Frequency detection of pyrethroid resistance allele in Anopheles sinensis populations by real-time PCR amplification of specific allele (rtPASA)

Pesticide Biochemistry and Physiology 87 (2007) 54–61 www.elsevier.com/locate/ypest

Frequency detection of pyrethroid resistance allele in Anopheles sinensis populations by real-time PCR ampliWcation of speciWc allele (rtPASA) Hyunwoo Kim a, Ji Hyung Baek a, Won-Ja Lee b, Si Hyeock Lee a,¤ a

b

School of Agricultural Biotechnology, Seoul National University, Seoul 151-921, Republic of Korea Department of Medical Zoology, Korea National Institute of Health, Seoul 122-701, Republic of Korea Received 30 March 2006; accepted 5 June 2006 Available online 4 July 2006

Abstract To investigate the level of pyrethroid resistance in Anopheles sinensis Wiedemann 1828 (Diptera: Culicidae), a major malaria vector in Korea, we cloned and sequenced the IIS4-6 transmembrane segments of the sodium channel gene that encompass the most widely known kdr mutation sites. Sequence analysis revealed the presence of the major Leu-Phe mutation and a minor Leu-Cys mutation at the same position in permethrin-resistant Weld populations of An. sinensis. To establish a routine method for monitoring resistance, we developed a simple and accurate real-time PCR ampliWcation of speciWc allele (rtPASA) protocol for the estimation of resistance allele frequencies on a population basis. The kdr allele frequency of a Weld population predicted by the rtPASA method (60.8%) agreed well with that determined by individual genotyping (61.7%), demonstrating the reliability and accuracy of rtPASA in predicting resistance allele frequency. Using the rtPASA method, the kdr allele frequencies in several Weld populations of An. sinensis were determined to range from 25.0 to 96.6%, suggestive of widespread pyrethroid resistance in Korea. © 2006 Elsevier Inc. All rights reserved. Keywords: Anopheles sinensis; Knockdown resistance (kdr); Real-time PASA (rtPASA); Pyrethroids

1. Introduction The mosquito Anopheles sinensis is a major vector of malaria in Korea. In the1990s the national malaria eradication program, based mostly on chemical control of vector mosquitoes, resulted in the apparent disappearance of malaria in South Korea; however malaria has since resurged with more than 21,400 cases detected to date (Korea Center for Disease Control and Prevention, http:// dis.cdc.go.kr/eng_statistics/statistics.asp). Since their introduction during the 1970s, insecticides including pyrethroids and organophosphates have been widely used for the control of medically important arthropod pests, including mosquitoes. Permethrin and DDVP (Dichlorvos) have been used in Korea as the principal active ingredients of both

*

Corresponding author. Fax: +82 2 873 2319. E-mail address: [email protected] (S.H. Lee).

0048-3575/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.pestbp.2006.06.009

indoor and outdoor mosquito control products and have also been widely used for the control of mosquitoes and Xies in animal farming. Intensive use of insecticides was quickly followed by development of insecticide resistance in a variety of mosquito species including An. sinensis. It is extremely important to understand the mechanism of insecticide resistance in order to suppress and delay the development of resistance and establish a reliable resistance monitoring system. Consequently, many studies have been conducted on the molecular basis of insecticide resistance. One important mechanism of resistance to pyrethroids is characterized by a marked reduction in the intrinsic sensitivity of the insect nervous system to these compounds. This phenomenon was originally reported as knockdown resistance (kdr) in Musca domestica, and it was subsequently determined that a single mutation (leucine to phenylalanine, Leu1014Phe) in the S6 transmembrane segment of domain II in the sodium channel is associated with kdr to pyrethroids and DDT in both M. domestica [1] and the

