Functional interactions of an upstream enhancer of the mouse glycoprotein hormone α-subunit gene with proximal promoter sequences

Molecular and Cellular Endocrinology 142 (1998) 141 – 152

Functional interactions of an upstream enhancer of the mouse glycoprotein hormone a-subunit gene with proximal promoter sequences William M. Wood *, Janet M. Dowding, Virginia D. Sarapura, Michael T. McDermott, David F. Gordon, E. Chester Ridgway Department of Medicine/Endocrinology (B-151), Uni6ersity of Colorado Health Sciences Center, 4200 East Ninth A6enue, Den6er, CO 80262, USA Received 18 March 1998; accepted 7 May 1998

Abstract Transcription of the glycoprotein hormone a-subunit gene in the pituitary is governed by different promoter elements in thyrotropes and gonadotropes. We recently identified an upstream enhancer that directs a high level of cell type specific expression in transgenic mice and stimulates proximal promoter activity in cultured aTSH and aT3 cells. To assess the contribution of promoter sequences that functionally interact with the enhancer, we mutated two proximal elements shown to be important in both thyrotrope and gonadotrope cells. Disruption of the pituitary glycoprotein hormone basal element (PGBE), which binds a LIM homeodomain protein, resulted in a decrease in basal promoter activity in both aTSH and aT3 cells. Enhancer function was completely abolished by the PGBE site mutation in aT3 gonadotropes, whereas some stimulatory activity remained in aTSH thyrotropes. Mutation of the gonadotrope specific element (GSE), which binds SF1 and is important for basal activity in gonadotropes and TRH response in thyrotropes, resulted in declines in basal and enhanced promoter activity only in aT3 cells and not in aTSH cells. Despite this decrease in enhanced activity, the GSE mutated promoter still retained some enhancer stimulated activity, suggesting that the PGBE site still functionally interacts in the absence of an intact GSE. This mutation had no effect in aTSH cells. These data suggest that although the enhancer works in both cell types it exhibits cell type specific functional characteristics. © 1998 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Glycoprotein hormone a-subunit (mouse); Enhancer; LIM homeodomain proteins; Steroidogenic factor 1

1. Introduction TSH, LH and FSH are members of a family of pituitary glycoprotein hormones that are composed of a unique b-subunit non-covalently associated with an a-subunit which is common to all three hormones. Because of this common structural role, the gene for the a-subunit is expressed in two different pituitary cell types, i.e. TSH-expressing thyrotropes and LH/FSH expressing gonadotropes. Whether expression of the a-subunit gene in both cell types is mediated by dif* Corresponding author. Tel.: +1 303 3158443; fax: + 1 303 3154525.

ferent promoter elements that interact with a different set of transcription factors is not fully understood. Previous studies with transfected thyrotrope and gonadotrope derived cells have identified regions within the proximal promoter of the a-subunit gene that are important for promoter activity in both pituitary cell types. Several promoter deletion studies have implicated the region between − 500 and − 200 of the mouse gene to be required for promoter activity in thyrotropes and gonadotropes (Sarapura et al., 1990, 1992; Horn et al., 1992; Schoderbek et al., 1992). Subsequent detailed mutational analyses have suggested that certain promoter elements are more important in gonadotropes than in thyrotropes whereas others ap-

0303-7207/98/$19.00 © 1998 Elsevier Science Ireland Ltd. All rights reserved. PII S0303-7207(98)00110-5

142

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

pear necessary in both cell types (Schoderbek et al., 1992). Specifically, mutation of the bases from −445 to − 438 decreased promoter activity in gonadotropes but not in thyrotropes, whereas disruption of the sequence between − 337 and −330 resulted in substantial decreases in promoter activity in both cell types. This region, termed the pituitary glycoprotein basal element (PGBE) because of its importance in both thyrotropes and gonadotropes, was shown by two groups to bind different but related LIM-homeodomain factors, LH2 (Roberson et al., 1994) and p-LIM (Bach et al., 1995). Several other elements in the human a-subunit 5% flanking region were reported to contribute to promoter activity in aT3 gonadotrope-derived cells. These include alpha basal elements (a-BE1 and -2) located at − 316 to − 302 and − 296 and − 285, respectively (Heckert et al., 1995), a gonadotrope specific element (GSE) between − 220 and − 202 (Horn et al., 1992), a GATA factor binding site from −156 to − 151 (Steger et al., 1994) and two E-boxes that could potentially bind members of the helix – loop – helix family of transcription factors located within 50 bp of the transcriptional start site (Jackson et al., 1995). The GSE was shown to bind a factor present in aT3 cells that was later shown to be steroidogenic factor 1 (SF1) which is not present in thyrotrope-derived aTSH cells (Barnhart and Mellon, 1994). The effect of mutating these sites on promoter activity in thyrotrope cells was not tested, except the GSE region which was shown by Pennathur et al. (1993) to be dispensable for basal activity but was required for TRH stimulation of a-subunit promoter activity in transfected dispersed rat pituitaries. A major advance in our understanding of a-subunit gene expression came with the discovery of a distal enhancer region located between − 4600 and − 3700 which directed high-level expression of a-subunit promoter-b-galactosidase fusion constructs only in thyrotropes and gonadotropes in the pituitary glands of transgenic mice (Kendall et al., 1994; Brinkmeier et al., 1998). Although not able to substantially enhance the already high promoter activity exhibited by a − 480 to + 43 a-promoter fragment in transient transfections of aTSH cells (Kendall et al., 1994), the upstream region was able to stimulate a construct containing 341 bp of a-subunit 5% flanking sequence 30-fold in aTSH cells and 8-fold in aT3 cells (Brinkmeier et al., 1998). To begin to examine which elements within the proximal promoter were mediating the enhancement, it was decided to initially mutate the two sites shown to be important for basal or regulated expression in both thyrotrope and gonadotrope cells, i.e. the PGBE and GSE sites. It is shown here that the PGBE site, but not the GSE, is required for maximal enhancement in thyrotropes. In contrast, both an intact GSE and PGBE are required for enhancer function in gonadotropes.

