- Email: [email protected]
Formulation and biological actions of nano-bioglass ceramic particles doped with Calcarea phosphorica for bone tissue engineering
Materials Science & Engineering C xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Materials Science & Engineering C journal homepage: www.elsevier.com/locate/msec
Formulation and biological actions of nano-bioglass ceramic particles doped with Calcarea phosphorica for bone tissue engineering S. Dinesh Kumara, K. Mohamed Abudhahira, N. Selvamuruganc, S. Vimalrajb, R. Murugesana, N. Srinivasana, A. Moorthia,⁎ a b c
Faculty of Allied Health Sciences, Chettinad Academy of Research and Education, Chettinad Health City, Kelambakkam, Tamil Nadu 603 103, India Vascular Biology Laboratory, AUKBC – Research Centre, MIT Campus, Anna University, Chennai, Tamil Nadu 600 043, India Tissue Engineering and Cancer Research Laboratory, Department of Biotechnology, SRM University, Kattankulathur, Tamil Nadu 603 203, India
A R T I C L E I N F O
A B S T R A C T
Keywords: Bioglass ceramics Calcarea phosphorica Sol-gel Bone formation and bone tissue engineering
The improvisation of the treatment procedures for treating the various kind of bone defects such as, bone or dental trauma and for diseases such as osteoporosis, osteomyelitis etc., need the suitable and promising biomaterials with resemblance of bone components. Bioactive glass ceramic (BGC) has recently acquired great attention as the most promising biomaterials; hence it has been widely applied as a filler material for bone tissue regeneration. Because it elicts specific biological responses after implantation in addition more potential in formation of strong interface with both hard and soft tissues by dissolution of calcium and phosphate ions. Hence, the current focus in treating the bone defects by orchestrating the biomaterial in combination of alternative medicine such as homeopathic remedies with biomaterials to prevent the adverse effects at minimal concentrations. So the current study was focused on constructing the nano-bioglass ceramic particles (nBGC) doped with novel homeopathic remedy Calcarea phosphorica for dental and bone therapeutic implants. The nBGC particles were synthesized by sol–gel method and reinforced with commercially available Calcarea phosphorica. The synthesized particles were characterized by SEM, DLS, EDS, FT-IR, and XRD studies. The SEM and DLS were shown the size of the particles at nano scale, also the EDS, and FT-IR investigations indicated that the Calcarea phosphorica was integrated with nBGC particles and also the crystalline nature of particles was confirmed by XRD studies. Both nBGC and Calcarea phosphorica doped nBGC (CP-nBGC) were found to be non toxic to mouse mesenchymal stem cells at lower concentrations and also illustrated the better bone forming ability in vitro.
1. Introduction Since early 1960's ceramics have been largely implicated as bone filler materials owing to their bioactivity, chemical similarity to the inorganic phase of bone and ability of osteo-integration [1]. However, the ceramic materials alone impose poor mechanical strength and faster dissolution rate in vivo. In order to develop a novel biomaterials with good mechanical strength, several materials sciences researchers have focused their attention towards development of Bioactive glass Ceramics (BGC) materials. BGC are a group of non-resorbable, osteoconductive, and prominent biomaterials were first developed by Hench in 1972 [2]. The BGC was widely used as coatings on metallic implants, dental filling materials and as scaffolds for bone tissue engineering due to its excellent bioactivity biocompatibility [3–8]. Also the BGC were particles proven to stimulate the gene expressions of osteoblast cells and angiogenesis process by releasing the Na+, K+, Ca, P, Si4+ ions in
exposure to physiological medium [9,10] and also found to induce formation of carbonated hydroxyapatite layer (HCA) when immersed in a simulated body fluids or SBF [11,12]. BG can be formed either by traditional melt-quenching or by modern sol–gel method but compared to melt-quenching process, sol-gel method widely applied since it requires low temperature for synthesis and promotes more porous structure with high specific surface area [13,14]. Nanomedical approaches for drug delivery, treating diseases or wound healing forms a core on nanoscale particles such as sterocomplexed polymers, hydrogels or similar molecules to improve drug bioavailability [15]. Hence, solgel technology is in the forefront as it delivers high quality BGCs. Taking advantage of this procedure, additives are introduced easily with the objective of improving the bioactivity of bioglasses. In this regard, various ions have been introduced as dopants and tested their efficiency on bone formation. The current study is aimed to synthesize nanobioglass ceramics (nBGC) materials and doping it with Calcarea
⁎ Corresponding author at: Department of Bionanotechnology, Faculty of Allied Health Sciences, Chettinad Hospital and Research Institute, Chettinad Academy of Research and Education, Kelambakkam, Chennai 603 103, India. E-mail address: [email protected] (A. Moorthi).
http://dx.doi.org/10.1016/j.msec.2017.08.077 Received 6 January 2017; Received in revised form 24 July 2017; Accepted 18 August 2017 0928-4931/ © 2017 Published by Elsevier B.V.
Please cite this article as: Dinesh Kumar, S., Materials Science & Engineering C (2017), http://dx.doi.org/10.1016/j.msec.2017.08.077
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
40 kV. The diffraction spectra was recorded at 2θ with a range of 10–70° and scanned at a speed of 2° min− 1. The identification of different phases present in the nBGC and CP-nBGC particles was carried out by Hanawalt method using Philips X-pert high score software. The intensity of the diffracted pattern was calculated by Bragg's law using the formula: nλ = 2dsinθ.
phosphorica/tribasic calcium phosphate (Ca3(PO4)2), a novel homeopathic remedy prescribed for the repair of non-union bone fractures and other bone defects [18]. Calcarea phosphorica, formulated from calcium phosphate dilutions, is one of the homeopathic medicines prescribed for bone disease treatment [16]. Calcarea phosphorica exhibited higher optical density in bone repair area in hypertensive castrated rats [17]. It is a combination of the calcium and phosphates produced by adding dilute phosphoric acid to lime water [19]. Hence, the present study was aimed to design the formulation of nanobioglass ceramic particles (nBGC) doped with CP and determination of their effect on osteoblast differentiation at cellular level in vitro.
2.3. Determination of cytotoxicity of the nBGC and CP-nBGC particles The mouse mesenchymal stem cells (mMSCs) C3H10T1/2 were used to determine the toxic effect of nBGC and CP-nBGC particles. Cytotoxicity study was carried out by following the methodology as previously described [20,21]. MTT [3-(4, 5-Dimethylthiazole-2-yl)-2, 5diphenyl tetrazolium] was used to evaluate cytotoxicity of the nBGC and CP-nBGC materials. Cells were seeded on a 96 well plate with a density of 1000 cells/cm2. Both the nBGC and CP-nBGC particles at different concentrations (0.01, 0.03, 0.05, 0.1, 0.5, and 1 mg/ml) in 200 μl cell culture media were added to the cells. The cells were incubated for the periods of and 48 h. 5 mg of MTT was dissolved in 10 ml of PBS and 100 μl of the MTT solution was added to each well and incubated for 4 h to form formazan crystals by mitochondrial dehydrogenases. After 4 h, the MTT solution was removed from the wells and 100 μl of the solubilisation solution (10% Triton X-100, 0.1 N HCl and isopropanol) was added in each well and incubated at room temperature for 1 h to dissolve the formazan crystals. The optical density of the solution was measured at a wavelength of 570 nm.
2. Materials and methods 2.1. Formulation of nanobioglass ceramics (nBGC) particles and Calcarea phosphorica doped nBGC particles (CP-nBGC) The nBGC particles (SiO2: CaO: P2O5 Mol% ~ 55:40:5) were synthesized via sol–gel method as reported earlier [20]. 7.693 g of calcium nitrate was mixed with 9.84 mL of TEOS (Tetraethyl orthosilicate) and dispersed into the solution of ethanol: water (1:2 ratio) and during this period the pH of the solution was maintained around 2 by the addition of 1 M citric acid the final clear solution obtained was considered as solution A. Followed by separately, 1.078 g of diammonium hydrogen orthophosphate was mixed with 2% of poly ethylene glycol (PEG; Mw 20,000) and the pH was maintained up to 10 by using ammoniated water the resultant solution was considered as solution B. Finally the solutions A and B were refluxed together under stirring conditions and aged for 24 h at room temperature to obtain the white gel precipitate. Then the precipitate was subjected to filtering followed by washed with deionized water, finally dried under vacuum then lyophilized and calcined at 700 °C (1 °C rise per minute) for 6 h to obtain white nBGC particles. The formulation of CP-nBGC was made briefly as follows: commercial grade of Calcarea phosphorica drug was purchased from retail vendor. 1:1 ration of nBGC and Calcarea phosphorica was mixed with water as solvent to prepare 1% w/v of CP-nBGC solution. Then the solution was aged for 24 h under stirring condition and centrifuged at 10,000 rpm for 5 min and washed with distilled water. This step was repeatedly done and pellet was calcinated at 250 °C to obtain fine powder of CP-nBGC particles.
