removing chorionic membrane and yolk sac, wild-type or homozygous yap1ncv101 mutant embryos were directly lysed in 1 x SDS sample buffer and subjected to Western blot analysis with a rabbit anti-YAP antibody (Novus Biologicals) recognizing zebrafish Yap1 and with an anti-b-actin antibody. QUANTIFICATION AND STATISTICAL ANALYSIS Measurements of GFP Intensity in EC-Specific TEAD Reporter To quantify relative GFP intensity of individual ISV in Tg(fli1:Gal4db-TEAD2DN-2A-mC);(UAS:GFP);(fli1:Myr-mC) embryos, 3D-rendered confocal stack fluorescence images of GFP and mCherry in the trunk regions were acquired using confocal microscopy in the same acquisition condition. Individual GFP-expressing ISV was manually cropped using IMARIS 8.4.1 software. Among the cropped area, GFP-positive voxels where GFP fluorescence intensity was above an appropriate threshold were selected as region of interest (ROI). Then, mean fluorescence intensity of GFP and mCherry within the ROI was calculated. Relative GFP intensity was determined in individual ISV by dividing the mean GFP fluorescence intensity by the mean mCherry fluorescence intensity.
Developmental Cell 40, 523–536.e1–e6, March 27, 2017 e5
Measurements of Nuclear/Cytoplasmic Ratio of YAP Quantification of nuclear/cytoplasmic ratio of YAP in individual EC was performed with MetaMorph software (Molecular Devices) by analyzing single confocal slices taken within the central region of the cells stained with anti-YAP antibody (Alexa Fluor 488) and DAPI. We defined a region of interest (ROI) kept at constant size (7-10 mm in diameter) both in the nucleus and in the cytoplasm and measured the mean fluorescence intensity of YAP staining within the ROI. We then calculated the intensity ratio after subtracting the background from both the nuclear and cytoplasmic intensities. Fluorescence intensities of F-actin and VE-cadherin were measured on the fluorescence images of the cells stained with Alexa Fluor 633 phalloidin (F-actin) and anti-VE-cadherin antibody (Alexa Fluor 546) using the line scan function in MetaMorph software (Molecular Devices). Statistical Analysis Data were analyzed using GraphPad Prism software or Excel and were presented as mean ± s.d. Sample numbers and experimental repeats were indicated in figure legends. Statistical significance for paired samples was determined using Student’s t test. Data were considered statistically significant if P < 0.05.
e6 Developmental Cell 40, 523–536.e1–e6, March 27, 2017