Fs and dioxin-like PCBs in marine and freshwater fish in Pearl River Delta, China

Marine Pollution Bulletin 63 (2011) 166–171

Contents lists available at ScienceDirect

Marine Pollution Bulletin journal homepage: www.elsevier.com/locate/marpolbul

Assessment of risk of PCDD/Fs and dioxin-like PCBs in marine and freshwater fish in Pearl River Delta, China X. Wei a, K.S. Leung b, M.H. Wong a, J. Giesy c, Z.W. Cai b, Chris K.C. Wong a,⇑ a

Croucher Institute of Environmental Sciences, Department of Biology, Hong Kong Baptist University, Hong Kong, PR China Dioxin Analysis Laboratory, Department of Chemistry, Hong Kong Baptist University, Hong Kong, PR China c Department of Veterinary Biomedical Sciences and Toxicological Center, University of Saskatchewan, 44 Campus Drive Saskatoon, SK S7N 5B3, Canada b

a r t i c l e

i n f o

Keywords: Polychlorinated dibenzo-p-dioxins Polychlorinated dibenzofurans Fish Leydig cells Ovarian cells

a b s t r a c t Fish consumption is known to be beneficial to human health. However since the age of industrialization, the released/disposed chemical pollutants into water systems make fish a source of various environmental toxicants to humans. In oceanic cities with heavy industrial activities, fish products contribute the greatest proportion of exposure to pollutants. In this study, risks and potential effects of dioxins to health of coastal populations in the Pearl River Delta were assessed. Concentrations of polychlorinated dibenzop-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs), and dioxin-like polychlorinated biphenyls (PCBs) were measured in common fish species purchased at local markets. Concentrations of total dioxins in fish ranged from 0.481 to 9.05 pg TEQ/g wet weight were similar to the lesser concentrations reported for fish from other countries. The greatest concentrations of dioxins were measured in mandarin fish, a carnivorous freshwater fish. Exposure of murine primary leydig and ovarian cells to 2,3,7,8-tetrachlorinated dibenzo-p-dioxins (2,3,7,8-TCDD) reduced the synthesis of progesterone, testosterone and/or estrogen. The reductions were probably via inhibitory effects on the expression of the steroidogenic enzymes, steroidogenic acute regulatory protein (StAR) and cytochrome P450 side-chain cleavage enzyme (P450scc). Based on these reproductive parameters, the concentrations of dioxins and dioxin-like residues represent a moderate health risk due to consumption of fish. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction Dioxins are highly toxic human-made pollutants with known adverse health effects to wildlife and humans (US EPA, 2010). The major sources of dioxin release into environments are from incineration, uncontrolled burning of refuse and by-products of industrial processes (Srogi, 2008). Because of their high lipophilicity and low biodegradability, dioxins are persistent in environments and are bioaccumulated in food chains (Fernandes et al., 2004; Focant et al., 2002). Over 90% of human exposure to dioxins comes from foods of animal origin (i.e. dairy products, poultry and fish), and the rest might be attributed by inhalation and dermal exposure to contaminated soils (Charnley and Doull, 2005). In human risk assessment, considerable numbers of reports indicated that traces of dioxins were detected in adipose tissues, blood and milk samples, especially from coastal populations (Jin et al., 2003; Leng et al., 2009). Levels of PCDD/Fs with concentrations of picogram/g (ppt) were measured in human adipose tissues from Turkey, US and Vietnam (Cok et al., 2007; Schecter et al., 2006, ⇑ Corresponding author. E-mail address: [email protected] (C.K.C. Wong). 0025-326X/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.marpolbul.2011.02.025

2002). PCDD/F concentrations highest up to 30 pg I-TEQ/g fat in human milks were reported from Vietnam, France, Spain, Canada, Germany, Brazil and Taiwan (Chao et al., 2003; Paumgartten et al., 2000; Srogi, 2008). Dioxins include polychlorinated dibenzodioxins (PCDDs)/polychlorinated dibenzofurans (PCDFs) and dioxin-like polychlorinated biphenyls (PCBs), can bind to (but not limited to) arylhydrocarbon receptor (AhR) to exhibit a variety of toxicological effects, including dermal toxicity, developmental deficits, immunotoxicity, reproductive impairment, endocrine disruption, and carcinogenicity (IARC, 1997). Pearl River Delta (PRD) is a highly-developed industrial region whereas dioxin contaminations were reported in different ecological compartments. Contamination of dioxins was reported in various abiotic samples collected from PRD like air, water, soil, sediments (Choi et al., 2008; Zheng et al., 2001). From a report of dioxin contamination in human breast milk samples of Hong Kong and PRD in year 2002–2003, the median WHO-TEQs of PCDD/Fs and PCBs in the milk samples from Hong Kong was found to be the highest among five Asian Pacific countries (Hedley et al., 2006). In oceanic cities with heavy industrial activities, fish products contributed the greatest proportion of exposure to pollutants (Oh et al., 2005). High levels of flame retardants like

