Food deprivation stimulates the luteolytic capacity in the gilt

Domestic Animal Endocrinology 33 (2007) 281–293

Food deprivation stimulates the luteolytic capacity in the gilt Giovanna Galeati ∗ , Monica Forni, Nadia Govoni, Marcella Spinaci, Augusta Zannoni, Marco De Ambrogi, Sara Volpe, Eraldo Seren, Carlo Tamanini Dipartimento di Morfofisiologia Veterinaria e Produzioni Animali (DIMORFIPA), Universit`a di Bologna, Via Tolara di Sopra 50, 40064 Ozzano Emilia (BO), Italy Received 16 January 2006; received in revised form 19 June 2006; accepted 19 June 2006

Abstract The aims of this study were to study the effects of fasting on progesterone (P4) production in the pig and to verify whether fasting influences luteal expression of PGF2␣ receptor (FPr) and prostaglandin secretion. Superovulated prepubertal gilts were used; half of them were fasted for 72 h starting on day 2 (F2) or 9 (F9) of the induced estrous cycle, respectively, while two groups (C2 and C9) served as respective controls. Plasma P4 and PGFM concentrations were determined by RIA while FPr mRNA expression in CLs collected at the end of fasting period was measured by real-time PCR. In experiment 1, plasma P4 concentrations in fasted gilts were significantly (P < 0.01) higher than in controls starting from day 3 (F2; n = 6) and 10 (F9; n = 6). FPr mRNA expression was similar in F2 and C2 (n = 6) CLs while it was significantly (P < 0.05) higher in F9 than in C9 (n = 6) CLs. In experiment 2, cloprostenol administered on day 12 significantly (P < 0.05) increased FPr mRNA expression in CLs from both F9 (n = 6) and C9 (n = 6) gilts. At the time of cloprostenol injection PGFM levels were significantly higher (P < 0.05) in the fasted group and cloprostenol-induced luteolysis in fasted but not in normally fed gilts. Results from this study indicate that fasting in prepubertal gilts induced to ovulate stimulates luteal P4 and PGFM production as well as FPr mRNA expression, thus increasing luteolytic susceptibility. © 2006 Elsevier Inc. All rights reserved. Keywords: Fasting; Gilt; Luteolysis; Prostaglandin; Progesterone

∗

Corresponding author. Tel.: +39 051 2097910; fax: +39 051 2097899. E-mail address: [email protected] (G. Galeati).

0739-7240/$ – see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.domaniend.2006.06.003

282

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

1. Introduction Nutrition is one of the main factors affecting reproductive efficiency, particularly in the female. Food deprivation suppresses both ovulation and estrous behaviour in several species [1]. In sows, for example, an inadequate nutritional intake may influence reproductive performance in many ways: it may delay the attainment of puberty and the return to estrus after weaning, decrease ovulation rate and adversely affect embryo survival [2–5]. These effects may be mediated through reproductive hormones, which influence follicular development, ovulation and corpus luteum (CL) lifespan. Corpus luteum persistence is essential for the maintenance of pregnancy through progesterone (P4) production. In fact, food deprivation during early pregnancy results in a tendency for lower embryo survival [2]. The exact mechanism responsible for the impairment of the luteal function after feed deprivation is still unclear. Serum P4 concentrations can be affected by alimentation, but data about the relationship between feed restriction and serum P4 concentrations in the pig are controversial. In fact, while Mwanza et al. [6] and Razdan et al. [7] did not observe any significant difference in serum P4 concentrations among fasted and control sows, some authors found that fasting around luteolysis [8], implantation [9] and during the post-ovulatory period [10] increased circulating P4. The fasting-induced rise in serum P4 concentrations may be due either to an alteration of its metabolic clearance rate (P4 increased in fasted ovariectomized ewes provided with an exogenous source of the hormone; [11]) or to a higher secretion rate. In fact, we recently demonstrated that fasting in gilts stimulated both luteal [12] and follicular [13] P4 production. Food deprivation in prepubertal gilts and in pregnant sows also induced an increase in plasma concentrations of cortisol and prostaglandin F2␣ metabolite [2,6,10]. Both CL lifespan and function are regulated by a complex interaction between stimulatory (luteotrophic) and inhibitory (luteolytic) mediators [14–16]. Prostaglandin F2␣ (PGF2␣ ) acts as the luteolysin in most mammals. Many studies have demonstrated that luteolytic PGF2␣ is of uterine/endometrial origin in cyclic sheep, cattle, pigs, horses and guinea pigs [16]. Endometrial PGs reach the CL(s) by local, systemic, or a combination of both mechanisms, depending on the species. On the contrary, in primates luteolytic PGF2␣ is not of uterine origin: in these species, both autocrine and paracrine effects of luteal PGs may be involved in the control of CL lifespan and function [17]. Luteal regression proceeds in two steps: the decrease in P4 secretion is considered as functional luteolysis, while luteal involution is described as structural [16,18]. In contrast to ruminant CL, which becomes sensitive to PGF2␣ by days 5–6 of the estrous cycle [19,20], pig CLs do not undergo regression in response to a single dose of PGF2␣ until day 12 of the estrous cycle [21]; in addition, their susceptibility to exogenous PGF2␣ is influenced by the type of estrous cycle, being higher in induced than in spontaneous CLs [22]. The mechanisms responsible for the acquisition of the luteolytic susceptibility have not been fully clarified yet. Pig luteal receptors for PGF2␣ (FPr) increase from day 4 to days 13–15 of the estrous cycle, with the highest expression on day 13 [23] concurrently with the onset of luteal sensitivity to PGF2␣ [24,25]. Recently, Diaz and Wiltbank [26] demonstrated that, in the pig, PGF2␣ induced an up-regulation of estradiol biosynthesis as well as an increase of estrogen receptor-ß expression in CLs with luteolytic capacity.