2. Materials and methods

2.1. Preparation of nuclear and bacterial extracts Nuclear extracts were prepared from dispersed TtT97 thyrotropic tumors and aTSH suspension cells as described previously (Sarapura et al., 1992). aT3 gonadotrope-derived cells (Windle et al., 1990) were obtained from Dr Pamela Mellon (UC San Diego), maintained in monolayer culture and nuclear extracts were prepared essentially as described previously for aTSH cells (Sarapura et al., 1992). Cultured cells were placed in medium containing 10% charcoal-stripped FCS for 48h before harvesting for extract preparation. A pGex1(l)T expression vector containing the coding region for the SF1 was obtained from Dr Keith Parker (Southwestern Medical School). Bacterial extracts expressing the SF1-protein as a fusion with glutathioneS-transferase were prepared according to a previously published procedure (Gordon et al., 1997). Control bacterial extracts were produced from E. coli DH5a transformed with pGEX-2T lacking an insert. Protein concentrations were determined by BioRad DC Protein Assay (Bio-Rad, Hurcules, CA) using BSA (Boehringer Mannheim, Indianapolis, IN) as a standard.

2.2. Generation of PGBE and GSE mutations A double PCR mutation method (Sarapura et al., 1997) was used to generate mutations within the a-subunit proximal promoter region for both DNase I protection and transfection studies. The PCR template used for the generation of the PGBE site mutation for footprinting was an Afl II to Bst EII fragment from − 579 to − 200 derived by digestion of a − 1700 to + 43 a-subunit fragment (Sarapura et al., 1990), endfilled with AMV reverse transcriptase and ligated into the Sma I site of pGEM7zf+ . For the initial PCR reactions the SP6 primer was used in conjunction with a sense primer with the sequence − 350 ATATCAGGTACTTGCGGCCGCAAATGTGCTACTC −317 where a GC-rich Not I site (underlined) replaced PGBE bases − 337 through to − 330. The complementary antisense primer was paired with the T7 primer and the products of the first PCR were combined and reamplified with the SP6 and T7 primers to generate the full-length mutated fragment. Following digestion with Kpn I and Hind III, the fragment was recloned into the pGEM plasmid. For transfection studies, the PGBE site was mutated in the context of the 859 bp enhancer fused to the − 341 to + 43 a-subunit fragment in pSELECT1 whose construction was described previously (Brinkmeier et al., 1998). A sense primer which spanned the enhancer/promoter junction with the sequence 5% CAGATCCCCACTTGCGGCCGCAAATGTGCTACTC 3% (the A at position − 341 is in bold

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

and the replacement Not I site underlined as before) was paired with the SP6 primer and the primer complementary to the junction sequence was used with T7. The product of the subsequent combined PCR reaction was digested with Kpn I and Hind III and ligated between the same sites of pA3LUC. The PGBE mutation in the context of the −341 construct lacking the enhancer was created by directly amplifying the mutated enhancer containing construct in pA3LUC using a primer whose sequence is complementary to the sequence coding for amino acids 4 – 10 of luciferase in conjunction with a sense oligonucleotide whose sequence 5% GCGAGTACTTGCGGCCGCAAATGTGC 3% corresponds to the region from−341 (A in bold) to −322 of the a-subunit sequence with the mutated PGBE site (underlined). Also underlined is a Sca I site which allowed the resultant mutated fragment to be reinserted after digestion with Sca I and Hind III, into the Sma I and Hind III sites of pA3LUC thus regenerating the identical upstream junction as the unmutated construct. The GSE site mutation was initially generated from the enhancer/promoter fusion in pSELECT1 as described above using the sense and antisense primer with the sequence (sense) 5% CTTCATAAGCTGTTTCTAGAATCACCACTACCTC 3% with the underlined bases altered as described in the mutational strategy in the legend to Fig. 4. The enhancer lacking − 341 GSE mutated construct was generated by the same strategy described above by direct PCR of this construct using a Sca I-containing wild type primer and the luciferase primer. The region used for footprinting the GSE site was obtained by digesting the enhancer lacking wild type and mutated proximal −341 pA3LUC constructs with Bam HI (upstream of the −341 site in the vector sequence) and Pvu II ( −62) and cloning this between the Bam HI and Sma I sites of pGEM7zf+ . All mutated areas and ligation boundaries were verified by sequencing.