X. Wei et al. / Marine Pollution Bulletin 63 (2011) 166–171

polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), dichlorodiphenyltrichloroethane (DDTs) and polycyclic aromatic hydrocarbons (PAHs) were found in edible fish samples in our region (Chan et al., 1999; Cheung et al., 2007, 2008). Hong Kong was ranked 6th in global fish consumption (WWF, 1999; ECP, 2000), however study for dioxin (PCDD/Fs and dioxin-like PCBs) contaminations in fish from PRD was limited (Tsang et al., 2009; Zhang et al., 2005). In this study, WHO-TEQs levels of PCDD/Fs and dioxin-like PCBs were analyzed in a total of 20 species of fish, whereas the sources were widely ranged from PRD to South China Sea. Effects of TCDD on steroidogenesis were investigated using primary cultures of mouse leydig and ovarian cells. On the basis of our findings, potential reproductive health risks of dioxin intoxication from fish consumption in our region were highlighted. 2. Materials and methods 2.1. Chemical reagents and standard solutions All solvents (acetone, ethanol, dichloromethane, toluene, ethyl acetate, n-hexane and isooctane, nonane) for analysis were purchased from Merck (Darmstadt, Germany). Multilayer silica, basic alumina and activated carbon were obtained from FMS Inc. (FMS Inc., Boston, USA). Perfluorokeronese (PFK, high boiling point) for mass spectrometry calibration was from Sigma–Aldrich (USA). Standard solutions (Labeled-Compound Spiking Solution (DS-1613LCS), Cleanup Standard (DS-1613CSS), internal standard (DS-1613ISS), calibration standards (DS-1613CS0.5 to DS1613CS5) and Precision and Recovery Standard (DS-1613PAR) from Cambridge Isotopes, Woburn, MA, USA were used for instrument calibration, quantification, sampling and analytical recovery. 2.2. Sampling information Twenty species of fish samples (i.e. 10 from freshwater and 10 from marine) cultured or caught from aquatic environments of PRD in China, were purchased from markets in Hong Kong. These samples were dissected. Meats (with skin) and gut tissues were portioned separately. The analyses of the meat samples were carried out individually (n P 6). The analyses of those fish species of small body size were conducted using pooled samples (n = 10– 30) in order to attain the minimum sample size (20 g wet weight) required for dioxin measurements. All samples were homogenized using a food blender and stored at 20 °C until the analysis. 2.3. Sample preparation and extraction The extraction method for fish was carried out on the basis of the US EPA Method 1613 with some modifications in clean-up procedures. Approximately 20 g of fish fillet sample was spiked with PCDD/F internal standard solution containing 15 13C12-isotope labeled PCDD/Fs and was then mixed thoroughly with 20 g of anhydrous sodium sulphate (Sigma). The sample was extracted with 400 mL of 50% v/v hexane:dichloromethane in a soxhlet extractor for at least 40 h. 2.4. Clean-up Before clean-up, each extract was spiked with 37Cl4 2,3,7,8TCDD clean-up standard as described in EPA Method 1613 and was mixed well. The sample extract was then processed through the following clean-up columns: acidic silica, acidic silica/acidic alumina, florisil, and activated carbon/Celite 545 mixture (18% w/ w) columns. The extracts were then transferred into a round bottom flask and were spiked with 13C12 1,2,3,4-TCDD-/13C12