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

283

On the basis of all these observations, this study was designed to verify whether or not the effect of fasting on P4 production in the pig is different depending on the phase of an induced estrous cycle. A second aim was to determine whether fasting influences CL FPr mRNA expression and prostaglandin secretion thus modulating the luteolytic capacity. Furthermore, we wanted to compare fasted to normally fed gilts regarding CL susceptibility to exogenous prostaglandins. 2. Materials and methods 2.1. Experimental animals and hormonal stimulation protocols A total of 36 Large White prepubertal gilts, with an average weight of 98 ± 1.67 kg (mean ± S.E.M.) and 160–170 days of age were used; gilts were considered prepuberal because puberty normally occurs around 210 days of age in this breeding herd. The animals were housed in individual crates and exposed to a constant temperature (22 ◦ C) and artificial photoperiod (12-h light/12-h dark). Pigs were fed 2.8 kg (split between 07:00 a.m. and 03:00 p.m.) of a corn/soybean meal ration (14% crude protein, 2848 kcal/kg metabolizable energy) supplemented with vitamins and minerals, according to the National Research Council guidelines [27]. Water was freely available. The animals were injected i.m. with 1250 IU equine chorionic gonadotropin (eCG; Folligon, Intervet, Holland) and 750 IU hCG (Corulon, Intervet) 60 h later. This treatment generally induces ovulation about 44 h after hCG administration (this time is designed as day 0). Animals were allocated randomly to one of the following groups: F2 (n = 6), C2 (n = 6), F9 (n = 12) and C9 (n = 12). F2 and F9 animals were fasted for 72 h starting after the morning meal on day 2 and 9, respectively, while groups C2 and C9 served as respective controls. The day before the starting of blood collection, pigs were fitted with an indwelling jugular catheter (Vygon, Ecouen, France) under general anaesthesia. Animals were pre-anesthetized by an injection of azaperone (240 mg/gilt; Stresnil, Janssen, Belgium) and atropine sodium salt (2 mg/gilt; Industria Galenica Senese, Italy), and maintained under thiopental sodium (1.5 g/gilt; Pentothal Sodium, Gellini, LT, Italy). Catheters were rinsed daily with physiological saline containing sodium heparin (190 IU/ml; Eparina Vister, Pfizer, LT, Italy) and antibiotics. Blood samples were collected into heparinized tubes and centrifuged at 1500 × g for 15 min. The plasma obtained was stored at −20 ◦ C until P4 and 15-keto-13,14-dihydro-PGF2␣ (prostaglandin F2␣ metabolite, PGFM) determination. All animals were housed and handled according to EEC animal care guidelines. The experimental procedures had previously been submitted to and approved by the Ethical Committee of Bologna University. 2.2. Experiment 1 Blood samples were collected for 3 h (09:00–12:00) at 30 min intervals from all the gilts of groups C2 (n = 6) and F2 (n = 6) on days 2, 3, 4 and 5 and from 6 animals of both group C9 and F9 on days 9, 10, 11 and 12. In order to determine the possible effect of fasting on CL expression of FPr, the animals were ovariectomized immediately after collection of the last blood samples on day 5 (groups