2.4. Cell morphology evaluation and cell proliferation by trypan blue dye exclusion assay The structural and morphological changes with response to CPnBGC were documented as reported earlier [22,23]. Briefly, the mMSCs were grown in the presence of medium conditioned with CP-nBGC for a period of 72 h. Cells grown in normal medium served as a control. After the treatment period the micrograph of the cells were documented under phase contrast microscopy with 20× objective. In order to determine the role of CP-nBGC particles on cell proliferation, we conducted the trypan blue exclusion test as reported earlier [20]. The cells 106 × 2 mMSCs cells was seeded in 6 well plates and treated with 0.1 mg/ml concentration of CP-nBGC particles, after 48 h and 72 h treatment the cells were stained with trypan blue dye and counted manually using haemocytometer.
2.2. Physio-chemical characterization of nBGC and CP-nBGC particles The surface topography, morphology and particle size of the nBGC and CP-nBGC particles were analyzed using scanning electron (SEM) microscopy and Dynamic light scattering (DLS) method. For SEM analysis, the samples were sputter coated onto platinum and the scanning was done at 25 kV and 40 mA under vacuum. The particle size distribution of the nBGC and CP-nBGC particles were determined by using particle size analyzer (Malvern Zeta sizer nanosizer). The fundamental principle of particle size measurement was based on measuring time dependent fluctuation of scattering of laser light by the nBGC and CPnBGC particles. The energy dispersive X-ray spectroscopy (EDS) was performed using JEOL JSM 6490 LA. The nBGC and CP-nBGC particles were dispersed in suitable solvent and subjected for EDS measurements using JEOL-JEM2100F. Samples were placed on carbon tape coated stub and coated with platinum using JEOL JFC 1600 for 2 min at 10 mA. The peaks displayed of the EDS spectrum correspond to the energy levels and referring to an individual element. The inter molecular interaction of the functional groups present in the nBGC and CPnBGC particles were recorded with FT-IR spectrophotometer (American Perkin Elmer Co) using KBr press. The spectra were collected over the range of 4000–450 cm− 1. The spectrogram of the sample was prepared using OPUS software. The XRD patterns of nBGC and CP-nBGC particles were obtained at room temperature using a (Panalytical XPERTPRO powder diffractometer) (CuKα radiation) operating at a voltage of
2.5. Osteoblast differentiation at molecular level by real-time reverse transcriptase polymerase chain reaction analysis The 5 × 105 cells mMSCs was seeded in 6 well culture plates at per well in the presence or absence of 0.1 mg/ml concentration of CP-nBGC particles in normal or osteogenic medium containing 10 mM β-glycerophosphate, 10 nM dexamethasone, and 50 μg/ml ascorbic acid in DMEM at 14 days time periods interval. Total RNA was isolated from mMSCs after treatment using TRIzol reagent (500 μl/well). The concentration of RNA was determined from the OD of the sample measured at 260 nm. cDNA was synthesized using 1 μg of total RNA from each sample. The SYBR reagent (Invitrogen) was used in RT-PCR. The specific oligonucleotide primers were designed as shown in Table 1. The threshold cycle (Ct) value was calculated from the amplification plots. The ΔCt value for each sample was calculated by subtraction of the Ct values of the internal control gene GAPDH. The ΔΔCt and fold change was calculated as previously mentioned [23,24]. 2.6. Osteoblast differentiation at cellular level by alizarin red staining and quantification The differentiation and mineralization of osteoblast will be reflected in the form of calcium deposition. Hence, the differentiations of mMSCs 2
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
days. At the end of the treatment, the cultured cells were washed twice with ice-cold 1 × PBS and fixed with 10% neutral buffered formalin for 1 h and then rehydrated with 1 ml of distilled water for 5 min. The fixed monolayer of cells was then incubated with 1% alizarin red in 2% ethanol (pH 4.2) for 10 min at room temperature. The monolayers were washed multiple times with distilled water. 1 ml of 70% ethanol was added to the monolayer and allowed to stand for 2 min. The monolayer was then covered with a layer of distilled water. Calcified nodules were identified by inverted light microscopy as a bright red colour. Micrographs were taken and the stained wells were quantified using 1 N acetic acid followed by incubation at 80 °C and neutralization with liquid ammonia. The colour was read at 405 nm and results were plotted [23,25].
Table 1 Primer sequences used for real-time RT-PCR analysis. S. No
Gene name
Sequence
1.
Runx2
2. 3.
Alkaline phosphatase (ALP) Type I collagen (Col-I)
4.
Osteocalcin (OC)
5.
GAPDH
Forward - CGCCTCACAAACAACCACAG Reverse - TCACTGTGCTGAAGAGGCTG Forward - TTGTGCCAGAGAAAGAGAGAGA Reverse - GTTTCAGGGCATTTTTCAAGGT Forward - TAACCCCCTCCCCAGCCACAAA Reverse - TTCCTCTTGGCCGTGCGTCA Forward – ATGGCTTGAAGACCGCCTAC Reverse - AGGGCAGAGAGAGAGGACAG Forward - GAGAGACCCCACTTGCTGCCA Reverse - CTCACACTGCCCCTCCCTGGT
2.7. Statistical analysis All the experiments were performed in triplicates and the results were expressed as mean ± S.D. The statistical significance was analyzed by Student's t-test. A “p” value < 0.05 was considered as statistically significant. 3. Results and discussion 3.1. Size and compositional analysis of nBGC and CP-nBGC particles The size of the nBGC and CP-nBGC particles were determined by using DLS analysis. Both the particles were found to be varied sizes, suggesting that the particles were exhibited in heterogeneous population. Also the hydrodynamic diameter of nBGC material was found to be 452 nm with PDI of 0.78 and CP-nBGC particle size was found to be around 1106 nm with PDI of 0.81 (Fig. 1) also the shift in peak indicates increase the size of nBGC particles, which is due to the aggregation of Calcarea phosphorica with nBGC. Also the synthesized particles were subjected to SEM analysis to determine surface morphological characteristics. The nBGC particles (Fig. 2 A & B) shows the presence of silica in glassy phase, the rod like structure, but the addition of CP were shown to exhibit the oriented spherical shaped structure (Fig. 2 C & D). This crystal has been identified as apatite phase by XRD analysis and
Fig. 1. DLS spectra of nBGC and CP-nBGC particles. Hydrodynamic diameter of nBGC was found to be 452 nm with Pdi of 0.78 and CP-nBGC was found to be 1106 nm with Pdi of 0.81. The increase in size indicates aggregation of drug with nBGC material.
into osteoblast were determined by calcium deposition using alizarin red staining. The mMSCs were cultured in the presence or absence of 0.1 mg/ml concentration of CP-nBGC particles in normal or osteogenic medium for 18 days. Fresh medium was replenished once in every three
Fig. 2. SEM images of the nBGC (A & B) and Cp-nBGC (C & D) particles. The nBGC particles were found crystalline in structure (A & B) and CP-nBGC particles were seen in spherical in structure (C & D). The EDS spectra of nBGC and CP-nBGC particles (Fig. 2 E & F). The presence of calcium, silica and phosphorous is evident from the corresponding peaks of EDS spectra.
3
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
Fig. 3. FT-IR spectra of nBGC, Calcarea phosphorica and CP-nBGC particles (A). X-Ray diffraction spectra of nBGC and CP-nBGC particles (B). The decrease in crystallinity indicates the aggregation of bioglass ceramics with Calcarea phosphorica (B).