H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61

German cockroach, Blattella germanica [2]. Kdr-related mutations, identical or similar to the Leu-to-Phe mutation, have been also reported in Anopheles gambiae [3] and in a variety of pyrethroid-resistant arthropod species [4]. To establish a successful resistance management system, it is essential to develop more sensitive tools for the rapid estimation of resistance allele frequencies from Weld populations [5,6]. Detection of the conserved mutations associated with insecticide resistance, such as the Leu-to-Phe mutation, has been achieved by various DNA-based genotyping techniques, including PCR ampliWcation of speciWc allele (PASA) [7], bi-directional PCR ampliWcation of speciWc allele (bi-PASA) [8], single stranded conformational polymorphism (SSCP) [9], minisequencing, and serial invasive signal ampliWcation reaction (SISAR) [10]. Although these individual genotyping techniques are very useful in precise estimation of both frequency and genotype of resistance alleles, they usually require a great number of analysis and sample preparation, limiting their potential as a high throughput resistance monitoring tool. For the rapid monitoring of resistance in a large number of Weld populations of mosquito, necessary would be a genotyping technique based on pooled DNA samples that can be employed at the preliminary step of resistance monitoring prior to more elaborate individual genotyping. In the present study, we demonstrate that the Leu-Phe sodium channel mutation is commonly found in most Korean populations of An. sinensis and describe a simple and accurate real-time PASA (rtPASA) protocol for the estimation of the kdr allele (Leu-Phe mutation) frequency on a population basis of An. sinensis. We also discuss the applicability of this protocol in large scale resistance monitoring and management. 2. Materials and methods 2.1. Mosquitoes Anopheles sinensis mosquitoes were collected using an aspirator or black-light trap. Blood-fed female mosquitoes were individually placed in a paper cup containing water and allowed to lay eggs under the conditions of 27 § 2 °C temperature, 65 § 5% relative humidity, and 12:12 photope-

55

riod (light:dark). Hatched larvae were reared under the same conditions and used for RNA or DNA extraction. For individual genotyping, F1 larvae were obtained from 100 blood-fed females, combined and stored at ¡20 °C until use. 2.2. PCR ampliWcation of the para-homologous sodium channel gene fragment Total RNA was extracted with Tri Reagent® (MRC, Cincinnati, OH) from 120 4th instar larvae (Paju strain) and mRNA was isolated with the PolyATract mRNA isolation SystemIII® (Promega, Madison, WI). First-strand cDNA was synthesized from the mRNA using SuperscriptIII reverse transcriptase as recommended by the manufacturer (Invitrogen, Carlsbad, CA). PCR was performed with degenerate primer sets (5⬘IIS4 vs. 3⬘IIS56; 5⬘ASIIS56 vs. 3⬘IIIS3) designed from highly conserved regions (Table 1 and Fig. 1) to amplify the IIS4-IIIS3 cDNA fragment of the para-homologous sodium channel gene in two overlapping consecutive fragments. A 20 l reaction mixture contained 20 M each of degenerate primer (Table 1), 0.5 U of Advantage® 2 polymerase mix (TITANIUM™ Taq DNA Polymerase, 0.3 mM Tris–HCl (pH 8.0), 1.5 mM KCl, and 10 M EDTA) (Clontech, Palo Alto, CA), 0.2 mM of dNTP (Invitrogene), and 1 l of cDNA template. Reaction mixtures were incubated at 95 °C for 1 min prior to 30 cycles of ampliWcation (95 °C for 30 s, 50 °C for 30 s, and 68 °C for 1 min). To amplify the IIS5-IIS6 genomic DNA fragment of the sodium channel gene, PCR was performed using sequencespeciWc primers (Table 1) and genomic DNA as the te7mplate. Genomic DNA was extracted from 10 adult mosquitoes with 200 l DNAzol® as recommended by the manufacturer (MRC). PCR mixtures (20 l) were as described above except for 0.1 M sequence-speciWc primers (5ASIIS56 and 3ASII6intron) (Table 1 and Fig. 1) and 20 ng of genomic DNA. The thermal program was: one cycle of 95 °C for 3 min followed by 35 cycles of 95 °C for 20 s, 65 °C for 20 s, and 68 °C for 1 min. Following Wltration through Microcon-100 Wlter (Millipore, Bedford, MA) twice, the 361-bp ampliWed DNA fragments were directly sequenced and the genotypes were analyzed.

Table 1 Primers used for the isolation of An. sinensis sodium channel gene fragment encompassing the Leu-to-Phe mutation site and for rtPASA Name

Sequence

Remarks

5⬘IIS4 3⬘IIS56 3⬘IIIS3 5⬘ASIIS5 3⬘ASIIS5

5⬘GCIAARWSITGGCCIACNYT 5⬘YTITGYGGIGARTGGATHG 5⬘CCARCACCAIGCRTTIGTRAA 5⬘GACGTTCGTGCTCTGCATTAT 5⬘CACATCCCCGACTAGCATACA

Primers for the ampliWcation of sodium channel

5⬘ASIIS56 3⬘ASIIS56intron

5⬘CGGACTTCATGCACTCCTTCA 5⬘TTAGCGCATTTGCTACGTTC

Primers for the ampliWcation of the rtPASA template

As-PASA-5 As-PASA-3R As-PASA-3S

5⬘GGAGTGGATCGAATCAATG 5⬘CTGCAGTTACTCACCACA 5⬘CTGCAGTTACTCACCACC

Allele-speciWc primers for the rtPASA

56

H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61

Fig. 1. Sequence and intron-exon structure of the IIS4-IIS6 transmembrane segment of the para-homologous sodium channel gene from An. sinensis encompassing the Leu-Phe or Leu-Cys mutation site. The Leu-Phe mutation site is marked with a box. Two introns are indicated by shadowing. The sequence has been submitted to the GenBank database with Accession No. DQ334052.