167

1,2,3,7,8,9-HxCDD (the recovery standards), and were concentrated to a final volume of 2 ml. The final aliquot of the extract was injected into a high resolution gas chromatography/high resolution mass spectrometry (HRGC/HRMS) (Agilent/Micromass) for analysis. 2.5. HRGC/HRMS analysis All extracts were analyzed by HRGC/HRMS (resolution =10,000) in a selected ion monitoring mode. The HRGC/HRMS system consisted of an Autospec-Ultima HRMS (Micromass, Manchester, UK) coupled to an Agilent 5890 capillary GC and a CTC A200s autosampler (CTC, Switzerland). Simultaneous analyses of seventeen 2,3,7,8-substituted PCDD/Fs and six PCBs were performed on a DB-5 (60 m  0.25 mm, 0.25 lm) capillary column (J&W Scientific Inc., Folsom, CA). Injection volumes of 1 lL were used for sample and calibration analyses. 2.6. Primary culture of mouse leydig cells and ovarian cells All experimental animals were housed and handled in accordance with Guidelines and Regulations in Hong Kong Baptist University. Leydig cells were isolated from testes of 8-week old sexually mature male CD-1 mice and were cultured for 2 days as described (Lai et al., 2005). Briefly, testes were collected and decapsulated from 10 male mice and were then digested in M199 medium containing 0.5 mg/ml collagenase (Sigma) and 1% BSA in an Erlenmyer flask in an oscillating incubator, 100 rpm at 34 °C for 20 min. Digested cell suspension was transferred to a 50 ml tube and was kept on ice for 2 min to allow tubules to settle. The medium containing leydig cells was filtered through 70 lm nylon cell strainers (Falcon, BD Biosciences, NJ, USA) and was then centrifuged at 350g for 20 min at 4 °C. The pellet was re-suspended in 5 ml of M199 medium and was loaded on top of a Percoll step-gradient solution of 5%, 30%, 58% and 70% (Sigma, USA). The Percoll gradient was then centrifuged at 800g for 30 min at 4 °C to separate three layers of cells. The enriched fraction of leydig cells was collected from the third layer. The cells were washed in M199 medium twice and were re-suspended in DMEM/F12 (1:1) medium supplemented with 10% fetal bovine serum (Hyclone, UK), 50 U/ml penicillin and 50 lg/ml streptomycin (GIBCO/BRL, Carlsbad, CA, USA). The cells were seeded at a density of 1  105/well in 12-well plates (IWAKI, Tokyo, Japan) and maintained at 34 °C with 5% CO2. Trypan blue dye exclusion assay was used to test the cell viability. Ovarian cells were isolated from ovaries of 8-week-old sexually mature female CD-1 mice and were cultured for 24 h. Briefly ovaries were collected from five female mice, chopped into small pieces and were then digested in DMEM/F12 (1:1) medium containing 1 mg/ml collagenase in an Erlenmyer flask in a 37 °C oscillating incubator, 100 rpm for 20 min. The medium containing cells was filtered through 100 lm nylon cell strainers (Falcon, BD Biosciences, NJ, USA) and was then centrifuged at 350g for 20 min at 4 °C. The cell pellet was re-suspended in DMEM/F12 (1:1) medium supplemented with 10% fetal bovine serum (Hyclone, UK), 25 mmol/L Hepes buffer (Sigma, USA), 50 U/ml penicillin and 50 lg/ml streptomycin (GIBCO/BRL, Carlsbad, CA, USA), 2 mmol/L L-glutamine (Sigma, USA) and 1% bovine serum albumin (Sigma, USA). The cells were seeded at a density of 1  105/well in 12-well plates (IWAKI, Tokyo, Japan) and were maintained at 37 °C with 5% CO2. Trypan blue dye exclusion assay was used to test the cell viability. 2.7. Cell treatment Cultured cells were exposed for 24 h to one of the following treatments: (i) 5 IU/ml hCG (Sigma); (ii) 0.5 nM TCDD (Cambridge

168

X. Wei et al. / Marine Pollution Bulletin 63 (2011) 166–171

Isotope Laboratories Inc., Andover, MA, USA); (iii) hCG (5 IU/ ml) + TCDD (0.5 nM); (iv) 5 nM TCDD; (v) hCG (5 IU/ml) + TCDD (5 nM); and (vi) dimethylsulfoxide (DMSO, a solvent control) (Sigma, USA). Total RNA was extracted by TRIZOl Reagent (Invitrogen, Paisley, UK) and transcript levels of steroidogenic acute regulatory protein (StAR), cytochrome P450 side-chain cleavage enzyme (P450scc), cytochrome P450-19a1 enzyme (CYP19a1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were measured by real-time PCR. Conditioned media were assayed for progesterone, testosterone and estrogen by ELISA. 2.8. ELISA for steroid hormones The conditioned media were assayed for progesterone, testosterone and estrogen using ELISA kits (MP Biomedicals, Ohio, USA). Total 100 ll working hormone-HRP conjugate reagent, 50 ll rabbit anti-hormone reagent and 25 ll sample/standard, were added in wells and incubated at 37 °C for 90 min. The wells were rinsed five times with distilled water and mixed with 100 ll TMB solution, followed by 20 min incubation at room temperature. The reaction was then stopped by 1 N HCl solution and the absorbance was read at 450 nm within 15 min.

ted cells was extracted by TRIZOL Reagent according to the manufacturer’s instructions. Real-time PCR was conducted for mRNA quantification. Total RNA (150 ng) was reverse transcribed using High Capacity cDNA synthesis kit (Applied Biosystems, USA). Quantified standards (104–108) and sample cDNA were analyzed by StepOne real-time PCR detection system (Applied Biosystems, USA) using SYBRÒGreen Master mix (Applied Biosystems, USA). The copy number for each sample was calculated and the data were normalized using the expression level of GAPDH mRNA. The PCR conditions were 95 °C for 20 s and 40 cycles of 95 °C for 3 s, 56 °C for 10 s and 72 °C for 30 s. Fluorescent signals were captured at 72 °C, the occurrence of primer dimers and secondary products were inspected using melting curve analysis. All apparatus were treated with diethyl pyrocarbonate and autoclaved. 2.10. Statistical analysis Drugs treatments were performed in duplicates in the same experiments and individual experiments were repeated at least three times. All data are represented as mean ± S.E. Statistical significance was tested by Duncan’s test. Groups were considered significantly different if P < 0.05.

