- Email: [email protected]
Fukutin mutations in congenital muscular dystrophies with defective glycosylation of dystroglycan in Korea
Neuromuscular Disorders 20 (2010) 524–530
Contents lists available at ScienceDirect
Neuromuscular Disorders journal homepage: www.elsevier.com/locate/nmd
Fukutin mutations in congenital muscular dystrophies with defective glycosylation of dystroglycan in Korea Bung Chan Lim a,1, Chang-Seok Ki b,1, Jong-Won Kim b, Anna Cho a, Min Jung Kim a, Hee Hwang a, Ki Joong Kim a, Yong Seung Hwang a, Woong Yang Park c, Yun-Jung Lim d, In One Kim d, Jun Su Lee e, Jong Hee Chae a,* a
Department of Pediatrics, Seoul National University Children’s Hospital, Seoul National University College of Medicine, Seoul, South Korea Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul, South Korea d Department of Radiology, Seoul National University Children’s Hospital, Seoul National University College of Medicine, Seoul, South Korea e Department of Pediatrics, Severance Children’s Hospital, Yonsei University College of Medicine, Seoul, South Korea b c
a r t i c l e
i n f o
Article history: Received 16 April 2010 Received in revised form 27 May 2010 Accepted 9 June 2010
Keywords: Muscular dystrophy Congenital Mutation Dystroglycan
a b s t r a c t This study was aimed to identify Fukutin (FKTN)-related congenital muscular dystrophies (CMD) with defective a-dystroglycan glycosylation in Korea and to discuss their genotype–phenotype spectrum focusing on detailed brain magnetic resonance imaging (MRI) findings. FKTN mutations were found in nine of the 12 CMD patients with defective a-dystroglycan glycosylation patients (75%). Two patients were homozygous for the Japanese founder retrotransposal insertion mutation. Seven patients were heterozygous for the retrotransposal insertion mutation, five of whom carried a novel intronic mutation that activates a pseudoexon between exons 5 and 6 (c.647+2084G>T). Compared with individuals that were homozygous for the retrotransposal insertion mutation, the seven heterozygotes for the retrotransposal insertion mutation, including five patients with the novel pseudoexon mutation, exhibited a more severe clinical phenotype in terms of motor abilities and more extensive brain MRI abnormalities (i.e., a wider distribution of cortical malformation and pons and cerebellar hypoplasia). FKTN mutations are the most common genetic cause of CMD with defective a-dystroglycan glycosylation in Korea. Compound heterozygosity of the retrotransposal insertion and the novel pseudoexon mutation is the most prevalent genotype in Korea and is associated with a more severe clinical and radiological phenotype compared with homozygosity for the retrotransposal insertion mutation. Ó 2010 Elsevier B.V. All rights reserved.
1. Introduction The identification of defective glycosylation of a-dystroglycan (a-DG) in muscle and brain as an important cause of progressive muscle degeneration and abnormal neuronal migration in the brain [1,2] led to the collective classification of a heterogeneous group of congenital muscular dystrophies (CMDs) as CMD with defective glycosylation of a-DG. To date, six genes associated with these disorders have been identified: Fukutin (FKTN; OMIM 607440), Protein-O-mannose 1,2-N-acetylglucosaminyltransferase 1 (POMGnT1; OMIM 606822), Fukutin-related protein (FKRP; OMIM 606596), Protein-O-mannosyl transferase 1 (POMT1; OMIM * Corresponding author. Address: Department of Pediatrics, Seoul National University Children’s Hospital, Seoul National University College of Medicine, 28 Yongon-Dong, Jongno-Gu, Seoul 110-744, South Korea. Tel.: +82 2 2072 3622; fax: +82 2 743 3455. E-mail address: [email protected] (J.H. Chae). 1 These authors contributed equally to this work. 0960-8966/$ - see front matter Ó 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.nmd.2010.06.005
607423), LARGE (OMIM 603590), and Protein-O-mannosyl transferase 2 (POMT2; OMIM 607439) [3–8]. Clinically, Fukuyama CMD (FCMD), muscle–eye–brain disease (MEB), and Walker–Warburg syndrome (WWS) are among the most frequently reported phenotypes of CMD with defective glycosylation of a-DG. Although the two most recent studies using large cohorts of subjects demonstrated overlapping spectra among these six genes and clinical phenotypes [9,10], each syndrome was described originally in distinct ethnic groups as having mutations in specific genes. MEB is most prevalent in the Finnish population and is associated with the high prevalence of a founder splice-site mutation in POMGnT1 [11]. The founder retrotransposal (RT) insertion mutation in the 30 untranslated region (UTR) of FKTN is responsible for the high incidence of FCMD in the Japanese population [3]. Therefore, although the genotype–phenotype spectrum of these diseases is heterogeneous, the prevalence of mutations among the listed genes may vary according to the different ethnic groups, as observed for POMGnT1 in Finland and FKTN in Japan.
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
In 2009, one Korean and one Chinese CMD patient were reported as having mutations in FKTN [12,13]. Interestingly, the RT insertion mutation, which had not been reported outside of Japan, was identified in either the heterozygous or the homozygous state in these patients. Based on the ethnic similarity between the Japanese and Korean populations, as well as on these recent reports, we hypothesized that mutation in FKTN is also prevalent in Korea. Thus, we performed a mutational analysis of FKTN in Korean patients with CMD with defective glycosylation of a-DG. We also discussed their genotype–phenotype spectrum, focusing on detailed brain magnetic resonance imaging (MRI) findings. 2. Subjects and methods 2.1. Patients and clinical data The Institutional Review Board of the Seoul National University Hospital approved the study protocol. The study subjects consisted of 12 cases diagnosed and followed at the Seoul National University Children’s Hospital from 2000 to 2008. The inclusion criteria were presence of hypoglycosylation of -DG on the sarcolemma of skeletal muscle sections, as assessed using immunohistochemistry [14], and a clinical diagnosis of CMD characterized by early onset muscle weakness or hypotonia at <2 years of age, delayed developmental milestones, and increased serum creatine kinase. Muscle biopsy specimens were unavailable for one female case; nevertheless, this patient was included in the study because she exhibited characteristic clinical findings that were highly suggestive of CMD with defective glycosylation of -DG, i.e., early onset muscle weakness, elevated serum creatine kinase (CK) levels, brain involvement, and a family history of the disease. Clinical and laboratory data, including ophthalmological findings, CK levels, presence of epilepsy or seizure, motor and language development, and family history, were reviewed. Clinical severity was classified as either severe or mild. A diagnosis of severe phenotype was attributed to patients who could not sit without support up to 5 years of age or who could not hold their head upright up to 2 years of age. A mild phenotype was attributed to patients who could sit without support or perform more complex motor tasks, regardless of age. One Korean patient [12] previously identified as having a homozygous RT insertion mutation in FKTN was included in the analysis of the genotype–phenotype spectrum. This patient was designated as Case 13. 2.2. FKTN mutational analysis 2.2.1. Three-primer PCR and direct sequencing of FKTN After obtaining informed consent, genomic DNA was extracted from either peripheral blood leukocytes or muscle samples using a Wizard Genomic DNA Purification kit, according to the manufacturer’s instructions (Promega, Madison, WI). A three-primer PCR using LAT7ura, LAT7–2, and ins385–359 was performed, as described previously [15]. Direct sequencing of all coding exons and flanking intronic sequences of the FKTN gene was performed using primer pairs designed by the authors (available upon request). PCR was performed in a thermal cycler (Model 9700; Applied Biosystems, Foster City, CA) and cycle sequencing was performed on an ABI Prism 3100xl Genetic Analyzer using the BigDye Terminator Sequencing Ready Reaction Kit (Applied Biosystems). Sequence variations were analyzed via comparison with the wild-type sequence (GenBank Accession No. NM_006731). 2.2.2. RT-PCR-based sequencing Total muscle RNA was extracted from frozen muscle biopsy specimens using TrizolÒ (Invitrogen, CA, USA) and cDNA was