284

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

C2 and F2) and day 12 (groups C9 and F9), respectively. The animals were anesthetized as described above. Ovaries were transported within 30 min to the laboratory where single CLs were isolated. Total RNA was isolated from 10 CLs/gilt with the Tri-Pure isolation reagent, according to the manufacturer’s instructions (Roche Diagnostic GmBH, Mannheim, Germany) and stored at −80 ◦ C until FPr mRNA levels were determined. 2.3. Experiment 2 In order to verify whether or not the effect of PGF2␣ on luteal FPr expression is influenced by fasting, the remaining 6 animals of group C9 and F9 were injected i.m. with cloprostenol (75 ␮g/gilt), a synthetic analog of PGF2␣ (Dalmazin, Fatro, Italy) on day 12 (at 12:00 a.m.). These animals were ovariectomized 12 h after the luteolytic stimulus and CLs were removed and treated as in experiment 2. Blood samples from these animals were collected for 3 h (09:00–12:00) at 30 min intervals on days 10, 11 and 12 for PGFM determination; blood samples were also withdrawn 48 and 24 h before cloprostenol injection and hourly 3 h before to 12 h after cloprostenol administration. The last blood sample was collected just before ovariectomy. 2.4. Progesterone assay Plasma P4 concentration was determined by a validated radioimmunoassay as described previously [28]. The sensitivity was 2.2 pg/tube, and the intra- and inter-assay coefficients of variation were 5.7 and 10.5%, respectively. 2.5. PGFM determination Plasma PGFM was determined by a validated RIA. In brief, 500 ␮l of plasma sample were acidified with 50 ␮l of formic acid solution (37.8% in water) and then extracted with 5 ml diethyl ether. After centrifugation, ether was collected and dried under a N2 stream. Dried ether extracts were resuspended in 500 ␮l of phosphate buffer and aliquots of 200 ␮l were then assayed. An anti-PGFM goat antiserum, kindly provided by Dr. K.T. Kirton (reference 11560-JCC-140D) was used at a 1:10,000 dilution. The relative cross-reactions of the antibody were 20% with 15-keto-PGF2␣ , and 0.5% with 13,14-dihydro-PGF2␣ . The recovery of tritiated PGFM (13,14-dihydro-15 keto [5,6,8,9,11,12,14(n)-3 H]-PGF2␣ ; 174 Ci/mmol specific activity; Amersham Biosciences, UK) added to plasma samples was 87%. Assay sensitivity was 2.5 pg/tube and the intra- and inter-assay coefficients of variation were 4.5 and 7.0%, respectively. The results are expressed in pg/ml. 2.6. Real-time PCR quantification of FPr mRNA RNA concentration was spectrophotometrically quantified (A260 nm) and its quality was determined by gel electrophoresis on 2% agarose. One microgram of total RNA was reversetranscribed to cDNA using iScript cDNA Synthesis Kit (Bio-RAD Laboratories Inc., CA, USA), in a final volume of 20 ␮l. Transcription reactions without reverse transcriptase were performed to verify absence of DNA contamination.

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

285

Swine primers (FPr and Hypoxanthine phosphoribosyltransferase (HPRT)) were designed to span one intron, to avoid genomic DNA amplification, using the Beacon Designer 2.07 Software (Premier Biosoft International, Palo Alto, CA, USA); FPr (EMBL Acc. No. AY043485) forward: 5 -TCAGCAGCACAGACAAGG-3 , reverse: 5 TTCACAGGCATCCAGATAATC3 and HPRT (Hypoxanthine phosphoribosyltransferaseEMBL Acc. No. AF143818) forward: 5 -GGACAGGACTGAACGGCTTG-3 , reverse: 5 GTAATCCAGCAGGTCAGCAAAG-3 . Expected PCR product length was 151 and 115, respectively. Real-time quantitative PCR was performed in the BioRad iCycler® real time PCR machine using SYBR green I detection. A master-mix of the following reaction components was prepared to the indicated end-concentrations: 0.5 ␮l forward primer (0.2 ␮M), 0.5 ␮l reverse primer (0.2 ␮M), 9 ␮l water and 12.5 ␮l IQ SYBR Green BioRad Supermix (Bio-RAD Laboratories Inc.). 2.5 ␮l of cDNA were added to 22.5 ␮l of the master mix. All samples were assayed in duplicate. The real-time PCR protocol employed was: initial denaturation for 3 min at 95 ◦ C, 40 cycles at 95 ◦ C for 15 s and 60 ◦ C for 30 s, followed by a melting step with a slow heating from 55 to 95 ◦ C with a rate of 0.5 ◦ C/s. Real-time efficiency for each primer set was acquired by amplification of a standardized cDNA dilution series. The specificity of the amplified PCR products was verified by analysis of the melting curve, which is sequence-specific and by agarose gel electrophoresis run. The housekeeping HPRT was used to normalize the amount of RNA and results are expressed as Delta Ct (threshold cycle). 3. Statistical analysis Plasma P4 data from experiment 1 and PGFM data from experiment 2 are presented as mean ± S.E. The experimental data were analysed according to the general linear model by a 2 × 2 factorial analysis of variance: yijk = μ + αi + βj + (αβ)ij + εijk where yijk is the experimental measurement (P4 or PGFM), μ the overall mean, αi and βj represent, respectively, the effect of time and treatment (fasted or normally fed), (αβ)ij the interaction term and εijk is the error term. The statistical significance was, as usual, set at probability values less than 0.05 (P < 0.05). The plasma P4 data were analysed by a split-plot-in-time analysis of variance: y = a × b + error(C) where a and b are the diet and the time and C is the error term determined by the sampling time. The differences between the means were assessed by variance analysis (post hoc “t” test). The statistical analysis was performed with JMP (SAS Institute Inc.) and R (R Development Core Team). Data on FPr mRNA expression are presented as mean ± S.E.M. The variations of mRNA expression of the target genes were subjected to a two-way analysis of variance (ANOVA); the significant differences between fasted animals and their respective controls were analyzed by “t” test (JMP—SAS Institute Inc. and R—R Development Core Team). 4. Results 4.1. Experiment 1 Plasma P4 levels in control (C2, C9) and fasted (F2, F9) gilts are shown in Fig. 1. Analysis of variance showed a significant effect of time (P < 0.0001) and treatment (P < 0.0001), as