CP-nBGC particles were shown in (Fig. 3A). Si-O-Si asymmetric stretching mode was visible and assigned to the band shoulder at 1139 cm− 1 and 1116 cm− 1. The band at 870 cm− 1 and 682 cm− 1 in both the particles represents Si-O-Si symmetric stretching mode. Also vibrational bending occurred in the region of 1116 cm− 1 attributed the Si–O–Ca groups. The band near 600 cm− 1 was due to the rocking vibration of the Si–O bond [32]. Stretching vibration of phosphate moieties in the nBGC particles was noticed at 1067 cm− 1. The broad band at 2148 cm− 1 and 2163 cm− 1 is due to stretching vibrations of phosphate groups in Calcarea phosphorica and CP-nBGC [33,34]. PEG was used as a surfactant in the synthesis of nBGC particles, and there were occurrence of the peaks at 1639 cm− 1corresponding to O-H bending vibrational bands of PEG. Similarly bands in 3496 cm− 1 were assigned to C-H stretch of CP-nBGC particles [35]. The vibrational shifts from 670 cm− 1 to 717 cm− 1, 1636 cm− 1 to 1640 cm− 1, 2148 cm− 1 to 2163 cm− 1, and 3430 cm− 1 to 3496 cm− 1 indicates the integration of
found as a spherical shape [26]. At higher magnification, the deposition of calcium ions over the crystalline structure was observed which indicates the aggregation of CP onto the surface of nBGC (Fig. 2 C & D). The spherical morphology of the particles was templated from the micelle structure of PEG, used as a surfactant in sol–gel synthesis of the particles [27]. The elemental percentage of atoms contributing to nBGC particles were determined by EDS. Fig. 2 E & F represents the spectral analysis indicating the presence of key atoms Si, Ca, P, C, O derived from different precursors utilized during the synthesis of these particles. The existence of calcium and silicon is vital in determining the biological action of nBGC particles [28–31].
3.2. Chemical molecular characterization of nBGC and CP-nBGC The intermolecular interactions of the particles were determined by FTIR analysis. The FT-IR analysis of the nBGC, Calcarea phosphorica and 4
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
Fig. 4. Effect of nBGC and CP-nBGC particles on cytotoxicity. C3H10T1/2 cells were treated with respective particles containing medium for a period of 48 h with different concentrations. (A) represent the 48 h MTT assay of nBGC and (B) CP-nBGC respectively. * indicates significant decrease compared to control (p < 0.05).
Fig. 5. Cell morphology and viability assessment by microscopic examination, cells in control (A) and 0.1 mg/ml CP-nBGC treated wells (B) exhibited a well spread morphology. The percentage of cell viability was calculated. ∗indicates significant difference compared to control (p < 0.001) (C).
5
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
Fig. 6. Effect of CP-nBGC particles on mRNA of osteoblast differentiation marker genes mRNA expressions in mMSCs. Real-time analysis was performed using the primers for Runx2, ALP COL-I and OC mRNA expression (A, B, C & D). The fold change of mRNA in CP-nBGC treated conditions was calculated over untreated control samples. GAPDH was used for normalization. Fig. 7. Effect of CP-nBGC particles on mMSCs differentiation and mineralization by alizarin red staining. Representative photographic images at 18 days after fixing the cells are shown (A). Quantification of data is presented above (B). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
6
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
with the activation of osteoblast differentiation marker genes as well as depositions of calcium molecules which promote the extracellular matrix formation. The expression levels of major transcription factor for bone Runx2 and early and late differentiation marker genes ALP, Col-I and OC mRNA expression were upregulated in presence of osteogenic stimulant compared to absence of osteogenic stimulant (Fig. 6 A–D). The earlier report states the stimulation of osteogenic differentiation marker genes as well as calcium deposition was found to be increase with response to the ceramic material in presence of osteogenic stimulants [20,23–25]. Also the osteogenic differentiation determination was carried out with evaluation of calcium deposition by alizarin red staining in response to CP-nBGC treatment with mMSCs cells after 18 days (Fig. 7). The expression of bright red colour is indication for differentiation of osteoblast cells (Fig. 7 A). In addition the deposited calcium molecules were quantified spectrophometrically and graphs were plotted (Fig. 7 B). The increased calcium deposition was seen in response to the CP-nBGC along with the osteogenic stimulant environment (Fig. 7 A). Moreover, the result was reflected in terms of quantification data of the deposited calcium (Fig. 7 B). Hence, it suggests the promotion of osteoblast differentiation of the stem cells requires the osteogenic environment to promote the differentiation of mMSCs. The previous reports associated with glass ceramics are agreed with current report [20,23].
Calcarea phosphorica with nBGC. Hence, the results suggest that the vibrational confirmations of presence of Silica (Si) and Calcium (Ca) as key components of nBGC and integration of Calcarea phosphorica with nBGC confirms the molecular bonding between the drug and ceramics. The XRD pattern of the synthesized nBGC and CP-nBGC particles were shown in Fig. 3 B. After calcination at 700 °C, the XRD pattern illustrates the peaks at definite 2θ values. The 2θ values of the XRD spectra for nBGC were exhibited at 21.88 and the peak for CP-nBGC was found in 19.72. The peaks were also in strong agreement with the Joint Committee for Powder Diffraction Standards (JCPDS). The intensity peak at 2θ of ~21.88° is attributed to the formation of the (CaSiO3) phase (JCPDS # 10-489) and the intensity peak at 19.72° match with the hydroxyapatite [Ca10(PO)4O] phase (JCPDS # 89-6495) [36,37]. Also the distance between the crystal lattice spacing calculated using Bragg‘s equation was found to be 5.03A° and 1.60A° and for nBGC and CP-nBGC respectively. In addition, sharper peak are observed in CPnBGC material, which indicates increase in crystallinity of nBGC by Calcarea phosphorica. 3.3. Biocompatibility of nBGC and CP-nBGC materials Since the particles (nBGC and CP-nBGC) comprises of multiple components, it is expected to be toxic to mammalian cells, and this cytotoxic effect could restrict or limit the usage of these materials for in vivo applications. Thus, the particles were subjected for cytocompatibility with mMSCs. The toxicity was studied by colorimetric quantification for assessing the mitochondrial succinate dehydrogenase activity to convert the MTT to purple colour formazan crystals. This crystalline product is further solubilized by the addition of dimethyl sulfoxide (DMSO) and preceded with OD measurement. Fig. 4 (A & B) depicts the MTT assay for nBGC and CP-nBGC particles. The particles were tested at five different concentrations (0.01, 0.03, 0.05, 0.1, 0.5 and 1 mg/ml) along with control and Triton-X-100 as positive control for 24 and 48 h. The colorimetric measurement depicted upto the concentrations 0.1 mg/ml found to be no remarkable effect in the cell death, but 0.5 and 1 mg/ml concentrations of nBGC and CP-nBGC particles showed a marked decrease in the cell viability. Hence 0.1 mg/ml of particles was chosen as the ideal concentration for further in vitro studies. The presence of increased concentrations of nBGC in the cell culture medium could result in dissolution of calcium and silicon ions from them which lead to an increase in the pH and osmolarity which could be detrimental to cell survival. It is evident that hyperosmolality generates osmotic shock which leads to shrinkage and death of cells [38].
4. Conclusion The current study provides the new approach with biomaterials and homeopathic preparation to strengthen the bone tissue engineering. The synthesized particles exhibited a proliferative and biocompatible effect on mouse mesenchymal stem cells. The natural composition with bone resembling biomaterial provided the osteogenic potential in mMSCs. Hence, the findings in this study provide new insights in the development of novel approach in developing the biomaterials with potential bone formation promoting potentiality furthermore offers the substantial advantages of biomaterials in bone tissue engineering. Further explorations with in vivo studies are needed to provide better application of the material in orthopedic and dental applications. Acknowledgement We thank Chettinad Academy of Research and Education (CARE) management for the financial support. Also we thank Dr. N. Subhapradha, Dr. Shoba Narayan, CARE, Chennai for their technical support. This work was also supported by research grant from Department of Science and Technology, Science and Engineering Research Board (SERB), India to S. Vimalraj (grant no. PDF/2015/ 000133).
3.4. Cell morphology and cell proliferation mediated by CP-nBGC particles The microscopic (Fig. 5 A & B) examination was demonstrated the biocompatibility of 0.1 mg/ml concentration of CP-nBGC particles treatment at 72 h with mMSCs. Cells in both control and CP-nBGC treated were found to be exhibited in well spread morphology, which has been a better indicative of biocompatible environment of the CPnBGC particles to mMSCs. In addition the proliferative capacity was determined by manual counting of proliferative cells, it has shown significant increase in cell number at 72 h treatment with CP-nBGC particles (Fig. 5 C). This may be due to silica and calcium present in the composition would have played vital role in mediating the better cell proliferation [24,25]. Also the proliferation might be mediated by activating the intercellular proliferative mechanism in osteoblast for reconstruction of the defective site of the bone [20,39]. Hence the CPnBGC was shown to promote around 18% of cells towards proliferation (Fig. 5 C).