525
synthesized from total muscle RNA using an iScript™ cDNA synthesis kit (Bio-Rad, CA), according to the manufacturer’s instructions. To assess the presence of splicing aberrations in the FKTN transcripts, RT-PCR-based sequencing was performed using five pairs of primers (RT-F1, CAGCCTGCTGTTGAGTGAGA; RT-R1, GCTATCCGAAACCAGCCTTC; RT-F2, TGGCTCTACTTCACAATGCAA; RT-R2, TGCTCGAGCTTCTTTATACCTACA; RT-F3, GACAGGCCAGA GTTACAGCA; RT-R3, CCATTCCACATGTGATCAGTTT; RT-F4, AGCA TTTCAGGATGCAGGAC; RT-R4, TGGTTCCCACTTATGTTTGACA; RTF5, TGGAATCTGGCCTATTTCTGA; RT-R5, GCACTAACATACCAGCTTA AATGC). PCR products were separated either on agarose gels or on ScreenTape using a Lab901 system (Lab901 Ltd., Loanhead, UK). Any PCR fragments of aberrant size were sequenced directly or after a cloning procedure using the TOPO TA Cloning Kit (Invitrogen). 2.3. Brain MRI All MRI data were reviewed by two radiologists (I.O.K. and Y.J.L.) who were blinded to the patients’ clinical history and to the results of the mutational analysis. Four categories of abnormalities were reviewed: cortical malformation (polymicrogyria and cobblestone-type lissencephaly), infratentorial cerebellar abnormalities (pons hypoplasia, cerebellar hypoplasia, and cerebellar cysts), white-matter changes, and ventricular dilatation. 2.4. Muscle immunohistochemistry Muscle samples that were collected with informed consent for diagnostic purposes were frozen in isopentane chilled with liquid nitrogen. Commercially available monoclonal antibodies to a-DG (VIA4-1; Upstate Biotechnology, Lake Placid, NY) and to b-dystroglycan (43DAG1/8D5; Novocastra, Newcastle upon Tyne, UK) were used for immunohistochemical staining. 3. Results 3.1. Clinical characteristics The detailed clinical information of the 12 cases (Cases 1–12) that were tested for FKTN mutation is presented in Table 1. Among the six cases that were followed after age 5, three cases could not sit without support. Among the six cases that were not followedup to age 5, four cases could not hold their head upright, even after 2 years of age. Seizures were present in four cases. Eye abnormalities were detected in six cases: myopia in four patients, strabismus in three patients, and cataract in two cases. Cases 8 and 12 had elder siblings with a similar clinical history that was suggestive of CMD; however, there was limited additional information, as the elder brother of Case 8 died at 7 years of age without a confirmation of the diagnosis and the parents of Case 12 refused the evaluation of the elder sister of this patient. The two maternal aunts of Case 2 seemed to suffer from a muscle disease with late onset, as assessed using history alone. 3.2. FKTN mutational analysis 3.2.1. Three-primer PCR and direct sequencing of FKTN The three-primer PCR revealed that two cases (Cases 1 and 2) were homozygous for the RT insertion mutation and seven cases (Cases 3–9) were heterozygous for the RT insertion mutation (Fig. 1A). The RT insertion mutation was present in nine of the 12 cases (75%) in at least one allele. Direct sequencing of FTKN exons and their boundaries was performed in 10 cases (i.e., seven cases that were heterozygous for the RT insertion mutation and
526
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
Table 1 Clinical features of the 12 patients tested for FKTN mutation. Case No. (sex)
Age at last evaluation
CK (year)
Best motor ability
Speech
Seizure
Eye
Muscle aDG
Case 1 (F)
2.0
Roll over
A few words
–
Reduced
Case 2 (F) Case 3 (M)
8.2 2.2**
Stand with assist No head control
– Myopia, esotropia
Reduced Reduced
2.0**
No head control
Sentences No meaningful soundsBabble
Case 4 (F)
–
Reduced
Case 5 (F)
6.6
No head control
Babble
–
Reduced
Tracheostomy
Case 6 (M) Case 7 (M)
2.9 2.2
No head control Roll over
No meaningful sounds Babble
+
Cataract Myopia
Reduced Reduced
VSD, PS
Case 8 (M) Case 9 (F)
7.9 2.0
Roll over No head control
Babble A few words
+ +
Myopia –
Reduced Reduced
Case 10 (M)
2.8**
No head control
No meaningful sounds
+
–
Reduced
Case 11 (M) Case 12 (F)
7.5 5.2
5002 (0.5) 4712 (8) 4900 (1.3) 7840 (0.6) 8566 (0.5) 3798 (3) 9208 (0.8) 5002 (7) 6758 (1.5) 4210 (2.8) 4905 (7) 948 (3)
Walk alone Sit without assist
Many single words A few words
Reduced na
Case 13 (M)*
10
3824 (10)
Sit without assist
Sentences
Esotropia Esotropia, cataract, myopia –
Others
FMHx+
FMHx+
FMHx+
na
CK, serum creatine kinase; FMHx, family history; VSD, ventricular septal defect; PS, pulmonary stenosis; na, not available. * A Korean patient reported previously [12]. ** Patients who were not followed-up after that age.
three cases in which the RT insertion mutation was not found). One novel nonsense mutation (c.346C>T, p.Gln116X) was identified via direct sequencing (Fig. 1B). 3.2.2. RT-PCR-based sequencing Sequencing of the cDNAs obtained from muscle specimens was performed in eight cases in which FKTN mutation was not found in either of the alleles (Case 3–7, Case 9–11). Case 12, for whom there were no muscle specimens available, was not included. The five RT-PCR segments were not amplified uniformly in every case, which reflected a variation in the levels of the FKTN mRNA. However, an RT-PCR fragment amplified using primer pairs RT-F2 and RT-R2 revealed the presence of different patterns among Cases 4, 5, and 7 and Cases 10 and 11 (Fig. 2A). Sequencing of the cloned
RT-PCR products corresponding to Case 7 demonstrated an insertion of 64 base pairs (bp) from the sequence of intron 5 (chromosome 9: 107, 408, 609–107, 408, 672), between exons 5 and 6 (Fig. 2B and C). Sequencing of the genomic DNA of Case 7, which contained the inserted sequence of 64 bp, led to the identification of a novel intronic variation (c.647+2084G>T) (Fig. 2D). Analysis of the remaining cases showed that this intronic variation was present in five cases (Cases 3–7), which included the three cases that exhibited an aberrant RT-PCR pattern. This intronic variation was located 6 bp away from the end of the insertion of 64 bp (plus strand). Analysis of this variation using SplicePort (http://spliceport.cs.umd.edu/) and Automated Splice Site Analysis (https://splice.uwo.ca/) predicted the presence of a novel splice site around the inserted 64 bp sequence. This variation was not found in 192 alleles of normal Korean controls. 3.3. Correlation of genotype with clinical phenotype and brain MRI features The correlations between the genotypes and the phenotypes of these patients, including brain MRI features, are summarized in Table 2. 3.3.1. Homozygotes for the RT insertion mutation Two cases (Cases 2 and 13) with homozygous RT insertion mutations exhibited a mild clinical phenotype. Although Case 1, who was 2 years old at the last follow-up, could roll over her body and sit briefly, the severity of the phenotype was not determined because of the shortness of the follow-up period. Polymicrogyria was the only cortical malformation observed in the cases that had homozygous RT insertion mutations, and was limited to the frontal or anterior temporal lobe (Fig. 3A). The infratentorial structures were not involved in any of these cases (with the exception of cerebellar cysts) (Fig. 3B). Patchy white-matter signal changes were observed in the three cases.