2.3. rtPASA with standard DNA mixtures A 361-bp genomic DNA fragment corresponding to the IIS5-IIS6 segment of the sodium channel gene was PCRampliWed from individual mosquitoes and directly sequenced to identify individuals with homozygous resistant (with Leu-Phe mutation) or homozygous susceptible (without Leu-Phe mutation) genotypes. Once the kdr genotype was determined, DNA samples were stored at ¡20 °C for use as standard template DNA. The standard template DNA mixtures for rtPASA were prepared by combining PCR-ampliWed fragments with and without the Leu-Phe mutation in various ratios (% susceptible allele: % resistance allele D 100:0, 50:50, 10:90, 1:99, 0:100). The optimized rtPASA reaction mixture (20 l) contained 1 ng standard template DNA mixture, 0.5 U of Taq polymerase (Promega), 0.035 M TaqStart antibody (Clontech), SYBR Green I (1:40,000 Wnal concentration; Molecular Probe, Eugene, OR), 0.3 M susceptible or resistance allele-speciWc primer (As-PASA-3S or As-PASA-3R), 0.3 M general primer (As-PASA-5), 100 M dNTPs, and 1.2 mM MgCl2. rtPASA was performed using a Chromo 4™ real-time detector (Bio-Rad, Hercules, CA) with a thermal cycler program of 1 cycle of 95 °C for 3 min, 35 cycles of 95 °C for 20 s, 62 °C for 20 s, 72 °C for 30 s, and a Wnal cycle of 72 °C for 3 min. To minimize prediction errors of rtPASA due to variations in template DNA concentration, the concentration of the PCR-ampliWed template DNA was estimated both by gel band intensity analysis (Kodak 1D image analysis software Version 3.5, Rochester, NY) with the Low DNA Mass Ladder (Invitrogen) following agarose gel electrophoresis, and by Xuorometric determination using PicoGreen

(Molecular Probe) according to the manufacturer’s directions, with a SPECTRAmax GEMINI XS Microplate SpectroXuorometer (Molecular Device, Palo Alto, CA). Threshold cycles (Ct) were determined from each ampliWcation curve, and plotted against respective susceptible allele frequency. Standard linear regression lines were generated from plotting the log scale of susceptible allele frequency vs. Ct value using the Sigma Plot program (Version 6.00 for Windows). The PCR ampliWcation eYciency was calculated from the slope of the standard curve using the following equation: E D 10¡1/slope [11,12]. 2.4. Evaluation of rtPASA One hundred individual frozen 4th instar larvae of Ansan population were cut into two pieces with a razor blade at the head–thorax region. The abdominal part of each body was separately processed for individual genomic DNA extraction, whereas the head–thorax parts were combined for pooled genomic DNA extraction. Genomic DNA extraction was performed using DNAzol (MRC) as recommended by the manufacturer, with a minor modiWcation. The single individual abdominal parts and pooled head– thorax parts of the larvae were homogenized in 200 and 40 l of DNAzol, respectively. The 361-bp sodium channel gene fragments were ampliWed from both the pooled and 30 individual genomic DNA samples. The PCR-ampliWed sodium channel gene fragments from 30 individuals were directly sequenced (NICEM sequencing facility, SNU, Seoul, Korea) to determine the kdr allele frequency, while the product from the pooled genomic DNA was used as an unknown sample for rtPASA.

H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61

57

2.5. Analysis of kdr allele frequencies of An. sinensis regional populations by rtPASA

low frequency as judged by the presence of weak but distinct G sequence signal in the TGT triplet code (Fig. 2).

Adult female An. sinensis mosquitoes were collected from 11 regions using an aspirator or black-light trap and then frozen and stored at ¡20 °C until use. Genomic DNA was extracted from 100 adults of each regional population. Standard DNA template was ampliWed by PCR from each genomic DNA as described above, and 1 ng was used for rtPASA.