2.3. DNase I protection analysis DNA fragments containing the wild type or mutated PGBE and GSE sites were excised from the pGEM plasmids generated as described in the previous section using Eco RI and Mlu I. This generated 5% overhangs that allowed specific end labeling by end filling with AMV reverse transcriptase and either 32P-a-labeled dATP and TTP (Eco RI end) or dCTP and dGTP (Mlu I end) as described (Wood et al., 1996). DNase I protection assays were carried out as described previously (Sarapura et al., 1992). Briefly, radiolabeled probes were allowed to interact with l0 mg of bovine serum albumin (no extract), 90 mg of bacterial SF1 extract protein or 60 – 70 mg of pituitary cell nuclear extract protein and then digested with DNase I digestion under defined conditions, and analyzed on 5% polyacrylamide –8 M urea gel.

143

2.4. Transient transfection and reporter gene assay Transient transfections using electroporation for aTSH (3× 106 cells) and aT3 (4×106) cells and calcium phosphate in CV-1 cells (750000 cells plated) were performed as previously described (Brinkmeier et al., 1998). A volume of 20 mg of wild type or mutated a-subunit promoter luciferase constructs were used for the aTSH and aT3 cell transfections and 10 mg were used for CV-1 cells. A volume of 2 mg of CMV-directed b-galactosidase plasmid was included as an internal control of transfection efficiency. Transfections were carried out in duplicate with a Rous sarcoma virus promoter luciferase and a promoterless pA31uc vectors as positive and negative controls. Experiments were performed at a minimum of three times with at least two preparations of each plasmid. After 24–48 h, luciferase and b-galactosidase activities were measured from duplicate aliquots of freeze–thawed cytoplasmic lysates. Luciferase activities of mutant constructs were normalized to the b-galactosidase value and expressed as a percent of the activity of the wild type control in the various cell types. In some experiments the activity of constructs containing the enhancer is expressed as fold stimulation over the same construct lacking the enhancer.

3. Results

3.1. Mutation of the PGBE site abrogates interaction with proteins present in thyrotropes and gonadotropes To determine what sequences within the proximal area of the a-subunit promoter were necessary for enhancer activity, this study focussed on the two areas that were shown to be important for expression in pituitary-derived a-subunit expressing cells. The first area is the PGBE region first defined by Schoderbek et al. (1992) who showed that mutation of the eight bases from − 337 to − 330 had a dramatic effect on promoter activity in transiently transfected aTSH thyrotropes and aT3 gonadotropes. The same group subsequently showed that these eight bases were part of a larger imperfect palindrome that extends from −342 to − 329 (Roberson et al., 1994). Using this region to screen an expression library from aT3 cells, they isolated a protein, that was the mouse homolog of a previously described rat LIM homeodomain family member, LH2, involved in blood and brain cell differentiation (Xu et al., 1993). Extracts of bacteria expressing a homeodomain fragment of mouse LH2 bound specifically to the PGBE site in gel mobility shift assays and also footprinted the region of the a-subunit promoter between − 343 and − 326 (Roberson et al., 1994). They further showed that selected mutations

144

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

within the palindrome including the 8 bp between − 337 and −330 abrogated binding to the PGBE region in gel shifts with both aT3 nuclear extracts as well as a purified recombinant LH2 homeodomain fragment. We decided to mutate these same 8 bp by replacing the AT-rich sequence AGCTAATT from − 337 to −330 with a GC-rich Not I site (GCGGCCGC) in the context of the − 341 to +43 promoter and examine the effects on both proximal promoter activity and its stimulation by the upstream enhancer. Because the mutated area was extremely close to position − 341, we subjected a more extensive fragment from − 580 to − 200 with both wild type and mutated PGBE sites to DNase protection analysis to assess the effect of the mutation on interaction with a-subunit expressing cell nuclear extracts. Fig. 1A shows that an area from − 350 to − 323 is clearly protected using extracts derived from gonadotropes (aT3 cells) and authentic TSH-producing thyrotrope tumors (TtT-97). Of interest the TtT-97 footprint extends 10 bp downstream to position −313, suggesting interaction with another factor in thyrotropes which is not present in gonadotropes. Also shown in Fig. 1B is a similar analysis using the same fragment with the nucleotides from − 337 to −330 mutated to a GC rich Not 1 site which was shown by Roberson et al. (1994) to abrogate LH2

homeodomain and aT3 extract binding by gel mobility shift analysis. Here we see that the nuclear extracts are no longer able to interact with the mutated PGBE site.