Fig. 1. Three-primer PCR and direct sequencing of FKTN. (A) The three-primer PCR results for the 12 cases showed the presence of homozygotes for the founder RT insertion mutation (Cases 1 and 2) and heterozygotes for the founder RT insertion mutation (Cases 3–9). (B) Novel nonsense mutation in Case 8 (c.346C>T, p.Gln116X).
3.3.2. Heterozygotes for the RT insertion mutation Six of the seven cases that were heterozygous for the RT insertion mutation, including five individuals that had the novel
527
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
Fig. 2. RT-PCR-based sequencing of FKTN. (A) ScreenTape electrophoresis of RT-PCR products using primer pairs RT-F2 and RT-R2 in Cases 7 and 11: note the presence of an additional band (arrow) in Case 7. (B) Sequencing of the RT-PCR products of Cases 7 and 11: note the presence of successive double peaks in Case 7, suggesting the insertion of additional base pairs. (C) Sequencing of cloned RT-PCR products demonstrated the insertion of sequences in intron 5, between exons 5 and 6, in Case 7. (D) Genomic DNA sequencing revealed the presence of a novel deep-intronic point mutation in Case 7 (c.647+2084G>T).
Table 2 Correlation of genotype, clinical phenotype, and brain MRI features. Case
Mutation
Clinical severity
Clinical phenotype
Brain MRI Cortical malformation
Case Case Case Case Case Case Case Case Case Case Case Case Case
1 2 13* 3 4 5 6 7 8 9 10 11 12
Homo RT Homo RT Homo RT RT/c.647+2084G>T RT/c.647+2084G>T RT/c.647+2084G>T RT/c.647+2084G>T RT/c.647+2084G>T RT/c.346C>T RT/not found No variation No variation No variation
UD M M S S S S UD S S S M M
FCMD FCMD FCMD FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD FCMD/MEB
Infratentorial cerebellar abnormalities
PMG
Cobblestone
Pons hypoplasia
Cbl hypoplasia
Cbl cyst
F, aT F, aT F F FT FT F F, aT FP F F F F
– – – T – TO TO T TO TO T – T
+ + + + + + + + + +
– – – inf. inf. inf. inf. inf. – inf. – – inf.
+ + + + + + + + + + +
vermis vermis vermis vermis vermis vermis
vermis
WM change
VD
Patchy Patchy Patchy Patchy Diffuse Diffuse Diffuse Diffuse Patchy Patchy Diffuse Patchy Diffuse
+ +, mild + + + + +, mild
PMG, polymicrogyria; cobblestone, cobblestone lissencephaly; Cbl, cerebellar; WM, cerebral white-matter; VD, ventricular dilatation; Homo RT, homozygous for retrotransposal insertion mutation; M, mild; S, severe; UD, undetermined; FCMD, Fukuyama congenital muscular dystrophy; MEB, muscle–eye–brain disease; F, frontal; T, temporal; aT, anterior temporal; FT, frontotemporal; FP, frontoparietal; TO, temporo-occipital; inf. vermis, inferior vermis.
pseudoexon mutation in one allele, were classified as having a severe clinical phenotype. The distribution of polymicrogyria was wider than in cases with homozygous RT insertion mutations. Cobblestone lissencephaly located in the temporo-occipital area was present in six cases (Fig. 3C and D). Hypoplasia of the pons was observed in the seven cases and hypoplasia of the inferior vermis was noted in six cases (Fig. 3E). Diffuse white-matter changes (four out of seven cases) and ventricular dilatation (five out of seven cases) were observed more frequently in these cases compared with cases that were homozygous for the RT insertion mutation.
4. Discussion The present study demonstrated that FKTN mutation was responsible for the majority of Korean cases of CMD with defective glycosylation of a-DG (75%, 9/12). The two major types of FKTN mutation were the RT insertion mutation in the 30 -UTR (11 of 18 alleles) and a novel pseudoexon mutation (5 of 18 alleles). Until very recently, the RT insertion mutation was found exclusively in Japanese FCMD or cardiomyopathy patients. However, the carrier frequency of the RT insertion mutation in the Korean population was estimated at 1 in 935 [15]. Thus, the possibility that
528
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
Fig. 3. Comparison of brain MRI findings between a homozygote for the founder RT insertion mutation (A and B, Case 2) and a compound heterozygote for the founder RT insertion mutation and a novel pseudoexon mutation (C–E, Case 7). (A) T2-weighted axial image demonstrating the presence of polymicrogyria in both frontal lobes. Patchy white-matter signal changes were associated. (B) T1-weighted sagittal image shows the absence of significant abnormalities in the pons and cerebellum. (C and D) T2weighted axial image demonstrating the presence of polymicrogyria in both frontal and anterior temporal lobes and cobblestone lissencephaly in both temporal lobes (arrows). Diffuse white-matter signal changes were associated. (E) T1-weighted sagittal image showing the presence of hypoplasia of the pons and of the inferior vermis of the cerebellum.
the RT insertion mutation is present in Korean CMD patients has been raised consistently. This study assessed both the presence and the prevalence of the RT insertion mutation in Korean patients with CMD with defective glycosylation of a-DG. To our knowledge, this is the largest report of CMD cases with RT insertion mutations outside of Japan. This common mutation between the Korean and Japanese populations could be explained partly by the closeness of the two populations, both geographically and ethnically. Further clarification of the origin of this mutation would require comparative haplotype analysis of patients and parents from both populations.
Although the RT insertion mutation was the most prevalent FKTN mutation in the Korean cohort, similarly to what was observed in the Japanese population, the presence of the novel pseudoexon mutation (c.647+2084G>T) rendered compound heterozygosity for the RT insertion and this novel mutation more prevalent than homozygosity for the RT insertion in the Korean population. To date, only one intronic FKTN mutation has been reported in one Japanese FCMD patient, i.e., a 1.2 kb L1 insertion in intron 7 that causes skipping of exons 7 and 8 [16]. In contrast, the c.647+2084G>T mutation is unique in that a single base-pair change in intron 5 causes the formation of a pseudoexon between
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
exons 5 and 6. This pseudoexon formed by the insertion of 64 bp from intronic sequences results in a shift in the reading frame that leads to a premature stop codon (p.Arg216SerfsX10). The elucidation of whether this mutation is specific to the Korean population would require further tests in various ethnic groups; we suggest that this novel intronic mutation should be included in the routine mutational screening of FKTN in other populations. The high prevalence of this pseudoexon mutation in the Korean population may have special therapeutic implications in the future, as patients harboring this mutation could be candidates for antisense oligonucleotide-mediated pseudoexon skipping, as suggested in a study of Duchenne and Becker muscular dystrophy patients with pseudoexon mutations in Dystrophin [17]. Another mutation identified in the FKTN exon (c.346C>T, p.Gln116X) was a novel nonsense mutation. A different mutation in the same residue (c.345_346GC>CT, p.Gln116X) was reported in a WWS patient [18]. As both the c.647+2084G>T and c.346C>T mutations identified in our patients are expected to cause severe disruption of the structure and function of FKTN, patients harboring these mutations in homozygosis should present with more severe clinical phenotypes than FCMD patients carrying the Japanese founder mutation in homozygosis. The phenotypic spectrum of FKTN mutations outside the Japanese population is largely confined to either WWS or a subtype of limb–girdle muscular dystrophy (LGMD2M), which represent the most severe and the mildest forms of a-dystroglycanopathy, respectively [18–21]. This phenotypic discrepancy between the Japanese and other populations may stem from the presence of the unique founder RT insertion mutation in the Japanese population, which is associated with reduced FTKN mRNA levels rather than with structural protein changes [3]; this could cause a phenotype that is milder than WWS or MEB. The large genotype–phenotype correlation study that was performed using Japanese FCMD patients demonstrated that compound heterozygotes for the RT insertion mutation and a point mutation are more severely affected than homozygotes for the RT insertion mutation [16]. This result was published before the description of a-dystroglycanopathies. Thus, based on the current concept regarding a-dystroglycanopathies, which postulates that the similar clinical phenotype can be caused by mutation of different genes, the phenotype of compound heterozygotes may be better classified as MEB or WWS rather than a severe form of FCMD. The present study produced similar results. While our three patients with homozygous RT insertion mutations, including the patient reported previously [12], exhibited the typical clinical course of FCMD, the remaining seven compound heterozygotes for the RT insertion mutation, including five patients with the novel pseudoexon mutation, exhibited a more severe clinical involvement in terms of motor abilities and association of eye abnormalities, which may have an overlapping spectrum with MEB. These phenotypic differences contrasted more sharply when analyzed in correlation with brain MRI findings. All seven compound heterozygotes for the RT insertion mutation showed invariable involvement of infratentorial structures, which was characterized by pons hypoplasia and cerebellar hypoplasia (inferior vermis). Moreover, radiological features of cobblestone lissencephaly (with temporo-occipital predominance), diffuse white-matter changes, and ventricular dilatation also characterized this group of patients. A similar study aiming to correlate radiological involvement with the types of FKRP mutation in CMD patients was reported [22]. Although this study failed to demonstrate specific correlations between genotypes and radiological features, further investigations of the correlation of other individual CMD-related genes with specific radiological findings are needed for a better understanding of the complex mechanisms underlying the involvement of the brain and muscle in adystroglycanopathies.