References [1] S.V. Dorozhkin, Bioceramics of calcium orthophosphates, Biomaterials 31 (2010) 1465–1485. [2] L.L. Hench, H.A. Paschall, Direct chemical bond of bioactive glass-ceramic materials to bone and muscle, J. Biomed. Mater. Res. 7 (1973) 25–42. [3] A. Hoppe, N.S. Guldal, A.R. Boccaccini, A review of the biological response to ionic dissolution products from bioactive glasses and glass-ceramics, Biomaterials 32 (2011) 2757–2774. [4] D.H. Kohn, P. Ducheyne, Materials for bone, joint and cartilage replacement, in: D.F. Williams (Ed.), Medical and Dental Materials, VCH Verlagsgesellschaft, FRG, 1992, pp. 29–109. [5] A. El Ghannam, P. Ducheyne, I.M. Shapiro, Porous bioactive glass and hydroxyapatite ceramic affect bone cell function in vitro along different time lines, J. Biomed. Mater. Res. 36 (1997) 167–180. [6] U. Gross, V. Strunz, The anchoring of glass ceramics of different solubility in the femur of the rat, J. Biomed. Mater. Res. 14 (1980) 607–618. [7] E.A.B. Effah Kaufmann, P. Ducheyne, I.M. Shapiro, Effect of varying physical properties of porous, surface modified bioactive glass 45S5 on osteoblast proliferation and maturation, J. Biomed. Mater. Res. 52 (2001) 783–796. [8] T. Nakamura, T. Yamamuro, S. Higashi, A new glass-ceramic for bone replacement: evaluation of its bonding to bone tissue, J. Biomed. Mater. Res. 19 (1985) 685–698.
3.5. Osteoblast differentiation mediated by CP-nBGC at molecular and cellular levels The osteoblast differentiation and mineralization will be reflected 7
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
[24] A. Moorthi, S. Vimalraj, C. Avani, Z. He, N.C. Partridge, N. Selvamurugan, Expression of microRNA-30c and its target genes in human osteoblastic cells by nano- bioglass ceramic-treatment, Int. J. Biol. Macromol. 56 (2013) 181–185. [25] R. Niranjan, C. Koushik, S. Saravanan, A. Moorthi, M. Vairamani, N. Selvamurugan, A novel injectable temperature-sensitive zinc doped chitosan/β-glycerophosphate hydrogel for bone tissue engineering, Int. J. Biol. Macromol. 54 (2013) 24–29. [26] T. Kokubo, T. Nakamura, F. Miyaji, Bioceramics, 1st Edition, 9 (1996), pp. 89–92. [27] N. Saranya, S. Saravanan, A. Moorthi, B. Ramyakrishna, N. Selvamurugan, Enhanced osteoblast adhesion on polymeric nano-scaffolds for bone tissue engineering, J. Biomed. Nanotechnol. 7 (2011) 238–244. [28] P.J. Marie, The calcium-sensing receptor in bone cells: a potential therapeutic target in osteoporosis, Bone 46 (2010) 571–576. [29] E.M. Carlisle, Silicon: a possible factor in bone calcification, Science 167 (1970) 279–280. [30] D.M. Reffitt, N. Ogston, R. Jugdaohsingh, H.F.J. Cheung, B.A.J. Evans, R.P. Thompson, J.J. Powell, G.N. Hampson, Orthosilicic acid stimulates collagen type 1 synthesis and osteoblastic differentiation in human osteoblast-like cells in vitro, Bone 32 (2003) 127–135. [31] J.J.M. Damen, J.M. Ten Cate, Silica-induced precipitation of calcium phosphate in the presence of inhibitors of hydroxyapatite formation, J. Dent. Res. 71 (1992) 453–457. [32] O. Peitl, E.D. Zanotto, L.L. Hench, Effect of crystallization on apatite layer formation of bioactive glass 45S5, J. Biomed. Mater. Res. 30 (1996) 509–514. [33] W. Xia, J. Chang, Preparation and characterization of nano-bioactive-glasses (NBG) by a quick alkali-mediated sol–gel method, Mater. Lett. 61 (2007) 3251–3253. [34] H.S. Mansur, H.S. Costa, Nanostructured poly (vinyl alcohol)/bioactive glass and poly (vinyl alcohol)/chitosan/bioactive glass hybrid scaffolds for biomedical applications, Chem. Eng. J. 137 (2008) 72–83. [35] S.R. Radin, P. Ducheyne, Plasma spraying induced changes of calcium ceramic characteristics and effect on in vitro stability, J. Mater. Sci. Mater. Med. 3 (1992) 33–42. [36] G. Goller, H. Demirkiran, F.N. Oktar, E. Demirkesen, Process and characterization of bioglass reinforced hydroxyapatite composites, Ceram. Int. 29 (2003) 721–724. [37] J. Zhong, D.C. Greespan, Processing and properties of sol-gel bioactive glasses, J. Biomed. Mater. Res. App. Biomater. 53 (2000) 694–701. [38] M. Brigotti, P.G. Petronini, D. Carnicelli, R.R. Alfieri, M.A. Bonelli, A.F. Borghetti, K.P. Wheeler, Effects of osmolarity, ions and compatible osmolytes on cell-free protein synthesis, Biochem. J. 369 (2003) 369–374. [39] S. Dhivya, S. Saravanan, T.P. Sastry, N. Selvamurugan, Nanohydroxyapatite-reinforced chitosan composite hydrogel for bone tissue repair in vitro and in vivo, J. Nanobiotechnol. 13 (2015) 40.
[9] L.L. Hench, J.M. Polak, I.D. Xynos, L.D.K. Buttery, Bioactive materials to control cell cycle, Mat. Res. Innov. 3 (2000) 313–323. [10] R.M. Day, Bioactive glass stimulates the secretion of angiogenic growth factors and angiogenesis in vitro, Tissue Eng. 11 (2005) 768–777. [11] L.L. Hench, The story of bioglass, J. Mater. Sci. Mater. Med. 17 (2006) 967–978. [12] T. Kokubo, Apatite formation on surfaces of ceramics, metals and polymers in body environment, Acta Mater. 46 (1998) 2519–2527. [13] A. Balamurugan, G. Balossier, J. Michel, S. Kannan, H. Benhayoune, A.H.S. Rebelo, J.M.F. Ferreira, Sol gel derived SiO2-CaO-MgO-P2O5 bioglass system–preparation and in vitro characterization, J Biomed Mater Res B Appl Biomater 83 (2007) 546–553. [14] P. Sepulveda, J.R. Jones, L.L. Hench, Characterization of melt-derived 45S5 and sol–gel-derived 58S bioactive glasses, J. Biomed. Mater. Res. 58 (2001) 734–740. [15] M. Saravanan, A.J. Domb, A contemporary review on – polymer stereocomplexes and its biomedical application, Eur. J. Nanomed. 5 (2013) 81–96. [16] C. Werkman, G.S. Senra, R.F. Rocha, A.A.H. Brandao, Comparative therapeutic use of Risedronate and Calcarea phosphorica - allopathy versus homeopathy - in bone repair in castrated rats, Braz. Oral. Res. 20 (2006) 196–201. [17] G.S. Senra, C. Werkman, R.F. Rocha, A.A.H. Brandão, Estudo radiográfico do reparo ósseo em ratos SHR com osteoporose utilizando homeopatia e risedronato. In: Programas e Resumos da 5 Mostra de pós-graduação da Universidade de Taubaté, Universidade de Taubaté, Taubate, 2004, p. 306. [18] H. Voisin, Manual de matériamédicapara o clínicohomeopata, 2nd ed., (1987) Sao Paulo Andrei. [19] M.L. Tyler, Calcarea phosphorica, in: M.L. Tyler (Ed.), Retratos de medicamentoshomeopaticos, 1 Santos, Sao Paulo, 1992, pp. 181–187. [20] A. Moorthi, S. Saravanan, N. Srinivasan, N.C. Partridge, J. Zhu, L. Qin, N. Selvamurugan, Synthesis, characterization and biological action of nano-bioglass ceramic particles for bone formation, J. Biomater. Tis. Eng. 2 (2012) 197–205. [21] K. Sahithi, M. Swetha, M. Prabaharan, A. Moorthi, N. Saranya, K. Ramasamy, N. Srinivasan, N.C. Partridge, N. Selvamurugan, Synthesis and characterization of nanoscale-hydroxyapatite-copper for antimicrobial activity towards bone tissue engineering applications, J. Biomed. Nanotechnol. 6 (2010) 333–339. [22] J. Pradeep Kumar, L. Lakshmi, V. Jyothsna, D.R. Balaji, S. Saravanan, A. Moorthi, N. Selvamurugan, Synthesis and characterization of diopside particles and their suitability along with chitosan matrix for bone tissue engineering in vitro and in vivo, J. Biomed. Nanotechnol. 10 (2014) 970–981. [23] S. Saravanan, S. Vimalraj, M. Vairamani, N. Selvamurugan, Role of mesoporous wollastonite (calcium silicate) in mesenchymal stem cell proliferation and osteoblast differentiation: a cellular and molecular study, J. Biomed. Nanotechnol. 11 (2015) 1124–1138.