3.2. An intact PGBE site is important for basal acti6ity of the proximal a-subunit promoter in thyrotropes and gonadotropes Having demonstrated that mutation of the PGBE region results in loss of interaction with a protein(s) present in thyrotrope and gonadotropes, we now assessed its effect on basal promoter activity in transiently transfected a-expressing cells. Schoderbek et al. (1992) had previously reported 5- and 23-fold decreases in aTSH and aT3 cells respectively as a result of introducing a PGBE site mutation in a fragment extending from − 507 to + 46. Fig. 2 shows that in the context of a fragment containing 341 bp of flanking sequence, promoter activity was decreased to a lesser extent, only 2-fold in aTSH cells and 5-fold in aT3 cells (panels A and B, respectively). These fold reductions are similar to those seen when the PGBE site is deleted by truncation of the promoter to position −297 (Fig. 2A and B). In a cell which does not express the endogenous a-subunit gene, i.e. monkey kidney CV-1 cells, only a modest effect of the PGBE mutation on promoter activity is seen (Fig. 2C). The lesser reductions seen with the shorter mutated promoter constructs (to − 341) suggest that more upstream sequences between − 507 and − 341 require an intact PGBE site in order to exert their function. Such an interaction was reported by Rosenfeld and coworkers (Bach et al., 1997) to involve another homeodomain protein pOTX which binds to the a-subunit promoter region between −400 and −380 and the LH2-related protein pLIM which also binds to the PGBE region. However, the functional synergy observed required the action of another mediating protein termed cLIM.

3.3. Enhancer-stimulated a-subunit promoter acti6ity is decreased dramatically in both cell types by the PGBE site mutation Fig. 1. Mutation of nucleotides from − 337 to − 330 of the mouse a-subunit promoter disrupts binding of nuclear extracts derived from a-subunit expressing thyrotrope and gonadotrope cells. A DNA fragment containing 380 bp of the a-subunit promoter ( − 580 to −200) either intact (panel A) or with the PGBE site altered by mutation of nucleotides − 337 to − 330 (panel B) was labeled at the downstream −200 site and subjected to DNase footprinting using BSA (¥) and nuclear extracts of either aT3 cells or cells dispersed from TtT-97 thyrotropic tumor tissue. The open box denotes the location of the footprinted area encompassing the PGBE site. The footprint produced by TtT-97 extracts is shown as a box extended to position − 313. A cross signifies the area altered by mutation. Nucleotide positions were calculated relative to a sequencing ladder run in a parallel lane (not shown).

As previously reported, fusion of the upstream enhancer greatly increased the capacity of the −341 promoter to direct activity of a luciferase reporter in both thyrotrope and gonadotrope cell lines (Brinkmeier et al., 1998). To see if this enhanced activity was affected by mutation of the PGBE site, we introduced the mutation into the enhancer-promoter fusion constructs and compared its expression to the corresponding wild type construct in both cell types. As can be seen in Fig. 3A vs B, loss of interaction at the PGBE site had a more dramatic effect on enhanced promoter

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

145

3.4. Interaction at the PGBE site is absolutely required for the enhancer region to stimulate the proximal promoter in gonadotropes but not in thyrotropes

Fig. 2. Effect of PGBE site mutation on basal activity of a-subunit promoter constructs in various cell types. A volume of 20 mg of a luciferase plasmid containing the indicated 5% region of the a-subunit promoter either intact or harboring a mutation (black cross) of the PGBE were electroporated into 3 × 106 aTSH cells (A) or 4 × 106 aT3 cells (B). A 10-mg volume of the indicated plasmids were also transfected using Ca2PO4 precipitation into 0.75 ×106 CV-1 cells (C). P and G denote the locations of the PGBE and GSE, respectively. A CMV b-galactosidase expression plasmid was also included to normalize transfection efficiency. After 16–20 h incubation at 37°C after electroporation or 48 h following Ca2PO4 treatment, cell extracts were prepared and luciferase and b-gal activities were measured. Shown is the luciferase activity of each construct corrected for b-gal and expressed relative to the activity of the wild type − 341 construct9 S.E.M. for n determinations. Transfections were carried out with at least two different preparations of each plasmid.

activity reducing it by 12-fold in aTSH cells and more than 30-fold in aT3 cells. Again no effect of a mutated PGBE site was seen in CV-1 cells (Fig. 3C). A comparison of the greater decreases in enhanced promoter activity with that of the basal activities of the −341 promoter lacking the enhancer suggests as was the case for the − 507 promoter constructs that an intact PGBE site is required for the enhancer region to exert its stimulatory action.