3.2. Development of rtPASA protocol

3. Results 3.1. Cloning of the IIS4-6 fragment of the para-homologous sodium channel gene Two contiguous overlapping cDNA fragments (230-bp IIS4-IIS5 and 347-bp IIS5-IIIS3) of the para-homologous sodium channel gene were ampliWed by PCR using degenerate primer sets and sequenced. The assembled 531-bp cDNA fragments showed 97.2 and 96.6% sequence identity to the corresponding region of the sodium channel genes from An. gambiae and Aedes aegypti, respectively. A 1500bp PCR product was generated using the sequence-speciWc primer set (Table 1) with genomic DNA as template. Two introns were identiWed within the IIS4-IIS6 segment of the sodium channel gene: a 905-bp intron located close to the end of IIS5 and a 64-bp intron in the middle of the IIS6 transmembrane segments (Fig. 1). Sequence analysis of the genomic DNA of the IIS4-IIS6 segment of the sodium channel gene from four regional populations of An. sinensis revealed that the Leu-Phe (TTG to TTT) mutation known to confer the kdr trait was present in all populations tested, but the Met-Thr mutation known to be associated with the super kdr trait was not present in any of the populations (Fig. 2). Interestingly, an allele containing a Leu-Cys (TTG-TGT) mutation at the same position was found in all the regional populations at a relatively

Fig. 2. Nucleotide sequence chromatograms at the Leu-Phe or Leu-Cys mutation site when sequencing the IIS5-IIS6 genomic DNA fragment of the sodium channel gene ampliWed from 10 adults of An. sinensis. The Leu/Phe/Cys-encoding codon position was indicated by dotted vertical lines. The typical Leu-Phe (TTG to TTT) mutation is mixed with a minor allele (TGT) encoding Cys in all the regional populations (Paju, Ansan, Jeonju, and Gurye) examined. Peak colors represent: T (red), C (blue), A (green), G (black). (For interpretation of the references to color in this Wgure legend, the reader is referred to the web version of this paper.)

Since two potential resistance alleles [the major Leu-Phe (TTT) mutated allele and the minor Leu-Cys (TGT) mutated allele were found in regional populations of An. sinensis, the rtPASA assay was designed to use the susceptible allele-speciWc primer (As-PASA-3S, Table 1) to detect the susceptible allele (TTG) instead of using primers speciWc for the resistance allele. Optimal conditions for the rtPASA were determined by sequential testing of various annealing temperatures and concentrations of primer, DNA template, and MgCl2. To Wnd the optimum annealing temperature that can simultaneously give minimum allelenonspeciWc ampliWcation and maximum ampliWcation eYciency for target DNA template, we tested a range of temperatures (55–67 °C) based on the estimated melting temperature (50 °C) of the susceptible allele-speciWc primer under the conditions of 1.2 mM MgCl2, 0.3 M of each primer, and 1 ng of 100% susceptible or 100% resistance standard DNA template. NonspeciWc ampliWcation was suppressed signiWcantly as the annealing temperature increased, as determined by the log ECt(0–100) value, where E is the ampliWcation eYciency and Ct(0–100) is the Ct value diVerence between 0 and 100% susceptible standard DNA templates (Fig. 3A). The ideal level of allele-speciWc ampliWcation was obtained at 63 °C. The ampliWcation eYciency, however, decreased noticeably at higher temperatures (67 °C) (Fig. 3A). Taken together, the optimum temperature was determined to be around 62–63 °C, at which allele-nonspeciWc ampliWcation was maximally suppressed whereas the eYciency of allele-speciWc ampliWcation remained close to 2.0. When titrating primer concentration, it was apparent that decreasing the concentration of the allele-speciWc primer (As-PASA-3S) to a certain level (0.1 M) resulted in both the reduction of ampliWcation eYciency and a signiWcant impairment of ampliWcation (Fig. 3B). In contrast, as the primer concentration increased to 0.4 M, ampliWcation eYciency increased above the ideal level of 2.0 (Fig. 3B), most likely due to nonspeciWc ampliWcation as indicated by heterogeneous melting curves (data not shown). Therefore, the optimum allele-speciWc primer concentration was determined to be 0.2–0.3 M (Fig. 3B). AmpliWcation eYciency was not altered signiWcantly within the range of template DNA concentrations tested (0.5, 1.0, and 2.0 ng/reaction) and no signiWcant diVerences were observed between diVerent MgCl2 concentrations in the range of 1.2–1.5 mM (data not shown). Taken together, the optimum conditions for the rtPASA were determined to be: 62 °C annealing temperature, 0.3 M each primer, 1 ng DNA template, and 1.2 mM MgCl2. Typical results obtained from the rtPASA using standard DNA mixtures under the optimum conditions are shown in Fig. 4A. Based on the relationship between susceptible allele frequencies (100–0%) and corresponding Ct values, a linear