286

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

Fig. 1. Plasma progesterone concentrations (mean ± S.E. of 7 plasma samples from 6 gilts for each group) in fasted (open bars) and normally fed (shaded bars) gilts in two different periods of the luteal phase (A: early luteal phase; B: mid-luteal phase). Values with different letters indicate significant differences among groups. (A: a vs. b, P < 0.01; b vs. c, P < 0.001. B: a vs. b, P < 0.01; b vs. c, P < 0.01).

well as a significant time × treatment interaction (P < 0.0001). The mean comparisons have been performed by post hoc “t” test. Plasma P4 concentrations remained constant in control animals while they progressively and significantly (P < 0.01) increased in fasted ones. Plasma P4 concentrations in fasted gilts were significantly (P < 0.01) higher than in controls on day 3 (group F2) and 10 (group F9), respectively. A total of 18.0 ± 2.12 and 24.2 ± 3.56 CLs/gilt (mean ± S.E.M.) were isolated from the ovaries of control animals on day 5 (C2 group) and 12 (C9 group), respectively. Fasting did not modify CLs number (19.2 ± 2.24 in F2 versus 24.6 ± 2.20 in F9 group); no significant differences in number of CLs among the treatment groups were observed. FPr mRNA expression in fasted and normally fed animals is shown in Fig. 2A. Analysis of variance showed a significant effect of time (P = 0.038) but not of treatment (P = 0.149); a significant time × treatment interaction (P = 0.034) was also observed. Expression was

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

287

similar in CLs from both groups (fasted and normally fed) on day 5, while the relative amount of FPr mRNA in CLs of day 12 was significantly higher in fasted than in normally fed animals (P < 0.05). In addition, in both groups at day 12, FPr mRNA expression was significantly higher respect to day 5 (P < 0.05). 4.2. Experiment 2 Cloprostenol administered on day 12 significantly (P < 0.05) increased FPr mRNA expression in CLs from both fasted and control animals as compared to not treated gilts (Fig. 2B). Analysis of variance showed a significant effect of PGF treatment (P = 0.001) and fasting (P = 0.029), but not a significant PGF × fasting interaction (P = 0.294). Plasma P4 concentrations remained unchanged after cloprostenol treatment in control animals while significantly decreasing (P < 0.05) in fasted gilts starting 2 h after cloprostenol

Fig. 2. (A) Effects of 3 days of fasting in two different periods of the luteal phase on FPr mRNA expression (control, n = 6, shaded bars; fasted, n = 6, open bars). (B) Effects of cloprostenol administration on day 12 on FPr mRNA expression in control (n = 6, shaded bars) and fasted gilts (n = 6, open bars). Data are presented as mean ± S.E.M. Values with different letters indicate significant differences among groups (P < 0.05).

288

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

Fig. 3. Plasma progesterone concentrations (mean ± S.E.) before and after cloprostenol (arrow, time 0) treatment in control (n = 6, shaded bars) and fasted (n = 6, open bars) gilts. Asterisks indicate significant differences (* P < 0.05 and ** P < 0.01 vs. the mean of 4 samples preceding cloprostenol administration).

administration (Fig. 3). Fig. 4 shows the changes in plasma PGFM in fasted and control gilts. Analysis of variance showed a significant effect of time (P < 0.0001) and treatment (P < 0.0001), as well as a significant time × treatment interaction (P < 0.0001). The same analysis has been utilized for the means comparison. No significant differences were observed on day 10 while the levels were significantly higher (P < 0.05) in the fasted group than in the control on days 11 and 12.

Fig. 4. Plasma PGFM concentrations (mean ± S.E. of 7 plasma samples from 6 gilts for each group) in fasted (open bars) and normally fed (shaded bars) gilts. Values with different letters indicate significant differences (a vs. b, P < 0.05; a and b vs. c, P < 0.001).