529
The remaining three cases without FKTN mutations may have mutations in other genes, such as POMT1, POMT2, POMGnT1, LARGE, and FKRP, or in other genomic regions of FKTN. We plan to analyze the other candidate genes in these three cases. However, the current strategy of mutational analysis, which usually targets the exons and their splicing junctions, may miss the Japanese founder RT insertion mutation and the pseudoexon mutation in FKTN. The careful evaluation of intronic variations that cause aberrant splicing, together with mRNA studies using muscle specimens from patients, although technically difficult and laborious, should increase the mutation detection rate and identify subgroups of patients who may be candidates for new therapeutic modalities. Author contributions Study concept and design: Bung Chan Lim, Jong Hee Chae, Hee Hwang, Ki Joong Kim, and Yong Seung Hwang. Acquisition of data: Bung Chan Lim and Anna Cho. Genetic analysis: Chang-Seok Ki, Jong-Won Kim, Woong Yang Park, Min Jung Kim, and Jong Hee Chae. Radiology review: Yun-Jung Lim and In One Kim. Drafting of the manuscript: Bung Chan Lim and Chang-Seok Ki. Critical revision of the manuscript for important intellectual content: Ki Joong Kim and Yong Seung Hwang. Obtained funding: Chang-Seok Ki and Jong Hee Chae. Administrative, technical, and material support: Min Jung Kim and Jun Su Lee. Study supervision: Jong Hee Chae and Yong Seung Hwang. Financial disclosures All authors have no conflict of interest to disclose. Acknowledgements This study was supported by a Grant from the Korea Healthcare Technology R&D project, Ministry for Health, Welfare and Family Affairs, Republic of Korea (Grant No. A080588) and by a Samsung Biomedical Research Institute Grant (Grant No. C-B0-206-1). The corresponding author had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. References [1] Michele DE, Barresi R, Kanagawa M, et al. Post-translational disruption of dystroglycan–ligand interactions in congenital muscular dystrophies. Nature 2002;418:417–22. [2] Moore SA, Saito F, Chen J, et al. Deletion of brain dystroglycan recapitulates aspects of congenital muscular dystrophy. Nature 2002;418:422–5. [3] Kobayashi K, Nakahori Y, Miyake M, et al. An ancient retrotransposal insertion causes Fukuyama-type congenital muscular dystrophy. Nature 1998;394: 388–92. [4] Yoshida A, Kobayashi K, Manya H, et al. Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev Cell 2001;1:717–24. [5] Brockington M, Blake DJ, Prandini P, et al. Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin alpha2 deficiency and abnormal glycosylation of alphadystroglycan. Am J Hum Genet 2001;69:1198–209. [6] Beltran-Valero de Bernabe D, Currier S, Steinbrecher A, et al. Mutations in the O-mannosyl transferase gene POMT1 give rise to the severe neuronal migration disorder Walker–Warburg syndrome. Am J Hum Genet 2002;71: 1033–43. [7] Longman C, Brockington M, Torelli S, et al. Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum Mol Genet 2003;12:2853–61. [8] van Reeuwijk J, Janssen M, van den Elzen C, et al. POMT2 mutations cause alpha-dystroglycan hypoglycosylation and Walker–Warburg syndrome. J Med Genet 2005;42:907–12. [9] Godfrey C, Clement E, Mein R, et al. Refining genotype phenotype correlations in muscular dystrophies with defective glycosylation of dystroglycan. Brain 2007;130:2725–35.
530
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
[10] Mercuri E, Messina S, Bruno C, et al. Congenital muscular dystrophies with defective glycosylation of dystroglycan: a population study. Neurology 2009;72:1802–9. [11] Diesen C, Saarinen A, Pihko H, et al. POMGnT1 mutation and phenotypic spectrum in muscle-eye-brain disease. J Med Genet 2004;41:e115. [12] Lee J, Lee BL, Lee M, et al. Clinical and genetic analysis of a Korean patient with Fukuyama congenital muscular dystrophy. J Neurol Sci 2009;281:122–4. [13] Xiong H, Wang S, Kobayashi K, et al. Fukutin gene retrotransposal insertion in a non-Japanese Fukuyama congenital muscular dystrophy (FCMD) patient. Am J Med Genet A 2009;149A:2403–8. [14] Dubowitz V, Sewry CA. Muscle biopsy: a practical approach. 3rd ed. Saunders; 2007. [15] Watanabe M, Kobayashi K, Jin F, et al. Founder SVA retrotransposal insertion in Fukuyama-type congenital muscular dystrophy and its origin in Japanese and Northeast Asian populations. Am J Med Genet A 2005;138:344–8. [16] Kondo-Iida E, Kobayashi K, Watanabe M, et al. Novel mutations and genotype– phenotype relationships in 107 families with Fukuyama-type congenital muscular dystrophy (FCMD). Hum Mol Genet 1999;8:2303–9.
[17] Gurvich OL, Tuohy TM, Howard MT, et al. DMD pseudoexon mutations: splicing efficiency, phenotype, and potential therapy. Ann Neurol 2008;63:81–9. [18] de Bernabe DB, van Bokhoven H, van Beusekom E, et al. A homozygous nonsense mutation in the fukutin gene causes a Walker–Warburg syndrome phenotype. J Med Genet 2003;40:845–8. [19] Godfrey C, Escolar D, Brockington M, et al. Fukutin gene mutations in steroid-responsive limb girdle muscular dystrophy. Ann Neurol 2006;60: 603–10. [20] Manzini MC, Gleason D, Chang BS, et al. Ethnically diverse causes of Walker– Warburg syndrome (WWS): FCMD mutations are a more common cause of WWS outside of the Middle East. Hum Mutat 2008;29:E231–41. [21] Silan F, Yoshioka M, Kobayashi K, et al. A new mutation of the fukutin gene in a non-Japanese patient. Ann Neurol 2003;53:392–6. [22] Mercuri E, Topaloglu H, Brockington M, et al. Spectrum of brain changes in patients with congenital muscular dystrophy and FKRP gene mutations. Arch Neurol 2006;63:251–7.