8
Contents lists available at ScienceDirect
Materials Science & Engineering C journal homepage: www.elsevier.com/locate/msec
Formulation and biological actions of nano-bioglass ceramic particles doped with Calcarea phosphorica for bone tissue engineering S. Dinesh Kumara, K. Mohamed Abudhahira, N. Selvamuruganc, S. Vimalrajb, R. Murugesana, N. Srinivasana, A. Moorthia,⁎ a b c
Faculty of Allied Health Sciences, Chettinad Academy of Research and Education, Chettinad Health City, Kelambakkam, Tamil Nadu 603 103, India Vascular Biology Laboratory, AUKBC – Research Centre, MIT Campus, Anna University, Chennai, Tamil Nadu 600 043, India Tissue Engineering and Cancer Research Laboratory, Department of Biotechnology, SRM University, Kattankulathur, Tamil Nadu 603 203, India
A R T I C L E I N F O
A B S T R A C T
Keywords: Bioglass ceramics Calcarea phosphorica Sol-gel Bone formation and bone tissue engineering
The improvisation of the treatment procedures for treating the various kind of bone defects such as, bone or dental trauma and for diseases such as osteoporosis, osteomyelitis etc., need the suitable and promising biomaterials with resemblance of bone components. Bioactive glass ceramic (BGC) has recently acquired great attention as the most promising biomaterials; hence it has been widely applied as a filler material for bone tissue regeneration. Because it elicts specific biological responses after implantation in addition more potential in formation of strong interface with both hard and soft tissues by dissolution of calcium and phosphate ions. Hence, the current focus in treating the bone defects by orchestrating the biomaterial in combination of alternative medicine such as homeopathic remedies with biomaterials to prevent the adverse effects at minimal concentrations. So the current study was focused on constructing the nano-bioglass ceramic particles (nBGC) doped with novel homeopathic remedy Calcarea phosphorica for dental and bone therapeutic implants. The nBGC particles were synthesized by sol–gel method and reinforced with commercially available Calcarea phosphorica. The synthesized particles were characterized by SEM, DLS, EDS, FT-IR, and XRD studies. The SEM and DLS were shown the size of the particles at nano scale, also the EDS, and FT-IR investigations indicated that the Calcarea phosphorica was integrated with nBGC particles and also the crystalline nature of particles was confirmed by XRD studies. Both nBGC and Calcarea phosphorica doped nBGC (CP-nBGC) were found to be non toxic to mouse mesenchymal stem cells at lower concentrations and also illustrated the better bone forming ability in vitro.
1. Introduction Since early 1960's ceramics have been largely implicated as bone filler materials owing to their bioactivity, chemical similarity to the inorganic phase of bone and ability of osteo-integration [1]. However, the ceramic materials alone impose poor mechanical strength and faster dissolution rate in vivo. In order to develop a novel biomaterials with good mechanical strength, several materials sciences researchers have focused their attention towards development of Bioactive glass Ceramics (BGC) materials. BGC are a group of non-resorbable, osteoconductive, and prominent biomaterials were first developed by Hench in 1972 [2]. The BGC was widely used as coatings on metallic implants, dental filling materials and as scaffolds for bone tissue engineering due to its excellent bioactivity biocompatibility [3–8]. Also the BGC were particles proven to stimulate the gene expressions of osteoblast cells and angiogenesis process by releasing the Na+, K+, Ca, P, Si4+ ions in
exposure to physiological medium [9,10] and also found to induce formation of carbonated hydroxyapatite layer (HCA) when immersed in a simulated body fluids or SBF [11,12]. BG can be formed either by traditional melt-quenching or by modern sol–gel method but compared to melt-quenching process, sol-gel method widely applied since it requires low temperature for synthesis and promotes more porous structure with high specific surface area [13,14]. Nanomedical approaches for drug delivery, treating diseases or wound healing forms a core on nanoscale particles such as sterocomplexed polymers, hydrogels or similar molecules to improve drug bioavailability [15]. Hence, solgel technology is in the forefront as it delivers high quality BGCs. Taking advantage of this procedure, additives are introduced easily with the objective of improving the bioactivity of bioglasses. In this regard, various ions have been introduced as dopants and tested their efficiency on bone formation. The current study is aimed to synthesize nanobioglass ceramics (nBGC) materials and doping it with Calcarea
⁎ Corresponding author at: Department of Bionanotechnology, Faculty of Allied Health Sciences, Chettinad Hospital and Research Institute, Chettinad Academy of Research and Education, Kelambakkam, Chennai 603 103, India. E-mail address: [email protected] (A. Moorthi).
http://dx.doi.org/10.1016/j.msec.2017.08.077 Received 6 January 2017; Received in revised form 24 July 2017; Accepted 18 August 2017 0928-4931/ © 2017 Published by Elsevier B.V.
Please cite this article as: Dinesh Kumar, S., Materials Science & Engineering C (2017), http://dx.doi.org/10.1016/j.msec.2017.08.077
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
40 kV. The diffraction spectra was recorded at 2θ with a range of 10–70° and scanned at a speed of 2° min− 1. The identification of different phases present in the nBGC and CP-nBGC particles was carried out by Hanawalt method using Philips X-pert high score software. The intensity of the diffracted pattern was calculated by Bragg's law using the formula: nλ = 2dsinθ.
phosphorica/tribasic calcium phosphate (Ca3(PO4)2), a novel homeopathic remedy prescribed for the repair of non-union bone fractures and other bone defects [18]. Calcarea phosphorica, formulated from calcium phosphate dilutions, is one of the homeopathic medicines prescribed for bone disease treatment [16]. Calcarea phosphorica exhibited higher optical density in bone repair area in hypertensive castrated rats [17]. It is a combination of the calcium and phosphates produced by adding dilute phosphoric acid to lime water [19]. Hence, the present study was aimed to design the formulation of nanobioglass ceramic particles (nBGC) doped with CP and determination of their effect on osteoblast differentiation at cellular level in vitro.
2.3. Determination of cytotoxicity of the nBGC and CP-nBGC particles The mouse mesenchymal stem cells (mMSCs) C3H10T1/2 were used to determine the toxic effect of nBGC and CP-nBGC particles. Cytotoxicity study was carried out by following the methodology as previously described [20,21]. MTT [3-(4, 5-Dimethylthiazole-2-yl)-2, 5diphenyl tetrazolium] was used to evaluate cytotoxicity of the nBGC and CP-nBGC materials. Cells were seeded on a 96 well plate with a density of 1000 cells/cm2. Both the nBGC and CP-nBGC particles at different concentrations (0.01, 0.03, 0.05, 0.1, 0.5, and 1 mg/ml) in 200 μl cell culture media were added to the cells. The cells were incubated for the periods of and 48 h. 5 mg of MTT was dissolved in 10 ml of PBS and 100 μl of the MTT solution was added to each well and incubated for 4 h to form formazan crystals by mitochondrial dehydrogenases. After 4 h, the MTT solution was removed from the wells and 100 μl of the solubilisation solution (10% Triton X-100, 0.1 N HCl and isopropanol) was added in each well and incubated at room temperature for 1 h to dissolve the formazan crystals. The optical density of the solution was measured at a wavelength of 570 nm.
2. Materials and methods 2.1. Formulation of nanobioglass ceramics (nBGC) particles and Calcarea phosphorica doped nBGC particles (CP-nBGC) The nBGC particles (SiO2: CaO: P2O5 Mol% ~ 55:40:5) were synthesized via sol–gel method as reported earlier [20]. 7.693 g of calcium nitrate was mixed with 9.84 mL of TEOS (Tetraethyl orthosilicate) and dispersed into the solution of ethanol: water (1:2 ratio) and during this period the pH of the solution was maintained around 2 by the addition of 1 M citric acid the final clear solution obtained was considered as solution A. Followed by separately, 1.078 g of diammonium hydrogen orthophosphate was mixed with 2% of poly ethylene glycol (PEG; Mw 20,000) and the pH was maintained up to 10 by using ammoniated water the resultant solution was considered as solution B. Finally the solutions A and B were refluxed together under stirring conditions and aged for 24 h at room temperature to obtain the white gel precipitate. Then the precipitate was subjected to filtering followed by washed with deionized water, finally dried under vacuum then lyophilized and calcined at 700 °C (1 °C rise per minute) for 6 h to obtain white nBGC particles. The formulation of CP-nBGC was made briefly as follows: commercial grade of Calcarea phosphorica drug was purchased from retail vendor. 1:1 ration of nBGC and Calcarea phosphorica was mixed with water as solvent to prepare 1% w/v of CP-nBGC solution. Then the solution was aged for 24 h under stirring condition and centrifuged at 10,000 rpm for 5 min and washed with distilled water. This step was repeatedly done and pellet was calcinated at 250 °C to obtain fine powder of CP-nBGC particles.