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

289

5. Discussion This study was designed to elucidate the effects of fasting during different luteal phases on P4 production as well as on CL expression of PGF2␣ receptor mRNA to test the hypothesis that CLs in fasted gilts are more sensitive to the luteolytic stimulus compared to that of normally fed ones. It should, however, be considered that in our experimental model all the gilts were induced to ovulate and spontaneously cycling gilts and sows could give different results. In fact, as already mentioned [22], induced CLs were more susceptible to luteolysin than spontaneous ones. In addition, induced CLs exhibited both a lower response to stimulators of P4 synthesis [29] and a lower concentration of LH receptors [30] than spontaneously formed CLs. Fasting induced an increase in plasma P4 concentrations during both luteal phases tested (days 2–5 and 9–12 of the induced estrous cycle). These results are in agreement with those by others [2,10,31,32] who observed that circulating P4 levels were inversely related to feed intake in the sow. Serum P4 concentrations also increased in response to feed restriction in both sheep [11,33] and cattle [34]. The cause(s) of P4 changes during food deprivation is/are not clear, and several hypotheses have been raised. Kawate et al. [35] suggested that increases in P4 could be stress-dependent as they observed a cortisol-induced increase in P4 secretion by bovine granulosa cells in vitro. A stimulatory effect of glucocorticoids on P4 secretion was also shown in sows treated with dexamethasone during the mid-luteal phase of the estrous cycle [36]; thus adrenal glands might also contribute to P4 elevation during food deprivation. Treatment with ACTH induced an increase in plasma P4 in pregnant gilts [37], pregnant sows [38], ewes [39] and boars [40]. The severe feed restriction we induced may obviously be considered as a potent stressor and may account for high P4 production. However, plasma P4 concentration reflects a balance between luteal synthesis and metabolic clearance by both liver and kidneys. High P4 levels in fasted gilts may be due to either a reduction of the metabolic clearance rate of the steroid [41], or a higher luteal secretion rate [12] or both. This effect may possibly be mediated via endothelin-1 (ET-1) [42,43], as we recently observed that fasting reduced ET-1 system gene expression in pig CL [12]. Similar conclusions have been drawn also in both sheep [11] and cows [44]. Taken together, our and other’s data allow us to hypothesise that plasma P4 concentration might be manipulated by adjusting the feed intake at appropriate times as a management tool, thus influencing the reproductive activity. PGF2␣ receptors have been identified in CL from several species [14] and were distributed on large luteal cells in both ruminants [45–48] and pigs [23–25]. Boonyaprakob et al. [23] demonstrated that FPr expression in pig corpora lutea is higher on days 10, 13 and 15 than on days 4 and 7 of the spontaneous estrous cycle. These results are consistent with those reported in cattle [46] and rabbits [49], confirming that FPr population increases as CL develop and mature; however, no data are available in the literature about the influence of diet on FPr mRNA expression. Our findings demonstrate that CL FPr mRNA expression in both fasted and normally fed animals is low at the beginning of the luteal phase and increases on day 12 with levels significantly higher in fasted than in control animals. These results may account, at least in part, for the different response of control and fasted animals to cloprostenol, which significantly decreased plasma P4 concentrations (leading to luteolysis) in fasted, but

290

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

not in control animals. In addition, we speculate that fasting is effective in advancing CL development, thus advancing CL responsiveness to exogenous prostaglandins. Cloprostenol significantly increased FPr mRNA expression in CLs from both fasted and normally fed animals, thus suggesting a prostaglandin-induced up-regulation of luteal FPr mRNA. This hypothesis agrees well with the data by Olofsson et al. [50] who observed a marked increase of FPr mRNA levels in rat CL 3 h after cloprostenol injection. These results and our findings conflict with those by Lamsa et al. [51], who demonstrated that PGF2␣ infusion in sheep down-regulate a high affinity FP receptor. In pigs, Estill et al. [52] did not observe any modification in PGF binding sites after exogenous prostaglandin treatment during the early luteal phase (day 5 of the estrous cycle). We, therefore, hypothesize that, in this species, exogenous prostaglandins are effective in increasing CL FPr mRNA expression only in mid-late luteal phase and CLs of fasted gilts are more responsive to PGF as a result of a fasting-stimulated FPr expression. The cloprostenol-induced luteolysis in fasted (but not in normally fed) gilts fits well with the high plasma PGFM concentrations observed in these animals. As suggested by others [53,54], the increase in peripheral PGFM concentrations during fasting may possibly be related to a fall in plasma glucose and a rise in triglycerides, phospholipids and free fatty acids, including arachidonic acid (the prostaglandin precursor) which might result in the stimulation of prostaglandin synthesis and, consequently, PGFM formation. One of the most intriguing aspects of luteal PGF2␣ production is that it seems to be stimulated by exogenous prostaglandins. This prostaglandin-induced PGF2␣ increase was demonstrated both in vivo (sheep: [55]; pigs: [56]) and in vitro (pigs: [57]; ewes: [58]). It is, therefore, likely that fasting has been effective not only in increasing luteal FPr mRNA expression, but also prostaglandin secretion (which, in turn, up-regulate FPr), thus amplifying the luteolytic stimulus. Another possible explanation is related to the role of luteal estradiol (E2) in the process of luteolysis, as suggested by Diaz and Wiltbank [26]. We recently demonstrated that fasting-stimulated luteal steroidogenesis as a whole, not only increasing P4 but also E2 and its precursor, testosterone [12]. We do not have any data on E2 from this particular study, but we cannot exclude that its possible increase may be involved in stimulating the luteolytic susceptibility, thus augmenting the responsiveness to exogenous prostaglandins. In conclusion, the results of the present study show that food deprivation is effective in elevating plasma P4 concentration (irrespective of the phase of the estrous cycle), and in stimulating FPr mRNA expression and PGFM production in mid-late luteal phase, thus modulating the luteolytic susceptibility in gilts which were induced to ovulate. Overall, induced CLs from fasted animals exhibit a higher sensitivity to exogenous prostaglandins than those from normally fed ones.