58

H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61

A

A 3.0 2.0

Ideal Efficiency Level 2.5 1.5

Efficiency ΔCt(0-100) Log E

Log EΔCt(0-100)

Amplification Efficiency

2.5

2.0

1.0 54

56

58

60

62

64

66

68

Annealing Temperature ( OC)

Real-time PCR Graph

B

B

2.6

2.4

0.4

Fluorescence

Amplification Efficiency

0.5

2.2 Ideal Efficiency Level

2.0

0.3

Sus 100% Sus 50% Sus 10% Sus 1% Sus 0%

0.2 0.1

1.8

0.0

0 1.6

10

20

30

Cycle 0.10

0.20

0.30

0.40

Primer Concentration (uM)

C

Fig. 3. Determination of optimum annealing temperature (A) and primer concentration (B) for rtPASA. (A) The PCR ampliWcation eYciency (E) (-䊉-) and the log ECt(0–100) index for maximum suppression of nonspeciWc allele (-䉱-) were plotted against annealing temperatures (55, 58, 62, and 65 °C), where E is the ampliWcation eYciency at each annealing temperature, and Ct(0–100) is the Ct (critical ampliWcation time) value diVerence between 0 and 100% susceptible standard DNA templates. (B) PCR ampliWcation eYciency (E) (-䊉-) was plotted against diVerent susceptible allele-speciWc primer (As-PASA-3S) concentrations (0.1–0.4 M).

regression line was generated by converting the frequency to log values. The high regression coeYcient (r2 D 0.9995) demonstrated a very strong correlation between susceptible allele frequency and Ct value (Fig. 4B). The calculated PCR ampliWcation eYciency was 2.1, indicating that the rtPASA was conducted under the optimum conditions. 3.3. Evaluation of the performance of rtPASA Individual genotyping for 30 individual larvae (abdominal 2/3 body part) from a single Weld population (Ansan) was conducted by sequencing. As shown in Fig. 4A, two homozygous and three diVerent heterozygous genotypes were found at the Leu-Phe mutation site. Among the 30 sequenced individual genotypes, 5 homozygous susceptible (TTG/TTG, Leu/ Leu), 11 homozygous resistance (TTT/TTT, Phe/Phe), and 11 heterozygous (TTG/TTT, Leu/Phe) genotypes were clearly determined on the basis of the sequence chromatogram (Fig. 4A). In addition to the major TTG/TTT heterozygote, two other minor heterozygous individuals were identiWed

Fig. 4. Evaluation of rtPASA performance by comparing the resistance allele frequency of Ansan population of An. sinensis estimated from individual genotyping by sequencing (A) and that from rtPASA (B and C). (A) Typical nucleotide sequence chromatograms of a variety of genotypes [homozygous Leu (TTG), homozygous Phe (TTT), and heterozygous alleles of Leu/Phe, Phe/Cys, and Leu/Cys] identiWed from individual sequencing. (B) Typical ampliWcation curves obtained from rtPASA using susceptible allele-speciWc primer (As-PASA-3S) and standard template DNA mixtures of diVerent ratios (% susceptible allele: % resistance allele D 100:0, 50:50, 10:90, 1:99, and 0:100). Ct (critical ampliWcation time) values were determined at Xuorescence level of 0.04. (C) Standard linear regression line generated by plotting Ct value vs. log susceptible allele frequency in the standard template DNA mixture.

from the mixed sequence signals of T(G/T)T and T(G/T) (G/T) (Fig. 4A). When the corresponding PCR-ampliWed DNA fragments were cloned and sequenced, these heterozygotes were resolved to be of TGT/TTT (Cys/Phe) and TTG/ TGT (Leu/Cys), respectively. One TGT/TTT (Cys/Phe) and two TTG/TGT (Leu/Cys) heterozygous individuals were