Although the PGBE site mutation resulted in substantial decreases in enhanced a-promoter activity in both cell types, the effect was greater in gonadotropes (\ 30- vs 12-fold). We therefore sought to determine if these decreases reflected a total or only a partial loss of the ability of the enhancer to stimulate the proximal promoter. Fig. 3 also shows that although significantly reduced from the 30-fold stimulation exhibited by the wild type construct in aTSH thyrotropes, the proximal promoter with the PGBE site mutation still retains the capacity to be stimulated 3–4-fold by the upstream enhancer (Fig. 3D). In contrast, in aT3 cells, loss of interaction at the PGBE site results in complete abrogation of the 7-fold stimulation seen with the unmutated proximal promoter (Fig. 3E). In CV-1 cells the PGBE mutation resulted in an increase in the stimulatory capacity of the enhancer from 2- to 5-fold (Fig. 3F). This agrees with our previous results where a promoter construct extending to − 297 which lacks the PGBE site also exhibited a greater degree of stimulation in CV-1 cells (Brinkmeier et al., 1998). These results suggest that the PGBE site may play a role in suppressing the enhancers function in non a-subunit expressing cells but there is an absolute requirement for interaction at the PGBE site for the enhancer to function in gonadotropes whereas in thyrotropes some residual enhancement still remains.

3.5. Disruption of the GSE region of the mouse a-subunit promoter results in loss of interaction with gonadotrope cell nuclear extracts and steroidogenic factor 1 The second area downstream of −341 that we chose to examine in this study is the gonadotrope specific element (GSE) just upstream of − 200 in both the human and mouse genes that is protected by gonadotrope cell extracts and also binds the steroidogenic factor SF1. Additionally, mutations of both G residues of the consensus AGGTCA binding site in the human gene resulted in a 50% decrease in activity of a −224bp promoter fragment in aT3 cells (Horn et al., 1992). Jameson and colleagues also reported that mutations within this region resulted in loss of TRH stimulation of a human promoter construct in dispersed cell preparations of rat pituitaries (Pennathur et al., 1993) suggesting a role in thyrotropes. Fig. 4 shows a sequence comparison of the human and mouse 5% flanking regions in the vicinity of the human SF1 consensus site. Asterisks denote individual nucleotide differences between the two sequences. Directly above the human sequence are the C to T mutations that reduced activity

146

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

Fig. 3. Effect of PGBE site mutation on the enhancement of the − 341 to + 43 a-subunit promoter construct conferred by the upstream region in various cell types. Constructs were generated with the upstream 859-bp region (a-ENH) fused to the proximal a-subunit promoter extending to − 341 with and without the PGBE site mutation (shown by a cross) and transfected into the various cell types shown. Plasmid amounts, transfection conditions and relative normalized luciferase activities9 S.E.M. for n determinations in the three cell types (A, B and C) were as described in Fig. 2. Also shown for each cell type, in D, E and F, is the fold stimulation by the enhancer of the activity exhibited by the −341 construct with or without the PGBE mutation 9 S.E.M. for n determinations. In panels D, E and F the corresponding activities of the constructs lacking the enhancer are denoted by lines set to a value of 1.

of the human promoter in gonadotropes (Horn et al., 1992) and on the line above are the nucleotide changes shown to blunt TRH stimulation in rat pituitaries (Pennathur et al., 1993). Shown in bold are perfect SF1 consensus sites. In the human gene this site was shown to interact with recombinant SF1 as well as with gonadotrope cell nuclear extracts (Barnhart and Mellon, 1994). Since the differences between the two sequences

Fig. 4. Sequence comparison of the human and mouse a-subunit gene 5% flanking regions in the vicinity of the GSE. The areas of the corresponding 5% flanking regions (bounded by the numbers shown) of the human and mouse a-subunit genes are shown. Asterisks denote differences between the two sequences. Perfect consensus nuclear hormone binding motifs are in bold. Above the human sequence are the two mutations introduced by Horn et al. (1992) and the six alterations made by Pennathur et al. (1993). Below the mouse sequence are the eight base changes introduced in the mouse sequence in this report to disrupt both potential consensus sites.

alters the equivalent region of the mouse gene but creates a perfect consensus AGGTCA motif just downstream, we decided to mutate an 8-bp segment (shown below the mouse sequence) which should destroy both potential SF1 sites specifically at the two critical G residues. To see how these base changes affected the binding of a-expressing cell extracts as well as recombinant SF1 protein, we performed DNase I protection analyses utilizing a fragment encoding either the wild type or mutated sequences. As is shown in Fig. 5A, a protected region from − 220 to −200 is seen with aT3 gonadotrope cell extracts which corresponds to the same footprint produced by a bacterial extract expressing SF1. When the fragment with the mutations designed to destroy the SF1 sites was analyzed, the protected regions were no longer observed (Fig. 5B) proving that the mutated region was no longer able to bind SF1 or interact with a protein, presumably SF1, present in gonadotrope cells. Protection of this region was not observed with aTSH thyrotrope cell extracts with the wild type or mutated regions which supports the reported lack of SF1 protein in thyrotrope cells (Barnhart and Mellon, 1994).