Acknowledgements This work was supported by a MIUR-PRIN grant. The Authors are grateful to Dr. K.T. Kirton (Upjohn Company, Kalamazoo, MI, USA) for kindly providing the anti-PGFM antiserum; they also thank C. Cappannari, D. Matteuzzi and M. Soflai Sohee for their skilful technical assistance.

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

291

References [1] Wade GN, Schneider JE. Metabolic fuels and reproduction in female mammals. Neurosci Biobehav Rev 1992;16:235–72. [2] Tsuma VT, Einarsson S, Madej A, Kindahl H, Lundeheim N. Effect of food deprivation during early pregnancy on endocrine changes in primiparous sows. Anim Reprod Sci 1996;41:267–78. [3] Foxcroft GR. Mechanisms mediating nutritional effects on embryonic survival in pigs. J Reprod Fertil Suppl 1997;52:47–61. [4] Almeida FR, Kirkwood RN, Aherne FX, Foxcroft GR. Consequences of different patterns of feed intake during the estrous cycle in gilts on subsequent fertility. J Anim Sci 2000;78(6):1556–63. [5] Prunier A, Quesnel H. Influence of the nutritional status on ovarian development in female pigs. Anim Reprod Sci 2000;60–61:185–97. [6] Mwanza AM, Englund P, Kindhal H, Lundeheim N, Einarsson S. Effects of post-ovulatory food deprivation on the hormonal profiles, activity of the oviduct and ova transport in sows. Anim Reprod Sci 2000;59(3–4):185–99. [7] Razdan P, Mwanza AM, Kindahl H, Hulten F, Einarsson S. Impact of postovulatory food deprivation on the ova transport, hormonal profiles and metabolic changes in sows. Acta Vet Scand 2001;42(1):45–55. [8] Prunier A, Quesnel H, Quiniou N, LeDenmat M. Influence of dietary intake on plasma progesterone and embryo mortality in gilts. J Rech Porcine Fr 1999;31:17–22. [9] Tsuma VT, Einarsson S, Madej A, Kindahl H, Lundeheim N, Rojkittikhun T. Endocrine changes during group housing of primiparous sows in early pregnancy. Acta Vet Scand 1996;37(4):481–9. [10] Mburu JN, Einarsson S, Kindahl H, Madej A, Rodriguez-Martinez H. Effect of post-ovulatory food deprivation on oviductal sperm concentration, embryo development and hormonal profiles in the pig. Anim Reprod Sci 1998;52(3):221–34. [11] Kiyma Z, Alexander BM, Van Kirk EA, Murdoch WJ, Hallford DM, Moss GE. Effects of feed restriction on reproductive and metabolic hormones in ewes. J Anim Sci 2004;82:2548–57. [12] Galeati G, Forni M, Spinaci M, Zannoni A, Govoni N, Ribeiro LA, et al. Fasting influences steroidogenesis, vascular endothelial growth factor (VEGF) levels and mRNAs expression for VEGF, VEGF receptor type 2 (VEGFR-2), endothelin 1 (ET-1), endothelin receptor type A (ET-A) and endothelin converting enzyme -1 (ECE-1) in newly formed pig corpora lutea. Domest Anim Endocrinol 2005;28:272–84. [13] Galeati G, Spinaci M, Govoni N, Zannoni A, Fantinati P, Seren E, et al. Stimulatory effects of fasting on vascular endothelial growth factor (VEGF) production by growing pig ovarian follicles. Reproduction 2003;126:647–52. [14] Olofsson J, Leung PC. Auto/paracrine role of prostaglandins in corpus luteum function. Mol Cell Endocrinol 1994;100:87–91. [15] Niswender GD, Juengel JL, Silva PJ, Rollyson MK, McIntush EW. Mechanisms controlling the function and life span of the corpus luteum. Physiol Rev 2000;80:1–29. [16] Arosh JA, Banu SK, Chapdelaine P, Madore E, Sirios J, Fortier MA. Prostaglandin biosynthesis, transport, and signaling in corpus luteum: a basis for autoregulation of luteal function. Endocrinology 2004;145(5):2551–60. [17] Wiltbank MC, Ottobre JS. Regulation of intraluteal production of prostaglandins. Reprod Biol Endocrinol 2003;10:1–91. [18] Forni M, Zannoni A, Tamanini C, Bacci ML. Opposite regulation of clusterin and LH receptor in the swine corpus luteum during luteolysis. Reprod Nutr Dev 2003;43(6):517–25. [19] Acritopoulou S, Haresign W. Response of ewes to a single injection of an analogue of PGF2␣ given at different stages of the oestrous cycle. J Reprod Fertil 1980;58:219–21. [20] Beal WE, Milvae RA, Hansel W. Oestrous cycle length and plasma progesterone concentrations following administration of prostaglandin F2␣ early in the bovine oestrous cycle. J Reprod Fertil 1980;59:393–6. [21] Guthrie H, Polge C. Luteal function and oestrus in gilts treated with a synthetic analogue of prostaglandin F2␣ (ICI 79,939) at various times during the oestrous cycle. J Reprod Fertil 1976;48:423–5. [22] Puglisi TA, Rampacek GB, Kraeling RR, Kiser TE. Corpus luteum susceptibility to prostaglandin F2 alpha (PGF2 alpha) luteolysis in hysterectomized prepuberal and mature gilts. Prostaglandins 1979;18: 257–64. [23] Boonyaprakob U, Gadbsy JE, Hedpeth V, Routh P, Almond GW. Cloning of pig prostaglandin F2␣ (FP) receptor cDNA and expression of its mRNA in the corpora lutea. Reproduction 2003;125:53–64.