H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61

found among the 30 samples, at low frequencies of 3.3 and 6.7%, respectively. Although the function of the Cys-substitution at the Leu amino acid location remains to be elucidated, the total frequency of the susceptible allele (TTG) was calculated to be 38.3% (16.7% homozygous allele + 43.3% heterozygous allele). If both the Phe (TTT) and Cys (TGT) mutations are regarded as resistance alleles, their frequency in the Ansan population was estimated to be 61.7% (100–38.3%; Fig. 4A). This allele frequency was used as a reference value for evaluating the performance of the rtPASA using the DNA template generated from the pooled DNA sample that had been extracted from a combination of 100 head–thorax parts of An. sinensis. Typical ampliWcation patterns of rtPASA reactions using a series of standard DNA mixture templates containing 100, 50, 10, 1 and 0% susceptible allele frequencies are shown in Fig. 4B. The pooled DNA samples were analyzed simultaneously with a set of internal standard DNA mixtures with known allele frequencies (100, 50, 10, 1, and 0%) by rtPASA under the standard conditions (Fig. 4C). The resulting Ct values for the pooled DNA samples were converted to actual allele frequencies using the equation generated by the set of internal standard DNA mixtures (y D ¡3.057x + 9.596, r2 D 0.9995) (Fig. 4C). The resistance allele frequency of the pooled DNA sample of the Ansan population was estimated as 60.8%, which corroborated well with the reference frequency determined by individual genotyping (61.7%) within the 95% CL (conWdence limit). 3.4. Prediction of the resistance allele frequency of 11 regional populations The frequency of the kdr resistance allele (Leu-Phe mutation) in 11 regional Weld populations of An. sinensis

Fig. 5. Pyrethroid resistance allele frequencies (Leu-Phe mutation frequency) in 11 regional populations of An. sinensis. The resistance allele frequencies were predicted by rtPASA. The four regions with highest resistance allele frequency were located in a major rice Weld area in Korea marked by a shadowed oval.

59

was determined using the rtPASA protocol developed in this study. Most of the regional populations revealed kdr allele frequencies higher than 50%, except for Daejeon (46.8%) and Gijang (25.0%) populations. Notably, all the local populations from the Jeonla-Do region (Gwangyang, Gurye, Jeonju, and Gwangju), a major paddy Weld area, showed relatively high resistance allele frequencies of 96.6, 96.3, 86.5, and 79.0%, respectively, compared with those from other regions (Fig. 5). 4. Discussion Sequence analysis of the IIS4-IIS6 segment of the sodium channel gene revealed that the Leu-Phe mutation known to confer kdr was present in all the regional populations of An. sinensis examined. However, the Met-Thr mutation known to be associated with the super-kdr trait was not found in the populations examined. In the parahomologous sodium channels present in a variety of insect species [4], the Leu residue is encoded by the codon CTT, in which a C to T substitution at the Wrst nucleotide position of results in the Leu-Phe mutation. Interestingly, this conserved Leu is encoded by TTG in An. sinensis and the mutation to Phe involves the replacement of the third position of the triplet. A similar codon usage is found in An. gambiae (TTA) [3] and the German cockroach (TTG) [2]. In addition to the TTG (Leu) and TTT (Phe) alleles, an allele encoding cysteine (TGT) was also found in some local populations. The TGT allele was found either with TTG or TTT, thereby forming TGT/TTG (Cys/Leu) and TGT/TTT (Cys/Phe) heterozygotes. The Leu-Cys mutation is likely associated with resistance since the substitution of this leucine by serine, an amino acid residue with similar properties to cysteine, confers pyrethroid resistance in An. gambiae [13]. If the Leu-Cys mutation is assumed to be responsible for resistance, the TGT/TTT heterozygous allele likely functions as a homozygous resistance allele in conferring resistance. The exact function of the Cys-substitution and which allele is transcribed in the cases of Cys/Leu and Cys/ Phe heterozygotes remains to be determined. The frequency of the Cys-encoding TGT allele appeared to be somewhat low (5%) compared to the Phe-encoding TTT allele, suggesting that it has been introduced into An. sinensis populations relatively recently. A similar case has been reported in pyrethroid-resistant populations of the house Xy, where an additional new allele, a Leu-His mutation, was present together with the Leu-Phe allele in most of the populations from the Eastern US [14]. In an attempt to detect the frequency of resistance-associated mutations in the sodium channel in An. sinensis on a population basis, we have developed a diagnostic protocol based on real-time PCR. To ensure an accurate prediction of resistance allele frequency, it is necessary to determine optimum rtPASA conditions. We have found that conditions which are too stringent, in particular temperatures that are too high, generally cause an overall reduction in the ampliWcation eYciency, thereby resulting in the