Contents lists available at ScienceDirect
Neuromuscular Disorders journal homepage: www.elsevier.com/locate/nmd
Fukutin mutations in congenital muscular dystrophies with defective glycosylation of dystroglycan in Korea Bung Chan Lim a,1, Chang-Seok Ki b,1, Jong-Won Kim b, Anna Cho a, Min Jung Kim a, Hee Hwang a, Ki Joong Kim a, Yong Seung Hwang a, Woong Yang Park c, Yun-Jung Lim d, In One Kim d, Jun Su Lee e, Jong Hee Chae a,* a
Department of Pediatrics, Seoul National University Children’s Hospital, Seoul National University College of Medicine, Seoul, South Korea Department of Laboratory Medicine and Genetics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul, South Korea d Department of Radiology, Seoul National University Children’s Hospital, Seoul National University College of Medicine, Seoul, South Korea e Department of Pediatrics, Severance Children’s Hospital, Yonsei University College of Medicine, Seoul, South Korea b c
a r t i c l e
i n f o
Article history: Received 16 April 2010 Received in revised form 27 May 2010 Accepted 9 June 2010
Keywords: Muscular dystrophy Congenital Mutation Dystroglycan
a b s t r a c t This study was aimed to identify Fukutin (FKTN)-related congenital muscular dystrophies (CMD) with defective a-dystroglycan glycosylation in Korea and to discuss their genotype–phenotype spectrum focusing on detailed brain magnetic resonance imaging (MRI) findings. FKTN mutations were found in nine of the 12 CMD patients with defective a-dystroglycan glycosylation patients (75%). Two patients were homozygous for the Japanese founder retrotransposal insertion mutation. Seven patients were heterozygous for the retrotransposal insertion mutation, five of whom carried a novel intronic mutation that activates a pseudoexon between exons 5 and 6 (c.647+2084G>T). Compared with individuals that were homozygous for the retrotransposal insertion mutation, the seven heterozygotes for the retrotransposal insertion mutation, including five patients with the novel pseudoexon mutation, exhibited a more severe clinical phenotype in terms of motor abilities and more extensive brain MRI abnormalities (i.e., a wider distribution of cortical malformation and pons and cerebellar hypoplasia). FKTN mutations are the most common genetic cause of CMD with defective a-dystroglycan glycosylation in Korea. Compound heterozygosity of the retrotransposal insertion and the novel pseudoexon mutation is the most prevalent genotype in Korea and is associated with a more severe clinical and radiological phenotype compared with homozygosity for the retrotransposal insertion mutation. Ó 2010 Elsevier B.V. All rights reserved.
1. Introduction The identification of defective glycosylation of a-dystroglycan (a-DG) in muscle and brain as an important cause of progressive muscle degeneration and abnormal neuronal migration in the brain [1,2] led to the collective classification of a heterogeneous group of congenital muscular dystrophies (CMDs) as CMD with defective glycosylation of a-DG. To date, six genes associated with these disorders have been identified: Fukutin (FKTN; OMIM 607440), Protein-O-mannose 1,2-N-acetylglucosaminyltransferase 1 (POMGnT1; OMIM 606822), Fukutin-related protein (FKRP; OMIM 606596), Protein-O-mannosyl transferase 1 (POMT1; OMIM * Corresponding author. Address: Department of Pediatrics, Seoul National University Children’s Hospital, Seoul National University College of Medicine, 28 Yongon-Dong, Jongno-Gu, Seoul 110-744, South Korea. Tel.: +82 2 2072 3622; fax: +82 2 743 3455. E-mail address: [email protected] (J.H. Chae). 1 These authors contributed equally to this work. 0960-8966/$ - see front matter Ó 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.nmd.2010.06.005
607423), LARGE (OMIM 603590), and Protein-O-mannosyl transferase 2 (POMT2; OMIM 607439) [3–8]. Clinically, Fukuyama CMD (FCMD), muscle–eye–brain disease (MEB), and Walker–Warburg syndrome (WWS) are among the most frequently reported phenotypes of CMD with defective glycosylation of a-DG. Although the two most recent studies using large cohorts of subjects demonstrated overlapping spectra among these six genes and clinical phenotypes [9,10], each syndrome was described originally in distinct ethnic groups as having mutations in specific genes. MEB is most prevalent in the Finnish population and is associated with the high prevalence of a founder splice-site mutation in POMGnT1 [11]. The founder retrotransposal (RT) insertion mutation in the 30 untranslated region (UTR) of FKTN is responsible for the high incidence of FCMD in the Japanese population [3]. Therefore, although the genotype–phenotype spectrum of these diseases is heterogeneous, the prevalence of mutations among the listed genes may vary according to the different ethnic groups, as observed for POMGnT1 in Finland and FKTN in Japan.
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
In 2009, one Korean and one Chinese CMD patient were reported as having mutations in FKTN [12,13]. Interestingly, the RT insertion mutation, which had not been reported outside of Japan, was identified in either the heterozygous or the homozygous state in these patients. Based on the ethnic similarity between the Japanese and Korean populations, as well as on these recent reports, we hypothesized that mutation in FKTN is also prevalent in Korea. Thus, we performed a mutational analysis of FKTN in Korean patients with CMD with defective glycosylation of a-DG. We also discussed their genotype–phenotype spectrum, focusing on detailed brain magnetic resonance imaging (MRI) findings. 2. Subjects and methods 2.1. Patients and clinical data The Institutional Review Board of the Seoul National University Hospital approved the study protocol. The study subjects consisted of 12 cases diagnosed and followed at the Seoul National University Children’s Hospital from 2000 to 2008. The inclusion criteria were presence of hypoglycosylation of -DG on the sarcolemma of skeletal muscle sections, as assessed using immunohistochemistry [14], and a clinical diagnosis of CMD characterized by early onset muscle weakness or hypotonia at <2 years of age, delayed developmental milestones, and increased serum creatine kinase. Muscle biopsy specimens were unavailable for one female case; nevertheless, this patient was included in the study because she exhibited characteristic clinical findings that were highly suggestive of CMD with defective glycosylation of -DG, i.e., early onset muscle weakness, elevated serum creatine kinase (CK) levels, brain involvement, and a family history of the disease. Clinical and laboratory data, including ophthalmological findings, CK levels, presence of epilepsy or seizure, motor and language development, and family history, were reviewed. Clinical severity was classified as either severe or mild. A diagnosis of severe phenotype was attributed to patients who could not sit without support up to 5 years of age or who could not hold their head upright up to 2 years of age. A mild phenotype was attributed to patients who could sit without support or perform more complex motor tasks, regardless of age. One Korean patient [12] previously identified as having a homozygous RT insertion mutation in FKTN was included in the analysis of the genotype–phenotype spectrum. This patient was designated as Case 13. 2.2. FKTN mutational analysis 2.2.1. Three-primer PCR and direct sequencing of FKTN After obtaining informed consent, genomic DNA was extracted from either peripheral blood leukocytes or muscle samples using a Wizard Genomic DNA Purification kit, according to the manufacturer’s instructions (Promega, Madison, WI). A three-primer PCR using LAT7ura, LAT7–2, and ins385–359 was performed, as described previously [15]. Direct sequencing of all coding exons and flanking intronic sequences of the FKTN gene was performed using primer pairs designed by the authors (available upon request). PCR was performed in a thermal cycler (Model 9700; Applied Biosystems, Foster City, CA) and cycle sequencing was performed on an ABI Prism 3100xl Genetic Analyzer using the BigDye Terminator Sequencing Ready Reaction Kit (Applied Biosystems). Sequence variations were analyzed via comparison with the wild-type sequence (GenBank Accession No. NM_006731). 2.2.2. RT-PCR-based sequencing Total muscle RNA was extracted from frozen muscle biopsy specimens using TrizolÒ (Invitrogen, CA, USA) and cDNA was