292

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

[24] Gadsby JE, Balapure AK, Britt JH, Fitz TA. Prostaglandin F2 alpha receptors on enzyme-dissociated pig luteal cells throughout the estrous cycle. Endocrinology 1990;126(2):787–95. [25] Gadsby JE, Lovdal JA, Britt JH, Fitz TA. Prostaglandin F2 alpha receptor concentrations in corpora lutea of cycling, pregnant, and pseudopregnant pigs. Biol Reprod 1993;49(3):604–8. [26] Diaz JF, Wiltbank MC. Acquisition of luteolytic capacity: changes in Prostaglandin F2␣ regulation of steroid hormone receptors and estradiol biosynthesis in pig corpora lutea. Biol Reprod 2004;70:1333–9. [27] National Research Council. Nutrient requirements of swine. 9th ed. Washington, DC: National Academy Press; 1988. [28] Tamanini C, Bono G, Cairoli F, Chiesa F. Endocrine responses induced in anestrous goats by the administration of different hormones after fluoregestone acetate treatment. Anim Reprod Sci 1985;9:357–64. [29] Kineman RD, Rampacek GB, Kraeling RR, Fiorello-Stocks NA, Wilson RL. Comparison of induced corpora lutea from prepuberal gilts and spontaneous corpora lutea from mature gilts: in vitro progesterone production. J Anim Sci 1987;64:526–32. [30] Estienne CE, Rampacek GB, Kraeling RR, Estienne MJ, Barb CR. Luteinizing hormone receptor number and affinity in corpora lutea from prepuberal gilts induced to ovulate and spontaneous corpora lutea of mature gilts. J Anim Sci 1988;66:917–22. [31] Dyck G, Palmer W, Simaraks S. Progesterone and luteinizing hormone concentration in serum of pregnant gilts on different levels of feed consumption. Can J Anim Sci 1980;69:877–84. [32] Miller HM, Foxcroft GR, Squires J, Aherne FX. The effects of feed intake and body fatness on progesterone metabolism in ovariectomized gilts. J Anim Sci 1999;77:3253–61. [33] Parr RA. Nutrition-progesterone interactions during early pregnancy in sheep. Reprod Fertil Dev 1992;4(3):297–300. [34] Rabiee AR, Macmillan KL, Schwarzenberger F. The effect of level of feed intake on progesterone clearance rate by measuring faecal progesterone metabolites in grazing dairy cows. Anim Reprod Sci 2001;67(3–4):205–14. [35] Kawate N, Inaba T, Mori J. Effects of cortisol on the amounts of estradiol-l7ß and progesterone secreted and the number of luteinizing hormone receptors in cultured bovine granulosa cells. Anim Reprod Sci 1993;32:15–25. [36] Frautschy SA, Liptrap RM. Anovulation and plasma hormone concentrations after administration of dexamethasone during the middle of the luteal phase in sows undergoing estrous cycles. Am J Vet Res 1988;49:1270–5. [37] Sulong A. Effects of ACTH on plasma concentrations of cortisol and progesterone and on embryonic survival in swine. Diss Abstr Int 1985, 3439-B. [38] Tsuma VT, Einarsson S, Madej A, Forsberg M, Lundeheim N. Plasma levels of progesterone and cortisol after ACTH administration in lactating primiparous sows. Acta Vet Scand 1998;39(1):71–6. [39] Van Lier E, Andersson H, Perez-Clariget R, Forsberg M. Effects of administration of adrenocorticotrophic hormone ACTH on extragonadal progesterone levels in sheep. Reprod Dom Anim 1998;33:55–9. [40] Juniewicz PE, Johnson BH. Ability of cortisol and progesterone to mediate the stimulatory effect of adrenocorticotropic hormone upon testosterone production by the porcine testis. Biol Reprod 1984;30: 134–42. [41] Prime GR, Symonds HW. Influence of the plane of nutrition on portal blood flow and the metabolic clearance rate of progesterone in ovariectomized gilts. J Agric Sci Cambridge 1993;121:389–97. [42] Wuttke W, Deyle B, Luedemann S, Pitzel L. Endothelin-1 (ET-1) release and its gene expression in steroidogenic large luteal cells (LLC) and by luteal fibroblasts (LFB) and the involvement in structural lutelysis of porcine corpora lutea. SSR 2000. Abstract 415. [43] Mamluk R, Levy N, Rueda B, Davis JS, Meidan R. Characterization and regulation of type A endothelin receptor gene expression in bovine luteal cell types. Endocrinology 1999;140(5):2110–6. [44] Skarzynski D, Mlynareczuk J, Kotwica J. Involvement of high-density lipoprotein in stimulatory effect of hormones supporting function of the bovine corpus luteum. Acta Vet Hung 2003;51(1):111–20. [45] Balapure AK, Caicedo IC, Kawada K, Watt DS, Rexroad Jr CE, Fitz TA. Multiple classes of prostaglandin F, binding sites in subpopulations of ovine luteal cells. Biol Reprod 1989;41:385–92. [46] Sakamoto K, Miwa K, Ezashi T, Okuda-Ashitaka E, Okuda K, Houtani T, et al. Expression of mRNA encoding the prostaglandin F2 alpha receptor in bovine corpora lutea throughout the oestrous cycle and pregnancy. J Reprod Fertil 1995;103(1):99–105.