2.9. Real-time PCR 3. Results and discussion StAR, P450scc, CYP19a1 and GAPDH PCR products were generated by PCR of total RNA derived from the harvested leydig and ovarian cells. Primers were synthesized (Table 1) and PCR products were cloned into pCRII-TOPO (Invitrogen, Carlsbad, CA) and were subjected to dideoxy sequencing for verification. Total RNA of trea-

Table 1 The DNA sequences of primers used in the present study.

StAR P450scc P45019a1 GAPDH

Forward

Reverse

GCAGCAGGCAACCTGGTG CCTCTGGTAATACTGGTGATAGG CTGTCGTGGACTTGGTCATG ATGGTGAAGGTCGTGTGAAC

TGATTGTCTTCGGCAGCC AGCTGGGCAACATGGAGTCA GGGGCCCAAAGCCAAATGGC TCCACCACCCTGTTGCTGT A

3.1. TEQ concentrations and dioxin contents in fish samples Table 2 summarizes the concentrations of polychlorinated dibenzo-p-dioxins (PCDD/Fs) and dioxin-like polychlorinated biphenyls (PCBs) that were measured in 20 common fish species from markets in Hong Kong. The total PCDD/Fs TEQ levels in the fish meats (2.7  10 1 to 3.8 pg total TEQ (pg I-TEQ/g wet weight)) were in similar ranges reported in other Asian countries (Okumura et al., 2004; Tsutsumi et al., 2007). In addition, concentrations of dioxin-like PCBs were measured in this study and the levels ranged from 6.5  10 2 to 5.25 pg total TEQ (pg WHO-TEQ/g) wet weight. The highest TEQ levels of PCDD/Fs and dioxin-like PCBs were both measured in Mandarin fish, a cultured carnivorous freshwater fish,

Table 2 TEQ concentrations and contents in fish samples. Sample

Species

Weight (g)a

Lipid (%)

pg-TEQ/g fresh wt.

Total TEQ content (pg-TEQ/sample)

PCDD/Fs

Dioxin-like PCBs

Total

Freshwater Big head Carp Catfish Grass Carp Grey Mullet Mandarin fish Mud fish Rice field eel Snakehead Spotted Snakehead Tilapia

1000 ± 45.8 315.7 ± 36.7 916.7 ± 16.7 378.8 ± 27.7 1518.6 ± 118.6 413.6 ± 132.1 287.6 ± 22.6 450.0 ± 68.3 253.8 ± 18.2 430.6 ± 28.8

8.55 21.40 19.02 17.60 17.30 10.43 7.40 19.53 23.43 21.80

0.519 0.787 0.762 0.274 3.800 0.390 0.416 0.400 0.260 0.787

0.432 0.296 0.547 0.321 5.250 0.434 0.065 0.522 0.244 0.520

0.951 1.083 1.309 0.595 9.050 0.824 0.481 0.922 0.504 1.307

951.00 341.90 1199.96 225.39 13743.33 340.81 138.39 414.90 127.92 562.79

Bartail Flathead Bigeye Bleeker’s Grouper Goldspotted rabbitfish Golden Threadfin Bream Orange-spotted grouper Snubnose Pompano Tongue Sole Yellow Croaker Yellow Seafin

489.1 ± 407.0 201.7 ± 55.8 358.0 ± 150.7 174.6 ± 62.6 121.9 ± 33.3 432.3 ± 16.7 409.4 ± 36.7 184.6 ± 32.4 352.2 ± 65.4 416.6 ± 32.8

18.28 4.31 16.8 25.66 8.44 24.38 44.53 16.52 44.61 27.74

0.327 0.308 0.841 0.947 0.290 0.335 0.683 0.531 0.359 0.560

0.290 0.536 0.568 0.427 0.525 4.123 0.419 0.065 2.270 0.474

0.617 0.844 1.409 1.374 0.815 4.458 1.102 0.596 2.629 1.034

301.77 170.23 504.42 239.90 99.35 1927.15 451.16 110.02 925.93 430.76

Marine

a

The weights of the fish were expressed as averages of the samples (n = 6–30).