60

H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61

impairment of target template ampliWcation and underestimation of target template frequency. Therefore, it is important to Wnd conditions that can ensure the ideal ampliWcation of target template (ampliWcation eYciency of 2.0) as well as the maximum suppression of nonspeciWc ampliWcation. In practice, ampliWcation eYciencies of 1.8– 2.2 were considered acceptable in this study. Once optimum conditions are established, it is desirable to evaluate the performance of rtPASA and calibrate the system by running duplicate samples with known allele frequency. In the present study, the allele frequency was determined from 30 individual genotypes and compared with that estimated from a pooled DNA sample by rtPASA. As reported previously, a slight change in standard DNA template concentration can cause a signiWcant shift in the regression line, potentially generating errors in frequency prediction [15]. Therefore, it is critical to include a standard DNA template set in all routine rtPASA analyses. In addition, use of a PCR fragment containing the mutation site(s) rather than genomic DNA has a great advantage with respect to control of both the quality and quantity of template DNA. Using the optimum conditions this rtPASA protocol showed a high level of reliability and accuracy as demonstrated by the performance evaluation of rtPASA, where the allele frequency predicted by the rtPASA was well correlated with that determined by individual sequence analysis. Based on this fact, rtPASA appears to be a powerful tool in detecting insecticide resistance allele frequency on a population basis. When estimated by rtPASA, the frequency of the resistance allele (Leu-Phe mutation) ranged from 25.0 to 96.6% in the 11 regional populations, suggesting that knockdown resistance of An. sinensis against pyrethroids is widespread in Korea. Due to the absence of a susceptible laboratory strain of An. sinensis that can be used as a reference, it was not possible to calculate exact pyrethroid resistance ratios in the Weld populations. However, since the Leu-Phe mutation in the insect sodium channel is known to confer pyrethroid resistance [1–4,16,17], presence of this mutation alone likely increases the baseline resistance level to pyrethroids in the regional populations of An. sinensis to that extent. In addition, considering the presence of other resistance factors such as cytochrome P450-mediated enhanced metabolism, actual resistance level in the Weld populations of An. sinensis would be higher than that estimated by kdr allele frequency. Interestingly, it appears that mosquitoes collected from areas close to rice Welds and animal farms (Gurye, Gwangyang, Gwangju, and Jeonju) showed relatively high levels of permethrin resistance compared with other regions (Fig. 5). Traditional pyrethroids have been intensively used in animal farms to control Xies, whereas nonester pyrethroids such as etofenprox and silaXuofen have been introduced into rice Welds, a main breeding habitat of An. sinensis, for the control of the rice water weevil since the late 1980s. In addition to pyrethroids directly used for the control of mosquitoes, the widespread use of insecticides for the control of other agri-

cultural pests, including rice water weevils, appears to contribute to the development of insecticide resistance in An. sinensis, likely resulting in high levels of resistance in the farming areas. Considering the high frequency of kdr alleles in representative Weld populations, continued use of pyrethroids to control An. sinensis mosquitoes will likely aggravate the resistance problem by further reducing the susceptible allele frequency in the population. Since it is likely that sodium channel insensitivity due to the kdr allele confers crossresistance to all other pyrethroids, switching to alternative pyrethroids may not solve the current resistance problem. Based on the Wndings in this study, it appears desirable to restrict the use of pyrethroids for the control of An. sinensis in Korea for the time being, thereby preserving the remaining pyrethroid-susceptible alleles. Since it is not easy to obtain a suYcient number of live An. sinensis larvae for bioassay and to rear under laboratory conditions, the genotyping of resistance alleles from either dead or live adult specimens, easily collectable by light trap, would be an alternative method of baseline resistance monitoring together with the traditional bioassay. In this regard, the rtPASA technique will greatly facilitate and expedite monitoring of pyrethroid resistance allele frequency and its change over time. Population-based analysis using rtPASA as a preliminary resistance monitoring tool will enable to survey overall resistance levels in a large number of regional populations of An. sinensis in a very eYcient manner. Acknowledgments This work was supported by Grant 02-PJ1-PG10-204050001 from the Korea Health Industry Development Institute. H.W. Kim and J.H. Baek were supported in part by Brain Korea 21 program. References [1] D.A. Andow, D.M. Olson, R.L. Hellmich, D.N. Alstad, W.D. Hutchison, Frequency of resistance to Bacillus thuringiensis toxin Cry1Ab in an Iowa population of European corn borer (Lepidoptera: Crambidae), J. Econ. Entomol. 93 (2000) 26–30. [2] J.H. Baek, J.I. Kim, D.W. Lee, B.K. Chung, T. Miyata, S.H. Lee, IdentiWcation and characterization of ace1-type acetylcholinesterase likely associated with organophosphate resistance in Plutella xylostella, Pestic. Biochem. Physiol. 81 (2005) 164–175. [3] J.M. Clark, S.H. Lee, H.J. Kim, K.S. Yoon, A. Zhang, DNA-based genotyping techniques for the detection of point mutations associated with insecticide resistance in Colorado potato beetle Leptinotarsa decemlineata, Pest Manag. Sci. 57 (2001) 968–974. [4] J.G. Hall, P.S. Eis, S.M. Law, L.P. Reynaldo, J.R. Prudent, D.J. Marshall, H.T. Allawi, A.L. Mast, J.E. Dahlberg, R.W. Kwiatkowski, M. de Arruda, B.P. Neri, V.I. Lyamichev, Sensitive detection of DNA polymorphisms by the serial invasive signal ampliWcation reaction, Proc. Natl. Acad. Sci. USA 97 (2000) 8272–8277. [5] T. Hongyo, G.S. Buzard, R.J. Calvert, C.M. Weghorst, ‘Cold SSCP’: a simple, rapid and non-radioactive method for optimized single-strand conformation polymorphism analyses, Nucleic Acids Res. 21 (1993) 3637–3642.