2.4. Cell morphology evaluation and cell proliferation by trypan blue dye exclusion assay The structural and morphological changes with response to CPnBGC were documented as reported earlier [22,23]. Briefly, the mMSCs were grown in the presence of medium conditioned with CP-nBGC for a period of 72 h. Cells grown in normal medium served as a control. After the treatment period the micrograph of the cells were documented under phase contrast microscopy with 20× objective. In order to determine the role of CP-nBGC particles on cell proliferation, we conducted the trypan blue exclusion test as reported earlier [20]. The cells 106 × 2 mMSCs cells was seeded in 6 well plates and treated with 0.1 mg/ml concentration of CP-nBGC particles, after 48 h and 72 h treatment the cells were stained with trypan blue dye and counted manually using haemocytometer.
2.2. Physio-chemical characterization of nBGC and CP-nBGC particles The surface topography, morphology and particle size of the nBGC and CP-nBGC particles were analyzed using scanning electron (SEM) microscopy and Dynamic light scattering (DLS) method. For SEM analysis, the samples were sputter coated onto platinum and the scanning was done at 25 kV and 40 mA under vacuum. The particle size distribution of the nBGC and CP-nBGC particles were determined by using particle size analyzer (Malvern Zeta sizer nanosizer). The fundamental principle of particle size measurement was based on measuring time dependent fluctuation of scattering of laser light by the nBGC and CPnBGC particles. The energy dispersive X-ray spectroscopy (EDS) was performed using JEOL JSM 6490 LA. The nBGC and CP-nBGC particles were dispersed in suitable solvent and subjected for EDS measurements using JEOL-JEM2100F. Samples were placed on carbon tape coated stub and coated with platinum using JEOL JFC 1600 for 2 min at 10 mA. The peaks displayed of the EDS spectrum correspond to the energy levels and referring to an individual element. The inter molecular interaction of the functional groups present in the nBGC and CPnBGC particles were recorded with FT-IR spectrophotometer (American Perkin Elmer Co) using KBr press. The spectra were collected over the range of 4000–450 cm− 1. The spectrogram of the sample was prepared using OPUS software. The XRD patterns of nBGC and CP-nBGC particles were obtained at room temperature using a (Panalytical XPERTPRO powder diffractometer) (CuKα radiation) operating at a voltage of
2.5. Osteoblast differentiation at molecular level by real-time reverse transcriptase polymerase chain reaction analysis The 5 × 105 cells mMSCs was seeded in 6 well culture plates at per well in the presence or absence of 0.1 mg/ml concentration of CP-nBGC particles in normal or osteogenic medium containing 10 mM β-glycerophosphate, 10 nM dexamethasone, and 50 μg/ml ascorbic acid in DMEM at 14 days time periods interval. Total RNA was isolated from mMSCs after treatment using TRIzol reagent (500 μl/well). The concentration of RNA was determined from the OD of the sample measured at 260 nm. cDNA was synthesized using 1 μg of total RNA from each sample. The SYBR reagent (Invitrogen) was used in RT-PCR. The specific oligonucleotide primers were designed as shown in Table 1. The threshold cycle (Ct) value was calculated from the amplification plots. The ΔCt value for each sample was calculated by subtraction of the Ct values of the internal control gene GAPDH. The ΔΔCt and fold change was calculated as previously mentioned [23,24]. 2.6. Osteoblast differentiation at cellular level by alizarin red staining and quantification The differentiation and mineralization of osteoblast will be reflected in the form of calcium deposition. Hence, the differentiations of mMSCs 2
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
days. At the end of the treatment, the cultured cells were washed twice with ice-cold 1 × PBS and fixed with 10% neutral buffered formalin for 1 h and then rehydrated with 1 ml of distilled water for 5 min. The fixed monolayer of cells was then incubated with 1% alizarin red in 2% ethanol (pH 4.2) for 10 min at room temperature. The monolayers were washed multiple times with distilled water. 1 ml of 70% ethanol was added to the monolayer and allowed to stand for 2 min. The monolayer was then covered with a layer of distilled water. Calcified nodules were identified by inverted light microscopy as a bright red colour. Micrographs were taken and the stained wells were quantified using 1 N acetic acid followed by incubation at 80 °C and neutralization with liquid ammonia. The colour was read at 405 nm and results were plotted [23,25].
Table 1 Primer sequences used for real-time RT-PCR analysis. S. No
Gene name
Sequence
1.
Runx2
2. 3.
Alkaline phosphatase (ALP) Type I collagen (Col-I)
4.
Osteocalcin (OC)
5.
GAPDH
Forward - CGCCTCACAAACAACCACAG Reverse - TCACTGTGCTGAAGAGGCTG Forward - TTGTGCCAGAGAAAGAGAGAGA Reverse - GTTTCAGGGCATTTTTCAAGGT Forward - TAACCCCCTCCCCAGCCACAAA Reverse - TTCCTCTTGGCCGTGCGTCA Forward – ATGGCTTGAAGACCGCCTAC Reverse - AGGGCAGAGAGAGAGGACAG Forward - GAGAGACCCCACTTGCTGCCA Reverse - CTCACACTGCCCCTCCCTGGT
2.7. Statistical analysis All the experiments were performed in triplicates and the results were expressed as mean ± S.D. The statistical significance was analyzed by Student's t-test. A “p” value < 0.05 was considered as statistically significant. 3. Results and discussion 3.1. Size and compositional analysis of nBGC and CP-nBGC particles The size of the nBGC and CP-nBGC particles were determined by using DLS analysis. Both the particles were found to be varied sizes, suggesting that the particles were exhibited in heterogeneous population. Also the hydrodynamic diameter of nBGC material was found to be 452 nm with PDI of 0.78 and CP-nBGC particle size was found to be around 1106 nm with PDI of 0.81 (Fig. 1) also the shift in peak indicates increase the size of nBGC particles, which is due to the aggregation of Calcarea phosphorica with nBGC. Also the synthesized particles were subjected to SEM analysis to determine surface morphological characteristics. The nBGC particles (Fig. 2 A & B) shows the presence of silica in glassy phase, the rod like structure, but the addition of CP were shown to exhibit the oriented spherical shaped structure (Fig. 2 C & D). This crystal has been identified as apatite phase by XRD analysis and
Fig. 1. DLS spectra of nBGC and CP-nBGC particles. Hydrodynamic diameter of nBGC was found to be 452 nm with Pdi of 0.78 and CP-nBGC was found to be 1106 nm with Pdi of 0.81. The increase in size indicates aggregation of drug with nBGC material.
into osteoblast were determined by calcium deposition using alizarin red staining. The mMSCs were cultured in the presence or absence of 0.1 mg/ml concentration of CP-nBGC particles in normal or osteogenic medium for 18 days. Fresh medium was replenished once in every three
Fig. 2. SEM images of the nBGC (A & B) and Cp-nBGC (C & D) particles. The nBGC particles were found crystalline in structure (A & B) and CP-nBGC particles were seen in spherical in structure (C & D). The EDS spectra of nBGC and CP-nBGC particles (Fig. 2 E & F). The presence of calcium, silica and phosphorous is evident from the corresponding peaks of EDS spectra.
3
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
Fig. 3. FT-IR spectra of nBGC, Calcarea phosphorica and CP-nBGC particles (A). X-Ray diffraction spectra of nBGC and CP-nBGC particles (B). The decrease in crystallinity indicates the aggregation of bioglass ceramics with Calcarea phosphorica (B).
CP-nBGC particles were shown in (Fig. 3A). Si-O-Si asymmetric stretching mode was visible and assigned to the band shoulder at 1139 cm− 1 and 1116 cm− 1. The band at 870 cm− 1 and 682 cm− 1 in both the particles represents Si-O-Si symmetric stretching mode. Also vibrational bending occurred in the region of 1116 cm− 1 attributed the Si–O–Ca groups. The band near 600 cm− 1 was due to the rocking vibration of the Si–O bond [32]. Stretching vibration of phosphate moieties in the nBGC particles was noticed at 1067 cm− 1. The broad band at 2148 cm− 1 and 2163 cm− 1 is due to stretching vibrations of phosphate groups in Calcarea phosphorica and CP-nBGC [33,34]. PEG was used as a surfactant in the synthesis of nBGC particles, and there were occurrence of the peaks at 1639 cm− 1corresponding to O-H bending vibrational bands of PEG. Similarly bands in 3496 cm− 1 were assigned to C-H stretch of CP-nBGC particles [35]. The vibrational shifts from 670 cm− 1 to 717 cm− 1, 1636 cm− 1 to 1640 cm− 1, 2148 cm− 1 to 2163 cm− 1, and 3430 cm− 1 to 3496 cm− 1 indicates the integration of
found as a spherical shape [26]. At higher magnification, the deposition of calcium ions over the crystalline structure was observed which indicates the aggregation of CP onto the surface of nBGC (Fig. 2 C & D). The spherical morphology of the particles was templated from the micelle structure of PEG, used as a surfactant in sol–gel synthesis of the particles [27]. The elemental percentage of atoms contributing to nBGC particles were determined by EDS. Fig. 2 E & F represents the spectral analysis indicating the presence of key atoms Si, Ca, P, C, O derived from different precursors utilized during the synthesis of these particles. The existence of calcium and silicon is vital in determining the biological action of nBGC particles [28–31].