169

X. Wei et al. / Marine Pollution Bulletin 63 (2011) 166–171

which had fat contents of about 17.3%. The detected highest TEQ in this fish species was probably due to their diet (i.e. trash fish) and their relatively high body lipid content. The medium TEQ levels of PCDD/Fs (3.0–5.3 pg g 1 fat) were higher than the measured PCDD/ F levels of four species of Hong Kong marketable fish (0.407– 1.219 pg g 1 fat) (Tsang et al., 2009). However, it is lower than in another study (12 pg g 1 fat) in Taiwan (Hsu et al., 2007). The total TEQ contents in whole fish were calculated (Table 2). The freshwater fish meats contained relatively greater levels of total TEQ contents as compared with the marine fish meats. The TEQ contents in the freshwater fish ranged from 127.92 to 13743.33 pg-TEQ/fish while the marine fish contained 99.35– 1927.15 pg-TEQ/fish. According to a report by Dickman and Leung (1998), the average consumption of fish per person in Hong Kong is 60 kg fish/60 kg body weight/year (160 g/60 kg dw/day). Based on the present data, if an individual with 60 kg b.w. consumes 160 g of fishes in a day, dietary intakes of PCDD/Fs and dioxin-like PCBs in total might range from 1.59 to 24.13 pg-TEQ/kg b.w. per day (47.7–723.9 pg TEQ/kg b.w. per month), which is considerable higher than the international tolerable intake of dioxins, furans, and dioxin-like PCBs (70 pg WHO-TEQ/kg b.w. per month) as reported by Food and Agriculture Organization (FAO)/World Health Organization (WHO) Expert Committee on Food Additives (WHO, 2002). Our data revealed that the possible exposure levels are higher than a study in year 2003 that estimated the total exposure of Hong Kong residents to dioxins/ furans via both dietary and inhalation routes were about 0.93 pg TEQ kg 1 b.w. d 1 (Ma and Yang, 2007). Therefore our data indicated possible health risks of consuming dioxin-contaminated fishes in Hong Kong. For risk assessment, the estimated maximum levels of daily TEQ intake via fish consumption for an individual with 60 kg b.w. would be up to 1.44 ng per day (24.13 pg-TEQ/kg b.w. per day). This value did not take into account of other possible routes of dioxin exposure. Taking into consideration of the long half-life of dioxins in human bodies which is about 7–11 years (Ogura et al., 2004), significant amounts of dioxins would be accumulated in a wide range of body tissues, like fats, blood, placenta and reproductive organs (Maruyama et al., 2003). Based on this assumption and calculation, in the subsequent bioassays, nanogram level of TCDD was used to treat the primary cultures of mouse leydig and ovarian cells to reveal effects of dioxin on steroidogenesis.

3.2. Effects of TCDD on steroidogenesis of CD-1 mice ovarian cells Despite numerous studies investigated the general toxicity of TCDD in rodents, such as a cause of reproductive failure (Mandal, 2005) and developmental defect in both male and female (Bell et al., 2007; Dienhart et al., 2000), little is known about the mechanisms by which TCDD exerts its toxic effect at the cellular or molecular levels. In the present study, our data demonstrated that the primary CD-1 mice ovarian cells exposed to both 0.5 and 5 nM of 2,3,7,8-TCDD showed a dose-dependent inhibition of the synthesis of progesterone and estradiol (E2) (n = 3; P < 0.001) as compared with hCG alone treatment (Fig. 1A). The data are consistent with other studies. Moran and co-workers demonstrated that E2 production by cultured human luteinized granulose cells was inhibited by 10 nM TCDD (Moran et al., 2003). In other study, TCDD at a single oral dose of 10 lg/kg suppressed ovarian E2 production in hCG treated immature rats (Li et al., 1995). In addition to E2 synthesis, our data were in line with Pieklo’s report that treatment of ovarian theca cells or granulosa cells with 10 nM TCDD timedependently reduced progesterone production (Pieklo et al., 2000). In addition to the measurement of hormone levels, effects of TCDD on the expression levels of some key steroidogenic enzymes were determined. The expressions of the steroidogenic enzymes, StAR and P450scc were inhibited by the presence of 2,3,7,8-TCDD in the ovarian culture (Fig. 1B). This observation suggested that TCDD interfered with the process of steroidogenesis. The observation agrees with the reports that TCDD significantly inhibited FSH-induced P450scc and P45019a1 in primary granulose cells (Dasmahapatra et al., 2000). However, a report from Son showed that TCDD blocked ovulation of immature rats by a direct action on ovaries without an alteration of ovarian steroidogenesis (Son et al., 1999). 3.3. Effects of TCDD on steroidogenesis of CD-1 mice leydig cells Similar to the study in the ovarian culture, TCDD exerted a dose-dependent inhibition on the secretion of progesterone and testosterone in hCG treated leydig cells (Fig. 2A). The data are consistent with other study that revealed TCDD inhibited testosterone secretions in rat leydig cells with or without hCG co-treatment (Lai et al., 2005; Uchida et al., 2002). To decipher the mechanistic action of TCDD on testosterone synthesis, we measured the changes in the expression levels of some key