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

147

in the human gene which contributes to promoter activity in aT3 cells (Heckert et al., 1995) could be responsible for the lesser effect of the GSE mutation.

3.7. Enhancer-stimulated a-subunit promoter acti6ity is dependent on the GSE in gonadotropes but not in thyrotropes The effect of the GSE mutation in the proximal promoter on the increased activity seen in the presence of the enhancer was next assessed in both a-expressing cell lines. Fig. 7 shows that proximal promoter enhancement by the upstream region was not reduced by mutating the GSE site in aTSH thyrotropes or CV-1 cells (panels A and C). However, as was seen for the PGBE mutation in both thyrotropes and gonadotropes, Fig. 5. Mutation of nucleotides from −212 to − 205 of the mouse a-subunit promoter disrupts binding of gonadotrope cell nuclear extracts and recombinant SF1. A DNA fragment containing 280 bp of the a-subunit promoter ( − 341 to − 62) either intact (panel A) or with the GSE site altered by mutation of nucleotides −212 to −205 (panel B) was labeled at the downstream − 62 site and subjected to DNase footprinting using BSA (¥) and nuclear extracts of either aT3 or aTSH cells as well as a bacterial extract expressing SF1. The SF1 reactions were exposed to the two DNase amounts (ng) shown. The open box denotes the location of the footprinted area encompassing the GSE site. A cross signifies the area altered by the mutation. Nucleotide positions were calculated relative to a sequencing ladder run in a parallel lane (not shown).

3.6. The GSE site is critical for basal promoter in gonadotropes but not in thyrotropes A promoter luciferase construct containing − 341 to + 43 of the a-subunit promoter with the above described mutation at the GSE was transfected into both aTSH thyrotropes and aT3 gonadotropes and its activity compared to the equivalent construct with an intact GSE site. Fig. 6 shows that loss of binding of gonadotrope proteins, including SF1, at this site had no effect on the proximal promoter activity in aTSH cells or non-pituitary CV-1 cells (panels A and C). However, an intact GSE was crucial for basal promoter activity in aT3 cells which decreased 12-fold with the mutated GSE construct (panel B). This is a more dramatic decrease than that reported by two other groups who observed only 2-fold reductions in aT3 cells after introducing mutations into the GSE site in a human promoter construct extending to either −244 (Horn et al., 1992) or to −1500 (Heckert et al., 1995). The former mutated the two G residues within the SF1 consensus site whereas the latter altered 10 bp encompassing the element. In studies with dispersed rat pituitary cells, Pennathur et al. (1993) showed no effect of mutating this region on basal activity of a human promoter extending to − 422. The presence of a functional CRE

Fig. 6. Effect of GSE site mutation on basal activity of a −341 to + 43 a-subunit promoter construct in various cell types. A total of 20 mg of a luciferase plasmid containing the indicated 5% region of the a-subunit promoter either intact or harboring a mutation of the GSE (black cross) were transfected into aTSH cells (A), aT3 cells (B) or CV-1 cells (C) as described in Fig. 2. P and G denote the locations of the PGBE and GSE, respectively. Relative normalized luciferase activities 9S.E.M. for n determinations were as described in Fig. 2.

148

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

Fig. 7. Effect of GSE site mutation on enhancement of the activity of the −341 to + 43 a-subunit promoter construct conferred by the upstream region in various cell types. Constructs were generated with the upstream 859-bp region (a-ENH) fused to the proximal a-subunit promoter extending to −341 with and without the GSE site mutation and transfected into the various cell types shown. Plasmid amounts, transfection conditions and relative normalized luciferase activities and fold stimulations 9 S.E.M. for n determinations were as described in Fig. 3.

the decrease in enhanced activity as a result of the GSE mutation in gonadotropes was greater than that seen with the proximal promoter lacking the enhancer (\ 30- vs 12-fold, respectively) again suggesting that elements within the upstream enhancer participate in a functional interaction in gonadotrope cells with the proximal GSE site.

functionally interact with the proximal promoter in the absence of binding of a factor, presumably SF1, at the GSE site. In thyrotrope cells the GSE site, although perhaps involved in responses to TRH (Pennathur et al., 1993), appears to be dispensable for basal and enhancer stimulated a-subunit promoter activity.