H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61 [6] D.H. Kwon, J.M. Clark, S.H. Lee, Estimation of knockdown resistance in diamondback moth using real-time PASA, Pest. Biochem. Physiol. 78 (2004) 39–48. [7] Q. Liu, E.C. Thorland, J.A. Heit, S.S. Sommer, Overlapping PCR for bidirectional PCR ampliWcation of speciWc alleles: a rapid one-tube method for simultaneously diVerentiating homozygotes and heterozygotes, Genome Res. 7 (1997) 389–398. [8] D. Martinez-Torres, F. Chandre, M.S. Williamson, F. Darriet, J.B. Berge, A.L. Devonshire, P. Guillet, N. Pasteur, D. Pauron, Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector Anopheles gambiae s.s, Insect Mol. Biol. 7 (1998) 179–184. [9] M. Miyazaki, K. Ohyama, D.Y. Dunlap, F. Matsumura, Cloning and sequencing of the para-type sodium channel gene from susceptible and kdr-resistant German cockroaches (Blattella germanica) and house Xy (Musca domestica), Mol. Gen. Genet. 252 (1996) 61–68. [10] M.W. PfaZ, A new mathematical model for relative quantiWcation in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [11] H. Ranson, B. Jensen, J.M. Vulule, X. Wang, J. Hemingway, F.H. Collins, IdentiWcation of a point mutation in the voltage-gated sodium channel gene of Kenyan Anopheles gambiae associated with resistance to DDT and pyrethroids, Insect Mol. Biol. 9 (2000) 491–497.

61

[12] F.D. Rinkevich, L. Zhang, R.L. Hamm, S.G. Brady, B.P. Lazzaro, J.G. Scott, Frequencies of the pyrethroid resistance alleles of Vssc1 and CYP6D1 in house Xies from the eastern United States, Insect Mol. Biol. 15 (2006) 157–167. [13] T.J. Smith, S.H. Lee, P.J. Ingles, D.C. Knipple, D.M. Soderlund, The L1014F point mutation in the house Xy Vssc1 sodium channel confers knockdown resistance to pyrethroids, Insect Biochem. Mol. Biol. 27 (1997) 807–812. [14] D.M. Soderlund, D.C. Knipple, The molecular biology of knockdown resistance to pyrethroid insecticides, Insect Biochem. Mol. Biol. 33 (2003) 563–577. [15] S.S. Sommer, J.D. Cassady, J.L. Sobell, C.D. Bottema, A novel method for detecting point mutations or polymorphisms and its application to population screening for carriers of phenylketonuria, Mayo Clin. Proc. 64 (1989) 1361–1372. [16] WHO, Instructions for determining the susceptibility or resistance of mosquito larvae to insecticides. WHO/VBC 81.807 (1981). [17] M.S. Williamson, D. Martinez-Torres, C.A. Hick, A.L. Devonshire, IdentiWcation of mutations in the houseXy para-type sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides, Mol. Gen. Genet. 252 (1996) 51–60.