G. Galeati et al. / Domestic Animal Endocrinology 33 (2007) 281–293

293

[47] Graves PE, Pierce KL, Bailey TJ, Rueda BR, Gil DW, Woodward DF, et al. Cloning of a receptor for prostaglandin F2 alpha from the ovine corpus luteum. Endocrinology 1995;136(8):3430–6. [48] Juengel JL, Wiltbank MC, Meberg BM, Niswender GD. Regulation of steady-state concentrations of messenger ribonucleic acid encoding prostaglandin F2 alpha receptor in ovine corpus luteum. Biol Reprod 1996;54(5):1096–102. [49] Boiti C, Zampini D, Zerani M, Guelfi G, Gobbetti A. Prostaglandin receptors and role of G protein-activated pathways on corpora lutea of pseudopregnant rabbit in vitro. J Endocrinol 2001;168:141–51. [50] Olofsson J, Leung CH, Bjurulf E, Ohno T, Selstam G, Peng C, et al. Characterization and regulation of a mRNA encoding the prostaglandin F2alpha receptor in the rat ovary. Mol Cell Endocrinol 1996;123(1):45–52. [51] Lamsa JC, Cushman RA, Nay MG, McCracken JA. In vivo desensitization of a high affinity PGF2 alpha receptor in the ovine corpus luteum. Prostaglandins 1992;43(2):165–79. [52] Estill CT, Britt JH, Gadsby JE. Does increased PGF2 alpha receptor concentration mediate PGF2 alphainduced luteolysis during early diestrus in the pig? Prostaglandins 1995;49:255–67. [53] Holst H, Edqvist LE, Kindahl H. Blood biochemical effects of fasting in gilts. In: Proc. 13th Int. Pig Vet. Soc. Con. 1994. p. 474. [54] Silver M, Fowden AL. Uterine prostaglandin F metabolite production in relation to glucose availability in late pregnancy and a possible influence of diet on time of delivery in the mare. J Reprod Fertil Suppl 1982;32:511–9. [55] Rexroad Jr CE, Guthrie HD. Prostaglandin F2 alpha and progesterone release in vitro by ovine luteal tissue during induced luteolysis. Adv Exp Med Biol 1979;112:639–44. [56] Guthrie HD, Rexroad Jr CE, Bolt DJ. In vitro release of progesterone and prostaglandins F and E by porcine luteal and endometrial tissue during induced luteolysis. Adv Exp Med Biol 1979;112:627–32. [57] Diaz FJ, Crenshaw TD, Wiltbank MC. Prostaglandin F2␣ induces distinct physiological responses in porcine corpora lutea after acquisition of luteolytic capacity. Biol Reprod 2000;63:1504–12. [58] Tsai SJ, Wiltbank MC. Prostaglandin F2␣ induces expression of prostaglandin G/H synthase-2 in the ovine corpus luteum: a potential positive feedback loop during luteolysis. Biol Reprod 1997;57:1016–22.