3.8. Stimulation of a-subunit proximal promoter acti6ity by the upstream enhancer is unaffected by the GSE mutation in thyrotropes but is reduced in gonadotropes

4. Discussion

We looked to see whether abrogation of binding to the GSE site in the proximal region had an effect on the degree of stimulation by the enhancer. The results of these experiments are also shown in Fig. 7. As expected from the earlier results on basal and enhanced promoter activity, no effect of the GSE site mutation on fold stimulation by the enhancer was observed in aTSH thyrotropes or CV-1 cells. In aT3 gonadotropes, the enhancer region, however, was still able to stimulate the proximal promoter with the mutated GSE site by 2.5fold. This retention of stimulation in gonadotrope cells suggests that elements within the enhancer can still

Restricted expression of the glycoprotein hormone a-subunit gene to thyrotropes and gonadotropes of the pituitary gland of transgenic mice is governed by specific elements within the proximal 500 bp of the 5% flanking region (Kendall et al., 1994). However, greatly enhanced levels of cell type specific expression required 4600 bp of flanking DNA which was not supported by a transgene construct containing 3700 bp. The region between − 4600 and − 3700 itself was able to confer a similar high level of expression when fused to a proximal promoter region extending from − 341 to +43. This enhanced expression was seen not only in transgenic mice but also in transiently transfected aTSH thyrotrope and aT3 gonadotrope derived cell lines (Brinkmeier et al., 1998). Several elements within this

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

149

Fig. 8. Schematic of the upstream enhancer region of the a-subunit gene. Shown is a linear representation of the region of the a-subunit 5% flanking region between a Kpn I site at − 4600 and a Bgl II site at −3700. The positions of various Pst I sites used in subcloning for sequencing are shown. Areas repeated in other genomic locations are designated by boxed regions R1 – 3. Circled letters denote the locations of sequences with homolgy to nuclear hormone response element half sites or HREs (H), Msx-1 binding sites (M), Spl binding sites (S) and cAMP response elements or CREs (C).

proximal region have been shown to contribute to a-subunit promoter activity in transfected pituitary and placental derived cells. Among these are the PGBE and GSE sites which have been implicated as playing a role in both basal or regulated a-subunit promoter activity in cells derived from both pituitary cell types that express the endogenous gene, i.e. thyrotropes (Pennathur et al., 1993) and gonadotropes (Horn et al., 1992). In this report we show that functional interaction between the upstream enhancer and the proximal promoter is dependent on the interaction of factors at both of these proximal elements. In both thyrotropes and gonadotropes loss of interaction of a LIM homeodomain factor at the PGBE site results in decreased promoter activity in the absence and presence of the upstream enhancer region. However, while disruption of the PGBE site totally abrogates the enhancer function in gonadotropes, a 3 – 4-fold enhancement was still retained in thyrotropes. This suggests that in the thyrotrope a site or sites other than the PGBE within the proximal region is still able to interact functionally and mediate residual enhancer function. Since we previously showed that enhancer effectiveness is reduced to only 1.5-fold by deletion to −297 (Brinkmeier et al., 1998), the other site of enhancer stimulation probably lies upstream of −297. This region contains the aBE-1 site which has been shown to bind proteins of 54 and 56 kDa and to play a role in a-subunit promoter activity in aT3 gonadotropes (Heckert et al., 1995). However its contribution in thyrotropes was not examined. The observation that mutation of the PGBE site affected both enhancer function and LIM homeodomain factor binding, attests to a role for a member of the LIM homeodomain family as a mediator of the stimulating capacity of the upstream enhancer. LH2, the family member shown by Maurer’s group to bind to the PGBE site and to activate the mouse a-subunit proximal promoter when cotransfected into non-pituitary COS cells, is present in aTSH and aT3 cells and also at a lesser abundance in the adult mouse pituitary gland by Northern blot analysis (Roberson et al., 1994). However, it is found in other tissues and plays an

important role in differentiating blood cells and brain and eye development (Xu et al., 1993; Porter et al., 1997). A more probable candidate is pLIM (also known as mLIM3 or Lhx3) which has more restricted expression to the adult pituitary gland (Seidah et al., 1994) and is present in aTSH and aT3 cells (Seidah et al., 1994; Bach et al., 1995) as well as cells of the somatomammotrope lineage (Seidah et al., 1994). It is first expressed at embryonic day 9.5 which just precedes the onset of a-subunit expression (Bach et al., 1995) and is also transiently expressed in the developing neural crest and brainstem (Seidah et al., 1994; Zhadanov et al., 1995). Mice deficient for pLIM lacked both the anterior and intermediate lobes of the pituitary (Sheng et al., 1996). pLIM has been shown to functionally interact with other homeodomain factors which may bind to the upstream enhancer region. It was shown to synergize with Pit-1 on the prolactin, TSHb and Pit-1 promoters, but not the a-subunit promoter (Bach et al., 1995). Although Pit-1 protein is present in pituitary thyrotropes, protein expression was not detectable in aTSH cells (Gordon et al., 1993), which exhibit abundant a-subunit expression (Akerblom et al., 1990). Other homeodomain proteins have been shown to interact with the region upstream of − 341 at sites important for promoter activity in thyrotropes. Our laboratory has recently reported that Msx-l, a homeobox protein that plays a role during embryogenesis in craniofacial development (Hill et al., 1989; Robert et al., 1989; MacKenzie et al., 1991a,b), bound to the a-subunit flanking region between −449 and −421 and that mutation of two AT-rich homeobox-like consensus sites resulted in a reduction in promoter activity in aTSH thyrotropes (Sarapura et al., 1997). Although no interaction of pLIM with Msx-1 has been reported there are several AT rich sequences that are potential sites of Msx-1 interaction within the enhancer sequence1 (M in Fig. 8) including an area 1 The genomic DNA sequence of the 859 bp upstream enhancer region of the a-subunit of the mouse glycoprotein hormones has been entered in Genbank, accession number AF044976.