525
synthesized from total muscle RNA using an iScript™ cDNA synthesis kit (Bio-Rad, CA), according to the manufacturer’s instructions. To assess the presence of splicing aberrations in the FKTN transcripts, RT-PCR-based sequencing was performed using five pairs of primers (RT-F1, CAGCCTGCTGTTGAGTGAGA; RT-R1, GCTATCCGAAACCAGCCTTC; RT-F2, TGGCTCTACTTCACAATGCAA; RT-R2, TGCTCGAGCTTCTTTATACCTACA; RT-F3, GACAGGCCAGA GTTACAGCA; RT-R3, CCATTCCACATGTGATCAGTTT; RT-F4, AGCA TTTCAGGATGCAGGAC; RT-R4, TGGTTCCCACTTATGTTTGACA; RTF5, TGGAATCTGGCCTATTTCTGA; RT-R5, GCACTAACATACCAGCTTA AATGC). PCR products were separated either on agarose gels or on ScreenTape using a Lab901 system (Lab901 Ltd., Loanhead, UK). Any PCR fragments of aberrant size were sequenced directly or after a cloning procedure using the TOPO TA Cloning Kit (Invitrogen). 2.3. Brain MRI All MRI data were reviewed by two radiologists (I.O.K. and Y.J.L.) who were blinded to the patients’ clinical history and to the results of the mutational analysis. Four categories of abnormalities were reviewed: cortical malformation (polymicrogyria and cobblestone-type lissencephaly), infratentorial cerebellar abnormalities (pons hypoplasia, cerebellar hypoplasia, and cerebellar cysts), white-matter changes, and ventricular dilatation. 2.4. Muscle immunohistochemistry Muscle samples that were collected with informed consent for diagnostic purposes were frozen in isopentane chilled with liquid nitrogen. Commercially available monoclonal antibodies to a-DG (VIA4-1; Upstate Biotechnology, Lake Placid, NY) and to b-dystroglycan (43DAG1/8D5; Novocastra, Newcastle upon Tyne, UK) were used for immunohistochemical staining. 3. Results 3.1. Clinical characteristics The detailed clinical information of the 12 cases (Cases 1–12) that were tested for FKTN mutation is presented in Table 1. Among the six cases that were followed after age 5, three cases could not sit without support. Among the six cases that were not followedup to age 5, four cases could not hold their head upright, even after 2 years of age. Seizures were present in four cases. Eye abnormalities were detected in six cases: myopia in four patients, strabismus in three patients, and cataract in two cases. Cases 8 and 12 had elder siblings with a similar clinical history that was suggestive of CMD; however, there was limited additional information, as the elder brother of Case 8 died at 7 years of age without a confirmation of the diagnosis and the parents of Case 12 refused the evaluation of the elder sister of this patient. The two maternal aunts of Case 2 seemed to suffer from a muscle disease with late onset, as assessed using history alone. 3.2. FKTN mutational analysis 3.2.1. Three-primer PCR and direct sequencing of FKTN The three-primer PCR revealed that two cases (Cases 1 and 2) were homozygous for the RT insertion mutation and seven cases (Cases 3–9) were heterozygous for the RT insertion mutation (Fig. 1A). The RT insertion mutation was present in nine of the 12 cases (75%) in at least one allele. Direct sequencing of FTKN exons and their boundaries was performed in 10 cases (i.e., seven cases that were heterozygous for the RT insertion mutation and
526
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
Table 1 Clinical features of the 12 patients tested for FKTN mutation. Case No. (sex)
Age at last evaluation
CK (year)
Best motor ability
Speech
Seizure
Eye
Muscle aDG
Case 1 (F)
2.0
Roll over
A few words
–
Reduced
Case 2 (F) Case 3 (M)
8.2 2.2**
Stand with assist No head control
– Myopia, esotropia
Reduced Reduced
2.0**
No head control
Sentences No meaningful soundsBabble
Case 4 (F)
–
Reduced
Case 5 (F)
6.6
No head control
Babble
–
Reduced
Tracheostomy
Case 6 (M) Case 7 (M)
2.9 2.2
No head control Roll over
No meaningful sounds Babble
+
Cataract Myopia
Reduced Reduced
VSD, PS
Case 8 (M) Case 9 (F)
7.9 2.0
Roll over No head control
Babble A few words
+ +
Myopia –
Reduced Reduced
Case 10 (M)
2.8**
No head control
No meaningful sounds
+
–
Reduced
Case 11 (M) Case 12 (F)
7.5 5.2
5002 (0.5) 4712 (8) 4900 (1.3) 7840 (0.6) 8566 (0.5) 3798 (3) 9208 (0.8) 5002 (7) 6758 (1.5) 4210 (2.8) 4905 (7) 948 (3)
Walk alone Sit without assist
Many single words A few words
Reduced na
Case 13 (M)*
10
3824 (10)
Sit without assist
Sentences
Esotropia Esotropia, cataract, myopia –
Others
FMHx+
FMHx+
FMHx+
na
CK, serum creatine kinase; FMHx, family history; VSD, ventricular septal defect; PS, pulmonary stenosis; na, not available. * A Korean patient reported previously [12]. ** Patients who were not followed-up after that age.
three cases in which the RT insertion mutation was not found). One novel nonsense mutation (c.346C>T, p.Gln116X) was identified via direct sequencing (Fig. 1B). 3.2.2. RT-PCR-based sequencing Sequencing of the cDNAs obtained from muscle specimens was performed in eight cases in which FKTN mutation was not found in either of the alleles (Case 3–7, Case 9–11). Case 12, for whom there were no muscle specimens available, was not included. The five RT-PCR segments were not amplified uniformly in every case, which reflected a variation in the levels of the FKTN mRNA. However, an RT-PCR fragment amplified using primer pairs RT-F2 and RT-R2 revealed the presence of different patterns among Cases 4, 5, and 7 and Cases 10 and 11 (Fig. 2A). Sequencing of the cloned
RT-PCR products corresponding to Case 7 demonstrated an insertion of 64 base pairs (bp) from the sequence of intron 5 (chromosome 9: 107, 408, 609–107, 408, 672), between exons 5 and 6 (Fig. 2B and C). Sequencing of the genomic DNA of Case 7, which contained the inserted sequence of 64 bp, led to the identification of a novel intronic variation (c.647+2084G>T) (Fig. 2D). Analysis of the remaining cases showed that this intronic variation was present in five cases (Cases 3–7), which included the three cases that exhibited an aberrant RT-PCR pattern. This intronic variation was located 6 bp away from the end of the insertion of 64 bp (plus strand). Analysis of this variation using SplicePort (http://spliceport.cs.umd.edu/) and Automated Splice Site Analysis (https://splice.uwo.ca/) predicted the presence of a novel splice site around the inserted 64 bp sequence. This variation was not found in 192 alleles of normal Korean controls. 3.3. Correlation of genotype with clinical phenotype and brain MRI features The correlations between the genotypes and the phenotypes of these patients, including brain MRI features, are summarized in Table 2. 3.3.1. Homozygotes for the RT insertion mutation Two cases (Cases 2 and 13) with homozygous RT insertion mutations exhibited a mild clinical phenotype. Although Case 1, who was 2 years old at the last follow-up, could roll over her body and sit briefly, the severity of the phenotype was not determined because of the shortness of the follow-up period. Polymicrogyria was the only cortical malformation observed in the cases that had homozygous RT insertion mutations, and was limited to the frontal or anterior temporal lobe (Fig. 3A). The infratentorial structures were not involved in any of these cases (with the exception of cerebellar cysts) (Fig. 3B). Patchy white-matter signal changes were observed in the three cases.