3.2. Chemical molecular characterization of nBGC and CP-nBGC The intermolecular interactions of the particles were determined by FTIR analysis. The FT-IR analysis of the nBGC, Calcarea phosphorica and 4
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
Fig. 4. Effect of nBGC and CP-nBGC particles on cytotoxicity. C3H10T1/2 cells were treated with respective particles containing medium for a period of 48 h with different concentrations. (A) represent the 48 h MTT assay of nBGC and (B) CP-nBGC respectively. * indicates significant decrease compared to control (p < 0.05).
Fig. 5. Cell morphology and viability assessment by microscopic examination, cells in control (A) and 0.1 mg/ml CP-nBGC treated wells (B) exhibited a well spread morphology. The percentage of cell viability was calculated. ∗indicates significant difference compared to control (p < 0.001) (C).
5
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
Fig. 6. Effect of CP-nBGC particles on mRNA of osteoblast differentiation marker genes mRNA expressions in mMSCs. Real-time analysis was performed using the primers for Runx2, ALP COL-I and OC mRNA expression (A, B, C & D). The fold change of mRNA in CP-nBGC treated conditions was calculated over untreated control samples. GAPDH was used for normalization. Fig. 7. Effect of CP-nBGC particles on mMSCs differentiation and mineralization by alizarin red staining. Representative photographic images at 18 days after fixing the cells are shown (A). Quantification of data is presented above (B). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
6
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
with the activation of osteoblast differentiation marker genes as well as depositions of calcium molecules which promote the extracellular matrix formation. The expression levels of major transcription factor for bone Runx2 and early and late differentiation marker genes ALP, Col-I and OC mRNA expression were upregulated in presence of osteogenic stimulant compared to absence of osteogenic stimulant (Fig. 6 A–D). The earlier report states the stimulation of osteogenic differentiation marker genes as well as calcium deposition was found to be increase with response to the ceramic material in presence of osteogenic stimulants [20,23–25]. Also the osteogenic differentiation determination was carried out with evaluation of calcium deposition by alizarin red staining in response to CP-nBGC treatment with mMSCs cells after 18 days (Fig. 7). The expression of bright red colour is indication for differentiation of osteoblast cells (Fig. 7 A). In addition the deposited calcium molecules were quantified spectrophometrically and graphs were plotted (Fig. 7 B). The increased calcium deposition was seen in response to the CP-nBGC along with the osteogenic stimulant environment (Fig. 7 A). Moreover, the result was reflected in terms of quantification data of the deposited calcium (Fig. 7 B). Hence, it suggests the promotion of osteoblast differentiation of the stem cells requires the osteogenic environment to promote the differentiation of mMSCs. The previous reports associated with glass ceramics are agreed with current report [20,23].
Calcarea phosphorica with nBGC. Hence, the results suggest that the vibrational confirmations of presence of Silica (Si) and Calcium (Ca) as key components of nBGC and integration of Calcarea phosphorica with nBGC confirms the molecular bonding between the drug and ceramics. The XRD pattern of the synthesized nBGC and CP-nBGC particles were shown in Fig. 3 B. After calcination at 700 °C, the XRD pattern illustrates the peaks at definite 2θ values. The 2θ values of the XRD spectra for nBGC were exhibited at 21.88 and the peak for CP-nBGC was found in 19.72. The peaks were also in strong agreement with the Joint Committee for Powder Diffraction Standards (JCPDS). The intensity peak at 2θ of ~21.88° is attributed to the formation of the (CaSiO3) phase (JCPDS # 10-489) and the intensity peak at 19.72° match with the hydroxyapatite [Ca10(PO)4O] phase (JCPDS # 89-6495) [36,37]. Also the distance between the crystal lattice spacing calculated using Bragg‘s equation was found to be 5.03A° and 1.60A° and for nBGC and CP-nBGC respectively. In addition, sharper peak are observed in CPnBGC material, which indicates increase in crystallinity of nBGC by Calcarea phosphorica. 3.3. Biocompatibility of nBGC and CP-nBGC materials Since the particles (nBGC and CP-nBGC) comprises of multiple components, it is expected to be toxic to mammalian cells, and this cytotoxic effect could restrict or limit the usage of these materials for in vivo applications. Thus, the particles were subjected for cytocompatibility with mMSCs. The toxicity was studied by colorimetric quantification for assessing the mitochondrial succinate dehydrogenase activity to convert the MTT to purple colour formazan crystals. This crystalline product is further solubilized by the addition of dimethyl sulfoxide (DMSO) and preceded with OD measurement. Fig. 4 (A & B) depicts the MTT assay for nBGC and CP-nBGC particles. The particles were tested at five different concentrations (0.01, 0.03, 0.05, 0.1, 0.5 and 1 mg/ml) along with control and Triton-X-100 as positive control for 24 and 48 h. The colorimetric measurement depicted upto the concentrations 0.1 mg/ml found to be no remarkable effect in the cell death, but 0.5 and 1 mg/ml concentrations of nBGC and CP-nBGC particles showed a marked decrease in the cell viability. Hence 0.1 mg/ml of particles was chosen as the ideal concentration for further in vitro studies. The presence of increased concentrations of nBGC in the cell culture medium could result in dissolution of calcium and silicon ions from them which lead to an increase in the pH and osmolarity which could be detrimental to cell survival. It is evident that hyperosmolality generates osmotic shock which leads to shrinkage and death of cells [38].
4. Conclusion The current study provides the new approach with biomaterials and homeopathic preparation to strengthen the bone tissue engineering. The synthesized particles exhibited a proliferative and biocompatible effect on mouse mesenchymal stem cells. The natural composition with bone resembling biomaterial provided the osteogenic potential in mMSCs. Hence, the findings in this study provide new insights in the development of novel approach in developing the biomaterials with potential bone formation promoting potentiality furthermore offers the substantial advantages of biomaterials in bone tissue engineering. Further explorations with in vivo studies are needed to provide better application of the material in orthopedic and dental applications. Acknowledgement We thank Chettinad Academy of Research and Education (CARE) management for the financial support. Also we thank Dr. N. Subhapradha, Dr. Shoba Narayan, CARE, Chennai for their technical support. This work was also supported by research grant from Department of Science and Technology, Science and Engineering Research Board (SERB), India to S. Vimalraj (grant no. PDF/2015/ 000133).
3.4. Cell morphology and cell proliferation mediated by CP-nBGC particles The microscopic (Fig. 5 A & B) examination was demonstrated the biocompatibility of 0.1 mg/ml concentration of CP-nBGC particles treatment at 72 h with mMSCs. Cells in both control and CP-nBGC treated were found to be exhibited in well spread morphology, which has been a better indicative of biocompatible environment of the CPnBGC particles to mMSCs. In addition the proliferative capacity was determined by manual counting of proliferative cells, it has shown significant increase in cell number at 72 h treatment with CP-nBGC particles (Fig. 5 C). This may be due to silica and calcium present in the composition would have played vital role in mediating the better cell proliferation [24,25]. Also the proliferation might be mediated by activating the intercellular proliferative mechanism in osteoblast for reconstruction of the defective site of the bone [20,39]. Hence the CPnBGC was shown to promote around 18% of cells towards proliferation (Fig. 5 C).