6 250

a 5

b

150

b 100

b b

a 40

b

b c 20

c

b

mRNA levels

200

Hormone levels

Ctrl(DMSO) hCG5IU/ml TDDD0.5nM TDDD0.5nM+hCG TDDD5nM TDDD5nM+hCG

a

4

a 3

a b ab

bc

2

b b b

c

c 1

c

c

b

ab

b b

b

b

0

0 P4 (nmol/L)

E2 (ng/ml)

StAR

CYPscc

CYP19a1

Fig. 1. Effects of TCDD on (A) the production progesterone (P4) and estradiol (E2) and (B) the expression levels of steroidogenic enzymes, StAR, CYPscc and CYP19a1 of primary mouse ovarian cells. Bars with the same letter are not significantly different according to the results of one-way ANOVA followed by Duncan’s multiple range test (p < 0.05).

170

X. Wei et al. / Marine Pollution Bulletin 63 (2011) 166–171

12

10 Ctrl(DMSO) hCG5IU/ml TDDD0.5nM TDDD0.5nM+hCG TDDD5nM TDDD5nM+hCG

a

a

8

ab

8

b 6

c 4

c

6

a 4

c a b d

b 2

2

0

mRNA levels

Hormone levels

10

d P4 (nmol/L)

b

c

b

b

b

b

b

b b

b

a

ab ab ab b b

d

0 T (ng/ml)

StAR

CYPscc

CYP19a1

Fig. 2. Effects of TCDD on (A) the production progesterone (P4) and testosterone (T) and (B) the expression levels of steroidogenic enzymes, StAR, CYPscc and CYP19a1 of primary mouse leydig cells. Bars with the same letter are not significantly different according to the results of one-way ANOVA followed by Duncan’s multiple range test (p < 0.05).

steroidogenic enzymes. Data showed that the reduced progesterone and testosterone levels may be attributed by the reduced expressions of StAR and P450scc mRNA (Fig. 2B). These observations were in agreement with other report using cultured leydig cell model (Mandal et al., 2001; Uchida et al., 2001). 4. Conclusion Our study reported PCDD/F and dioxin-like PCBs contamination in 20 common marketable fish species for human consumption. The freshwater fish meats contained relatively greater amounts of total TEQ contents as compared with the marine fish. Mandarin fish was contaminated with the highest levels of PCDD/Fs and dioxin-like PCBs amongst the all 20 species of fish. The negative effects of TCDD on steroidogenesis were revealed in both primary cultures of leydig and ovarian cells. Taken together the present study highlighted the risk of high frequency fish consumption in PRD. Acknowledgements This work was supported by the Super Faculty Research Grant, Hong Kong Baptist University and Collaborative Research Fund (HKBU 1/CRF/08), University Grants Committee (to Prof. C.K.C. Wong). Dioxin analysis was conducted by Dioxin Analysis Laboratory, supervised by Prof. Z.W. Cai, Department of Chemistry, Hong Kong Baptist University. Prof. Giesy was supported by the Canada Research Chair program and an at large Chair Professorship at the Department of Biology and Chemistry and State Key Laboratory in Marine Pollution, City University of Hong Kong. References Bell, D.R., Clode, S., Fan, M.Q., Fernandes, A., Foster, P.M., Jiang, T., Loizou, G., MacNicoll, A., Miller, B.G., Rose, M., Tran, L., White, S., 2007. Toxicity of 2,3,7,8tetrachlorodibenzo-p-dioxin in the developing male Wistar(Han) rat. II: Chronic dosing causes developmental delay. Toxicol. Sci. 99, 224–233. Chan, H.M., Chan, K.M., Dickman, M., 1999. Organochlorines in Hong Kong fish. Mar. Pollut. Bull. 39, 346–351. Chao, H.R., Wang, S.L., Chang, L.W., 2003. Dioxins and dioxin-like PCBs compounds in Taiwanese human milk. Epidemiology 14, S92–S93. Charnley, G., Doull, J., 2005. Human exposure to dioxins from food, 1999–2002. Food Chem. Toxicol. 43, 671–679. Cheung, K.C., Leung, H.M., Kong, K.Y., Wong, M.H., 2007. Residual levels of DDTs and PAHs in freshwater and marine fish from Hong Kong markets and their health risk assessment. Chemosphere 66, 460–468.