Fig. 1. Three-primer PCR and direct sequencing of FKTN. (A) The three-primer PCR results for the 12 cases showed the presence of homozygotes for the founder RT insertion mutation (Cases 1 and 2) and heterozygotes for the founder RT insertion mutation (Cases 3–9). (B) Novel nonsense mutation in Case 8 (c.346C>T, p.Gln116X).
3.3.2. Heterozygotes for the RT insertion mutation Six of the seven cases that were heterozygous for the RT insertion mutation, including five individuals that had the novel
527
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
Fig. 2. RT-PCR-based sequencing of FKTN. (A) ScreenTape electrophoresis of RT-PCR products using primer pairs RT-F2 and RT-R2 in Cases 7 and 11: note the presence of an additional band (arrow) in Case 7. (B) Sequencing of the RT-PCR products of Cases 7 and 11: note the presence of successive double peaks in Case 7, suggesting the insertion of additional base pairs. (C) Sequencing of cloned RT-PCR products demonstrated the insertion of sequences in intron 5, between exons 5 and 6, in Case 7. (D) Genomic DNA sequencing revealed the presence of a novel deep-intronic point mutation in Case 7 (c.647+2084G>T).
Table 2 Correlation of genotype, clinical phenotype, and brain MRI features. Case
Mutation
Clinical severity
Clinical phenotype
Brain MRI Cortical malformation
Case Case Case Case Case Case Case Case Case Case Case Case Case
1 2 13* 3 4 5 6 7 8 9 10 11 12
Homo RT Homo RT Homo RT RT/c.647+2084G>T RT/c.647+2084G>T RT/c.647+2084G>T RT/c.647+2084G>T RT/c.647+2084G>T RT/c.346C>T RT/not found No variation No variation No variation
UD M M S S S S UD S S S M M
FCMD FCMD FCMD FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD/MEB FCMD FCMD/MEB
Infratentorial cerebellar abnormalities
PMG
Cobblestone
Pons hypoplasia
Cbl hypoplasia
Cbl cyst
F, aT F, aT F F FT FT F F, aT FP F F F F
– – – T – TO TO T TO TO T – T
+ + + + + + + + + +
– – – inf. inf. inf. inf. inf. – inf. – – inf.
+ + + + + + + + + + +
vermis vermis vermis vermis vermis vermis
vermis
WM change
VD
Patchy Patchy Patchy Patchy Diffuse Diffuse Diffuse Diffuse Patchy Patchy Diffuse Patchy Diffuse
+ +, mild + + + + +, mild
PMG, polymicrogyria; cobblestone, cobblestone lissencephaly; Cbl, cerebellar; WM, cerebral white-matter; VD, ventricular dilatation; Homo RT, homozygous for retrotransposal insertion mutation; M, mild; S, severe; UD, undetermined; FCMD, Fukuyama congenital muscular dystrophy; MEB, muscle–eye–brain disease; F, frontal; T, temporal; aT, anterior temporal; FT, frontotemporal; FP, frontoparietal; TO, temporo-occipital; inf. vermis, inferior vermis.
pseudoexon mutation in one allele, were classified as having a severe clinical phenotype. The distribution of polymicrogyria was wider than in cases with homozygous RT insertion mutations. Cobblestone lissencephaly located in the temporo-occipital area was present in six cases (Fig. 3C and D). Hypoplasia of the pons was observed in the seven cases and hypoplasia of the inferior vermis was noted in six cases (Fig. 3E). Diffuse white-matter changes (four out of seven cases) and ventricular dilatation (five out of seven cases) were observed more frequently in these cases compared with cases that were homozygous for the RT insertion mutation.
4. Discussion The present study demonstrated that FKTN mutation was responsible for the majority of Korean cases of CMD with defective glycosylation of a-DG (75%, 9/12). The two major types of FKTN mutation were the RT insertion mutation in the 30 -UTR (11 of 18 alleles) and a novel pseudoexon mutation (5 of 18 alleles). Until very recently, the RT insertion mutation was found exclusively in Japanese FCMD or cardiomyopathy patients. However, the carrier frequency of the RT insertion mutation in the Korean population was estimated at 1 in 935 [15]. Thus, the possibility that
528
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
Fig. 3. Comparison of brain MRI findings between a homozygote for the founder RT insertion mutation (A and B, Case 2) and a compound heterozygote for the founder RT insertion mutation and a novel pseudoexon mutation (C–E, Case 7). (A) T2-weighted axial image demonstrating the presence of polymicrogyria in both frontal lobes. Patchy white-matter signal changes were associated. (B) T1-weighted sagittal image shows the absence of significant abnormalities in the pons and cerebellum. (C and D) T2weighted axial image demonstrating the presence of polymicrogyria in both frontal and anterior temporal lobes and cobblestone lissencephaly in both temporal lobes (arrows). Diffuse white-matter signal changes were associated. (E) T1-weighted sagittal image showing the presence of hypoplasia of the pons and of the inferior vermis of the cerebellum.
the RT insertion mutation is present in Korean CMD patients has been raised consistently. This study assessed both the presence and the prevalence of the RT insertion mutation in Korean patients with CMD with defective glycosylation of a-DG. To our knowledge, this is the largest report of CMD cases with RT insertion mutations outside of Japan. This common mutation between the Korean and Japanese populations could be explained partly by the closeness of the two populations, both geographically and ethnically. Further clarification of the origin of this mutation would require comparative haplotype analysis of patients and parents from both populations.
Although the RT insertion mutation was the most prevalent FKTN mutation in the Korean cohort, similarly to what was observed in the Japanese population, the presence of the novel pseudoexon mutation (c.647+2084G>T) rendered compound heterozygosity for the RT insertion and this novel mutation more prevalent than homozygosity for the RT insertion in the Korean population. To date, only one intronic FKTN mutation has been reported in one Japanese FCMD patient, i.e., a 1.2 kb L1 insertion in intron 7 that causes skipping of exons 7 and 8 [16]. In contrast, the c.647+2084G>T mutation is unique in that a single base-pair change in intron 5 causes the formation of a pseudoexon between
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
exons 5 and 6. This pseudoexon formed by the insertion of 64 bp from intronic sequences results in a shift in the reading frame that leads to a premature stop codon (p.Arg216SerfsX10). The elucidation of whether this mutation is specific to the Korean population would require further tests in various ethnic groups; we suggest that this novel intronic mutation should be included in the routine mutational screening of FKTN in other populations. The high prevalence of this pseudoexon mutation in the Korean population may have special therapeutic implications in the future, as patients harboring this mutation could be candidates for antisense oligonucleotide-mediated pseudoexon skipping, as suggested in a study of Duchenne and Becker muscular dystrophy patients with pseudoexon mutations in Dystrophin [17]. Another mutation identified in the FKTN exon (c.346C>T, p.Gln116X) was a novel nonsense mutation. A different mutation in the same residue (c.345_346GC>CT, p.Gln116X) was reported in a WWS patient [18]. As both the c.647+2084G>T and c.346C>T mutations identified in our patients are expected to cause severe disruption of the structure and function of FKTN, patients harboring these mutations in homozygosis should present with more severe clinical phenotypes than FCMD patients carrying the Japanese founder mutation in homozygosis. The phenotypic spectrum of FKTN mutations outside the Japanese population is largely confined to either WWS or a subtype of limb–girdle muscular dystrophy (LGMD2M), which represent the most severe and the mildest forms of a-dystroglycanopathy, respectively [18–21]. This phenotypic discrepancy between the Japanese and other populations may stem from the presence of the unique founder RT insertion mutation in the Japanese population, which is associated with reduced FTKN mRNA levels rather than with structural protein changes [3]; this could cause a phenotype that is milder than WWS or MEB. The large genotype–phenotype correlation study that was performed using Japanese FCMD patients demonstrated that compound heterozygotes for the RT insertion mutation and a point mutation are more severely affected than homozygotes for the RT insertion mutation [16]. This result was published before the description of a-dystroglycanopathies. Thus, based on the current concept regarding a-dystroglycanopathies, which postulates that the similar clinical phenotype can be caused by mutation of different genes, the phenotype of compound heterozygotes may be better classified as MEB or WWS rather than a severe form of FCMD. The present study produced similar results. While our three patients with homozygous RT insertion mutations, including the patient reported previously [12], exhibited the typical clinical course of FCMD, the remaining seven compound heterozygotes for the RT insertion mutation, including five patients with the novel pseudoexon mutation, exhibited a more severe clinical involvement in terms of motor abilities and association of eye abnormalities, which may have an overlapping spectrum with MEB. These phenotypic differences contrasted more sharply when analyzed in correlation with brain MRI findings. All seven compound heterozygotes for the RT insertion mutation showed invariable involvement of infratentorial structures, which was characterized by pons hypoplasia and cerebellar hypoplasia (inferior vermis). Moreover, radiological features of cobblestone lissencephaly (with temporo-occipital predominance), diffuse white-matter changes, and ventricular dilatation also characterized this group of patients. A similar study aiming to correlate radiological involvement with the types of FKRP mutation in CMD patients was reported [22]. Although this study failed to demonstrate specific correlations between genotypes and radiological features, further investigations of the correlation of other individual CMD-related genes with specific radiological findings are needed for a better understanding of the complex mechanisms underlying the involvement of the brain and muscle in adystroglycanopathies.