References [1] S.V. Dorozhkin, Bioceramics of calcium orthophosphates, Biomaterials 31 (2010) 1465–1485. [2] L.L. Hench, H.A. Paschall, Direct chemical bond of bioactive glass-ceramic materials to bone and muscle, J. Biomed. Mater. Res. 7 (1973) 25–42. [3] A. Hoppe, N.S. Guldal, A.R. Boccaccini, A review of the biological response to ionic dissolution products from bioactive glasses and glass-ceramics, Biomaterials 32 (2011) 2757–2774. [4] D.H. Kohn, P. Ducheyne, Materials for bone, joint and cartilage replacement, in: D.F. Williams (Ed.), Medical and Dental Materials, VCH Verlagsgesellschaft, FRG, 1992, pp. 29–109. [5] A. El Ghannam, P. Ducheyne, I.M. Shapiro, Porous bioactive glass and hydroxyapatite ceramic affect bone cell function in vitro along different time lines, J. Biomed. Mater. Res. 36 (1997) 167–180. [6] U. Gross, V. Strunz, The anchoring of glass ceramics of different solubility in the femur of the rat, J. Biomed. Mater. Res. 14 (1980) 607–618. [7] E.A.B. Effah Kaufmann, P. Ducheyne, I.M. Shapiro, Effect of varying physical properties of porous, surface modified bioactive glass 45S5 on osteoblast proliferation and maturation, J. Biomed. Mater. Res. 52 (2001) 783–796. [8] T. Nakamura, T. Yamamuro, S. Higashi, A new glass-ceramic for bone replacement: evaluation of its bonding to bone tissue, J. Biomed. Mater. Res. 19 (1985) 685–698.
3.5. Osteoblast differentiation mediated by CP-nBGC at molecular and cellular levels The osteoblast differentiation and mineralization will be reflected 7
Materials Science & Engineering C xxx (xxxx) xxx–xxx
S. Dinesh Kumar et al.
[24] A. Moorthi, S. Vimalraj, C. Avani, Z. He, N.C. Partridge, N. Selvamurugan, Expression of microRNA-30c and its target genes in human osteoblastic cells by nano- bioglass ceramic-treatment, Int. J. Biol. Macromol. 56 (2013) 181–185. [25] R. Niranjan, C. Koushik, S. Saravanan, A. Moorthi, M. Vairamani, N. Selvamurugan, A novel injectable temperature-sensitive zinc doped chitosan/β-glycerophosphate hydrogel for bone tissue engineering, Int. J. Biol. Macromol. 54 (2013) 24–29. [26] T. Kokubo, T. Nakamura, F. Miyaji, Bioceramics, 1st Edition, 9 (1996), pp. 89–92. [27] N. Saranya, S. Saravanan, A. Moorthi, B. Ramyakrishna, N. Selvamurugan, Enhanced osteoblast adhesion on polymeric nano-scaffolds for bone tissue engineering, J. Biomed. Nanotechnol. 7 (2011) 238–244. [28] P.J. Marie, The calcium-sensing receptor in bone cells: a potential therapeutic target in osteoporosis, Bone 46 (2010) 571–576. [29] E.M. Carlisle, Silicon: a possible factor in bone calcification, Science 167 (1970) 279–280. [30] D.M. Reffitt, N. Ogston, R. Jugdaohsingh, H.F.J. Cheung, B.A.J. Evans, R.P. Thompson, J.J. Powell, G.N. Hampson, Orthosilicic acid stimulates collagen type 1 synthesis and osteoblastic differentiation in human osteoblast-like cells in vitro, Bone 32 (2003) 127–135. [31] J.J.M. Damen, J.M. Ten Cate, Silica-induced precipitation of calcium phosphate in the presence of inhibitors of hydroxyapatite formation, J. Dent. Res. 71 (1992) 453–457. [32] O. Peitl, E.D. Zanotto, L.L. Hench, Effect of crystallization on apatite layer formation of bioactive glass 45S5, J. Biomed. Mater. Res. 30 (1996) 509–514. [33] W. Xia, J. Chang, Preparation and characterization of nano-bioactive-glasses (NBG) by a quick alkali-mediated sol–gel method, Mater. Lett. 61 (2007) 3251–3253. [34] H.S. Mansur, H.S. Costa, Nanostructured poly (vinyl alcohol)/bioactive glass and poly (vinyl alcohol)/chitosan/bioactive glass hybrid scaffolds for biomedical applications, Chem. Eng. J. 137 (2008) 72–83. [35] S.R. Radin, P. Ducheyne, Plasma spraying induced changes of calcium ceramic characteristics and effect on in vitro stability, J. Mater. Sci. Mater. Med. 3 (1992) 33–42. [36] G. Goller, H. Demirkiran, F.N. Oktar, E. Demirkesen, Process and characterization of bioglass reinforced hydroxyapatite composites, Ceram. Int. 29 (2003) 721–724. [37] J. Zhong, D.C. Greespan, Processing and properties of sol-gel bioactive glasses, J. Biomed. Mater. Res. App. Biomater. 53 (2000) 694–701. [38] M. Brigotti, P.G. Petronini, D. Carnicelli, R.R. Alfieri, M.A. Bonelli, A.F. Borghetti, K.P. Wheeler, Effects of osmolarity, ions and compatible osmolytes on cell-free protein synthesis, Biochem. J. 369 (2003) 369–374. [39] S. Dhivya, S. Saravanan, T.P. Sastry, N. Selvamurugan, Nanohydroxyapatite-reinforced chitosan composite hydrogel for bone tissue repair in vitro and in vivo, J. Nanobiotechnol. 13 (2015) 40.
[9] L.L. Hench, J.M. Polak, I.D. Xynos, L.D.K. Buttery, Bioactive materials to control cell cycle, Mat. Res. Innov. 3 (2000) 313–323. [10] R.M. Day, Bioactive glass stimulates the secretion of angiogenic growth factors and angiogenesis in vitro, Tissue Eng. 11 (2005) 768–777. [11] L.L. Hench, The story of bioglass, J. Mater. Sci. Mater. Med. 17 (2006) 967–978. [12] T. Kokubo, Apatite formation on surfaces of ceramics, metals and polymers in body environment, Acta Mater. 46 (1998) 2519–2527. [13] A. Balamurugan, G. Balossier, J. Michel, S. Kannan, H. Benhayoune, A.H.S. Rebelo, J.M.F. Ferreira, Sol gel derived SiO2-CaO-MgO-P2O5 bioglass system–preparation and in vitro characterization, J Biomed Mater Res B Appl Biomater 83 (2007) 546–553. [14] P. Sepulveda, J.R. Jones, L.L. Hench, Characterization of melt-derived 45S5 and sol–gel-derived 58S bioactive glasses, J. Biomed. Mater. Res. 58 (2001) 734–740. [15] M. Saravanan, A.J. Domb, A contemporary review on – polymer stereocomplexes and its biomedical application, Eur. J. Nanomed. 5 (2013) 81–96. [16] C. Werkman, G.S. Senra, R.F. Rocha, A.A.H. Brandao, Comparative therapeutic use of Risedronate and Calcarea phosphorica - allopathy versus homeopathy - in bone repair in castrated rats, Braz. Oral. Res. 20 (2006) 196–201. [17] G.S. Senra, C. Werkman, R.F. Rocha, A.A.H. Brandão, Estudo radiográfico do reparo ósseo em ratos SHR com osteoporose utilizando homeopatia e risedronato. In: Programas e Resumos da 5 Mostra de pós-graduação da Universidade de Taubaté, Universidade de Taubaté, Taubate, 2004, p. 306. [18] H. Voisin, Manual de matériamédicapara o clínicohomeopata, 2nd ed., (1987) Sao Paulo Andrei. [19] M.L. Tyler, Calcarea phosphorica, in: M.L. Tyler (Ed.), Retratos de medicamentoshomeopaticos, 1 Santos, Sao Paulo, 1992, pp. 181–187. [20] A. Moorthi, S. Saravanan, N. Srinivasan, N.C. Partridge, J. Zhu, L. Qin, N. Selvamurugan, Synthesis, characterization and biological action of nano-bioglass ceramic particles for bone formation, J. Biomater. Tis. Eng. 2 (2012) 197–205. [21] K. Sahithi, M. Swetha, M. Prabaharan, A. Moorthi, N. Saranya, K. Ramasamy, N. Srinivasan, N.C. Partridge, N. Selvamurugan, Synthesis and characterization of nanoscale-hydroxyapatite-copper for antimicrobial activity towards bone tissue engineering applications, J. Biomed. Nanotechnol. 6 (2010) 333–339. [22] J. Pradeep Kumar, L. Lakshmi, V. Jyothsna, D.R. Balaji, S. Saravanan, A. Moorthi, N. Selvamurugan, Synthesis and characterization of diopside particles and their suitability along with chitosan matrix for bone tissue engineering in vitro and in vivo, J. Biomed. Nanotechnol. 10 (2014) 970–981. [23] S. Saravanan, S. Vimalraj, M. Vairamani, N. Selvamurugan, Role of mesoporous wollastonite (calcium silicate) in mesenchymal stem cell proliferation and osteoblast differentiation: a cellular and molecular study, J. Biomed. Nanotechnol. 11 (2015) 1124–1138.
8