Cheung, K.C., Zheng, J.S., Leung, H.M., Wong, M.H., 2008. Exposure to polybrominated diphenyl ethers associated with consumption of marine and freshwater fish in Hong Kong. Chemosphere 70, 1707–1720. Choi, M.P., Ho, S.K., So, B.K., Cai, Z., Lau, A.K., Wong, M.H., 2008. PCDD/F and dioxinlike PCB in Hong Kong air in relation to their regional transport in the Pearl River Delta region. Chemosphere 71, 211–218. Cok, I., Donmez, M.K., Hakan Satiroglu, M., Aydinuraz, B., Henkelmann, B., Kotalik, J., Schramm, K.W., 2007. Concentration of polychlorinated dibenzo-p-dioxins, polychlorinated dibenzofurans and dioxin-like PCBs in human adipose tissue from Turkish men. Chemosphere 66, 1955–1961. Dasmahapatra, A.K., Wimpee, B.A., Trewin, A.L., Wimpee, C.F., Ghorai, J.K., Hutz, R.J., 2000. Demonstration of 2,3,7,8-tetrachlorodibenzo-p-dioxin attenuation of P450 steroidogenic enzyme mRNAs in rat granulosa cell in vitro by competitive reverse transcriptase-polymerase chain reaction assay. Mol. Cell. Endocrinol. 164, 5–18. Dickman, M.D., Leung, K.M., 1998. Mercury and organochlorine exposure from fish consumption in Hong Kong. Chemosphere 37 (5), 991–1015. Dienhart, M.K., Sommer, R.J., Peterson, R.E., Hirshfield, A.N., Silbergeld, E.K., 2000. Gestational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin induces developmental defects in the rat vagina. Toxicol. Sci. 56, 141–149. ECP (Earth Trends Country Profiles), 2000. Coastal and Marine Ecosystems-Hong Kong. . Fernandes, A., White, S., D’Silva, K., Rose, M., 2004. Simultaneous determination of PCDDs, PCDFs, PCBs and PBDEs in food. Talanta 63, 1147–1155. Focant, J.F., Eppe, G., Pirard, C., Massart, A.C., Andre, J.E., De Pauw, E., 2002. Levels and congener distributions of PCDDs, PCDFs and non-ortho PCBs in Belgian foodstuffs – assessment of dietary intake. Chemosphere 48, 167–179. Hedley, A.J., Wong, T.W., Hui, L.L., Malisch, R., Nelson, E.A., 2006. Breast milk dioxins in Hong Kong and Pearl River Delta. Environ. Health Perspect. 114, 202–208. Hsu, M.S., Hsu, K.Y., Wang, S.M., Chou, U., Chen, S.Y., Huang, N.C., Liao, C.Y., Yu, T.P., Ling, Y.C., 2007. A total diet study to estimate PCDD/Fs and dioxin-like PCBs intake from food in Taiwan. Chemosphere 67, S65–70. International Agency for Research on Cancer (IARC), 1997. IARC Monographs on the evaluation of carcinogenic risks to humans, vol. 69. Polychlorinated Dibenzopara-Dioxins and Polychlorinated Dibenzofurans. Available: (accessed 06.07.10). Jin, Y.H., Chen, H.C., Tang, H.J., Jin, X.H., Liu, H.F., Li, Z., Kayama, F., Humamatsu, A., Sagisaka, K., Brown, D., Clark, G., Nakamura, M., 2003. A survey on the dioxin level in breast milk in coastal and inland region. Zhonghua Yu Fang Yi Xue Za Zhi 37, 439–441. Lai, K.P., Wong, M.H., Wong, C.K., 2005. Inhibition of CYP450scc expression in dioxin-exposed rat Leydig cells. J. Endocrinol. 185, 519–527. Leng, J.H., Kayama, F., Wang, P.Y., Nakamura, M., Nakata, T., Wang, Y., 2009. Levels of persistent organic pollutants in human milk in two Chinese coastal cities, Tianjin and Yantai: influence of fish consumption. Chemosphere 75, 634–639. Li, X., Johnson, D.C., Rozman, K.K., 1995. Reproductive effects of 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD) in female rats: ovulation, hormonal regulation, and possible mechanism(s). Toxicol. Appl. Pharmacol. 133, 321–327. Ma, W.Y., Yang, R.R., 2007. Persistent organic pollutants in Hong Kong. Dev. Environ. Sci. 7, 313–373 (Chapter 7). Mandal, P.K., 2005. Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor biology. J. Comp. Physiol. B 175, 221–230. Mandal, P.K., McDaniel, L.R., Prough, R.A., Clark, B.J., 2001. 7,12Dimethylbenz[a]anthracene inhibition of steroid production in MA-10 mouse