529
The remaining three cases without FKTN mutations may have mutations in other genes, such as POMT1, POMT2, POMGnT1, LARGE, and FKRP, or in other genomic regions of FKTN. We plan to analyze the other candidate genes in these three cases. However, the current strategy of mutational analysis, which usually targets the exons and their splicing junctions, may miss the Japanese founder RT insertion mutation and the pseudoexon mutation in FKTN. The careful evaluation of intronic variations that cause aberrant splicing, together with mRNA studies using muscle specimens from patients, although technically difficult and laborious, should increase the mutation detection rate and identify subgroups of patients who may be candidates for new therapeutic modalities. Author contributions Study concept and design: Bung Chan Lim, Jong Hee Chae, Hee Hwang, Ki Joong Kim, and Yong Seung Hwang. Acquisition of data: Bung Chan Lim and Anna Cho. Genetic analysis: Chang-Seok Ki, Jong-Won Kim, Woong Yang Park, Min Jung Kim, and Jong Hee Chae. Radiology review: Yun-Jung Lim and In One Kim. Drafting of the manuscript: Bung Chan Lim and Chang-Seok Ki. Critical revision of the manuscript for important intellectual content: Ki Joong Kim and Yong Seung Hwang. Obtained funding: Chang-Seok Ki and Jong Hee Chae. Administrative, technical, and material support: Min Jung Kim and Jun Su Lee. Study supervision: Jong Hee Chae and Yong Seung Hwang. Financial disclosures All authors have no conflict of interest to disclose. Acknowledgements This study was supported by a Grant from the Korea Healthcare Technology R&D project, Ministry for Health, Welfare and Family Affairs, Republic of Korea (Grant No. A080588) and by a Samsung Biomedical Research Institute Grant (Grant No. C-B0-206-1). The corresponding author had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. References [1] Michele DE, Barresi R, Kanagawa M, et al. Post-translational disruption of dystroglycan–ligand interactions in congenital muscular dystrophies. Nature 2002;418:417–22. [2] Moore SA, Saito F, Chen J, et al. Deletion of brain dystroglycan recapitulates aspects of congenital muscular dystrophy. Nature 2002;418:422–5. [3] Kobayashi K, Nakahori Y, Miyake M, et al. An ancient retrotransposal insertion causes Fukuyama-type congenital muscular dystrophy. Nature 1998;394: 388–92. [4] Yoshida A, Kobayashi K, Manya H, et al. Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev Cell 2001;1:717–24. [5] Brockington M, Blake DJ, Prandini P, et al. Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin alpha2 deficiency and abnormal glycosylation of alphadystroglycan. Am J Hum Genet 2001;69:1198–209. [6] Beltran-Valero de Bernabe D, Currier S, Steinbrecher A, et al. Mutations in the O-mannosyl transferase gene POMT1 give rise to the severe neuronal migration disorder Walker–Warburg syndrome. Am J Hum Genet 2002;71: 1033–43. [7] Longman C, Brockington M, Torelli S, et al. Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum Mol Genet 2003;12:2853–61. [8] van Reeuwijk J, Janssen M, van den Elzen C, et al. POMT2 mutations cause alpha-dystroglycan hypoglycosylation and Walker–Warburg syndrome. J Med Genet 2005;42:907–12. [9] Godfrey C, Clement E, Mein R, et al. Refining genotype phenotype correlations in muscular dystrophies with defective glycosylation of dystroglycan. Brain 2007;130:2725–35.
530
B.C. Lim et al. / Neuromuscular Disorders 20 (2010) 524–530
[10] Mercuri E, Messina S, Bruno C, et al. Congenital muscular dystrophies with defective glycosylation of dystroglycan: a population study. Neurology 2009;72:1802–9. [11] Diesen C, Saarinen A, Pihko H, et al. POMGnT1 mutation and phenotypic spectrum in muscle-eye-brain disease. J Med Genet 2004;41:e115. [12] Lee J, Lee BL, Lee M, et al. Clinical and genetic analysis of a Korean patient with Fukuyama congenital muscular dystrophy. J Neurol Sci 2009;281:122–4. [13] Xiong H, Wang S, Kobayashi K, et al. Fukutin gene retrotransposal insertion in a non-Japanese Fukuyama congenital muscular dystrophy (FCMD) patient. Am J Med Genet A 2009;149A:2403–8. [14] Dubowitz V, Sewry CA. Muscle biopsy: a practical approach. 3rd ed. Saunders; 2007. [15] Watanabe M, Kobayashi K, Jin F, et al. Founder SVA retrotransposal insertion in Fukuyama-type congenital muscular dystrophy and its origin in Japanese and Northeast Asian populations. Am J Med Genet A 2005;138:344–8. [16] Kondo-Iida E, Kobayashi K, Watanabe M, et al. Novel mutations and genotype– phenotype relationships in 107 families with Fukuyama-type congenital muscular dystrophy (FCMD). Hum Mol Genet 1999;8:2303–9.
[17] Gurvich OL, Tuohy TM, Howard MT, et al. DMD pseudoexon mutations: splicing efficiency, phenotype, and potential therapy. Ann Neurol 2008;63:81–9. [18] de Bernabe DB, van Bokhoven H, van Beusekom E, et al. A homozygous nonsense mutation in the fukutin gene causes a Walker–Warburg syndrome phenotype. J Med Genet 2003;40:845–8. [19] Godfrey C, Escolar D, Brockington M, et al. Fukutin gene mutations in steroid-responsive limb girdle muscular dystrophy. Ann Neurol 2006;60: 603–10. [20] Manzini MC, Gleason D, Chang BS, et al. Ethnically diverse causes of Walker– Warburg syndrome (WWS): FCMD mutations are a more common cause of WWS outside of the Middle East. Hum Mutat 2008;29:E231–41. [21] Silan F, Yoshioka M, Kobayashi K, et al. A new mutation of the fukutin gene in a non-Japanese patient. Ann Neurol 2003;53:392–6. [22] Mercuri E, Topaloglu H, Brockington M, et al. Spectrum of brain changes in patients with congenital muscular dystrophy and FKRP gene mutations. Arch Neurol 2006;63:251–7.