X. Wei et al. / Marine Pollution Bulletin 63 (2011) 166–171 Leydig tumor cells is not directly linked to induction of CYP1B1. Toxicol. Appl. Pharmacol. 175, 200–208. Maruyama, W., Yoshida, K., Tanaka, T., Nakanishi, J., 2003. Simulation of dioxin accumulation in human tissues and analysis of reproductive risk. Chemosphere 53, 301–313. Moran, F.M., VandeVoort, C.A., Overstreet, J.W., Lasley, B.L., Conley, A.J., 2003. Molecular target of endocrine disruption in human luteinizing granulosa cells by 2,3,7,8-tetrachlorodibenzo-p-dioxin: inhibition of estradiol secretion due to decreased 17alpha-hydroxylase/17,20-lyase cytochrome P450 expression. Endocrinology 144, 467–473. Ogura, I., Masunaga, S., Nakanishi, J., 2004. Quantitative source identification of dioxin-like PCBs in Yokohama, Japan, by temperature dependence of their atmospheric concentrations. Environ. Sci. Technol. 38, 3279–3285. Oh, J.R., Hong, S.H., Shim, W.J., Kannan, N., 2005. A survey of polychlorinated dibenzo-p-dioxins and furans in Korean seafood-a congener-specific approach. Mar. Pollut. Bull. 50, 1121–1127. Okumura, Y., Yamashita, Y., Isagawa, S., 2004. Concentrations of polychlorinated dibenzo-p-dioxins, dibenzofurans, non-ortho polychlorinated biphenyls, and mono-ortho polychlorinated biphenyls in Japanese flounder, with reference to the relationship between body length and concentration. J. Environ. Monit. 6, 201–208. Paumgartten, F.J., Cruz, C.M., Chahoud, I., Palavinskas, R., Mathar, W., 2000. PCDDs, PCDFs, PCBs, and other organochlorine compounds in human milk from Rio de Janeiro, Brazil. Environ. Res. 83, 293–297. Pieklo, R., Grochowalski, A., Gregoraszczuk, E.L., 2000. 2,3,7,8-Tetrachlorodibenzop-dioxin alters follicular steroidogenesis in time- and cell-specific manner. Exp. Clin. Endocrinol. Diabetes 108, 299–304. Schecter, A., Quynh, H.T., Papke, O., Tung, K.C., Constable, J.D., 2006. Agent Orange, dioxins, and other chemicals of concern in Vietnam: update 2006. J. Occup. Environ. Med. 48, 408–413. Schecter, A., Wallace, D., Pavuk, M., Piskac, A., Papke, O., 2002. Dioxins in commercial United States baby food. J. Toxicol. Environ. Health A 65, 1937– 1943. Son, D.S., Ushinohama, K., Gao, X., Taylor, C.C., Roby, K.F., Rozman, K.K., Terranova, P.F., 1999. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) blocks ovulation by a

171

direct action on the ovary without alteration of ovarian steroidogenesis: lack of a direct effect on ovarian granulosa and thecal-interstitial cell steroidogenesis in vitro. Reprod. Toxicol. 13, 521–530. Srogi, K., 2008. Levels and congener distributions of PCDDs, PCDFs and dioxin-like PCBs in environmental and human samples: a review. Environ. Chem. Lett. 6, 1– 28. Tsang, H.L., Wu, S.C., Wong, C.K., Leung, C.K., Tao, S., Wong, M.H., 2009. Risk assessment of PCDD/Fs levels in human tissues related to major food items based on chemical analyses and micro-EROD assay. Environ. Int. 35, 1040– 1047. Tsutsumi, T., Amakura, Y., Sasaki, K., Maitani, T., 2007. Dioxin concentrations in the edible parts of Japanese common squid and saury. Shokuhin Eiseigaku Zasshi 48, 8–12. Uchida, T., Ohashi, Y., Morikawa, E., Tsugita, A., Takeda, K., 2001. Proteome analysis of the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on murine testicular Leydig and Sertoli cells. J. Health Sci. 47, 136–144. Uchida, T., Yoshida, S., Inui, Y., Takeda, K., 2002. Effect of 2,3,7,8-tetrachlorodibenzop-dioxin an testosterone production in isolated murine testicular cells. J. Health Sci. 48, 292–295. US EPA, 2010. EPA’s Reanalysis of Key Issues Related to Dioxin Toxicity and Response to NAS Comments (External Review Draft). US Environmental Protection Agency, Washington, DC, EPA/600/R-10/038A. World Health Organization (WHO), 2002. Exposure to Dioxins and Dioxin-like Substances: A Major Public Health Concern. Available: . WWF, 1999. Hong Kong Ranked 6th in Global Fish Consumption in the WWF (World Wide Fund for Nature Hong Kong) Living Planet Report, 1999. . Zhang, J.Q., Jiang, Y.S., Zhou, J., Jiang, J., Zhuang, Z.X., Liu, X.L., Wu, Y.N., 2005. Levels of polychlorinated dibenzo-p-dioxins and dibenzo-furans in sea fish samples in some sea areas in China. Zhonghua Yu Fang Yi Xue Za Zhi 39, 253–256. Zheng, M.H., Chu, S.G., Sheng, G.Y., Min, Y.S., Bao, Z.C., Xu, X.B., 2001. Polychlorinated dibenzo-p-dioxins and dibenzofurans in surface sediments from Pearl River Delta in China. Bull. Environ. Contam. Toxicol. 66, 504–507.