150

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

which has 15 of 20 matches with the region of the a-subunit 5% flanking region between −439 and −420 (R3 in Fig. 8) which binds Msx-1 (Sarapura et al., 1997). The other homeodomain family protein that binds to the proximal region is pOTX, which interacts at a site between − 400 and −380 and was shown recently to synergize with pLIM on the a-subunit promoter but only in the presence of a novel co-adaptor protein cLIM (Bach et al., 1997). Although there are no discernible pOTX consensus sites within the enhancer region, a potential interaction cannot be discounted since authentic binding sites were found to vary from the consensus (Lamonerie et al., 1996). An interesting finding of this report was that mutation of the GSE site abrogated both basal promoter activity and enhancer augmented a-subunit promoter activity but only in gonadotropes derived aT3 cells. Neither activity was affected by disrupting binding at the GSE area in thyrotropes. Although mutations at this site appeared to interfere with the TRH response of a transfected human a-promoter construct in primary rat pituitary cells (Pennathur et al., 1993), it was not unexpected that it does not contribute to basal or enhanced activity in thyrotropes since the factor shown to interact at this site, SF1, is not present in aTSH cells (Barnhart and Mellon, 1994) and is restricted to FSH and LH staining cells in the pituitary gland (Ingraham et al., 1994). However, this observation may represent a major difference in how the enhancer functions in gonadotropes as compared to thyrotropes and suggests the presence of a novel element within the enhancer that functionally interacts with SF1 at the GSE in a gonadotrope-specific fashion. However, we previously showed that a construct containing an intact GSE site but not the PGBE area (deleted to − 297) was stimulated only 2-fold in gonadotropes (Brinkmeier et al., 1998). This result implicates a role for the PGBE site for functional interaction of the enhancer with the GSE. SF1, an orphan member of the nuclear hormone receptor superfamily, was first identified as a factor that binds to and regulates genes of the corticosteroid biosynthetic pathway in the adrenal cortex (Lala et al., 1992; Honda et al., 1993). It was subsequently shown to be present in the gonads (Ikeda et al., 1993) and in cells derived from a precursor to the pituitary gonadotrope (Barnhart and Mellon, 1994). SF1 has been shown to functionally interact with a number of other transcription factors. For example, it has been shown to synergize with the estrogen receptor to activate salmon LHb subunit expression (Drean et al., 1996), it is required along with Spl for efficient expression of the bovine CYP11A gene in adrenal Y1 cells (Liu and Simpson, 1997), and modulates the response of the human steroid acute regulatory (StAR) protein pro-

moter to cAMP (Sugawara et al., 1997). The location of potential binding sites within the upstream enhancer for estrogen receptor or other nuclear hormone receptors (HRE), Sp1 and areas homologous to cAMP response elements are shown in Fig. 8. Other features of the enhancer that are shown in Fig. 8 are areas which are repeated elsewhere in the mouse genome. R1 is 70% homologous to a sequence that occurs in many rodent gene loci whereas R2 represents a region with high homology (68 of 75 matches) to a sequence within the 5% flanking region of the mouse T-cell receptor d-gene. To see which, if any, of these areas of putative factor binding may be involved in enhancer interaction with SF1 at the GSE in gonadotropes, or with a LIM homeodomain protein at the PGBE site in both cell types, will have to await a structural and functional analysis of the enhancer region. In summary we have demonstrated that an upstream region of the a-subunit gene directs high level expression in thyrotropes and gonadotropes by functionally interacting with proximal promoter elements. In both cell types the PGBE site, which binds a LIM homeodomain protein, is required for the enhancer to function while in gonadotropes only, a second site, the GSE also contributes to the enhancers stimulatory effect.

Acknowledgements We thank Pamela Mellon for aT3 cells and Keith Parker for the SF1 bacterial expression vector. We also thank Sally Camper for assistance with sequencing and Arthur Gutierrez-Hartmann for critical discussion. This work was funded primarily by the National Institutes of Health, Grants DK-36842 and CA-47411 and by a generous gift from the Lucille P. Markey Charitable Trust.

References Akerblom, I.E., Ridgway, E.C., Mellon, P.L., 1990. An a-subunit secreting cell line derived from a mouse pituitary tumor. Mol. Endocrinol. 4, 589 – 596. Bach, I., Rhodes, S.J., Pearse II, R.V., Heinzel, T., Gloss, B., Scully, K.M., Sawchenko, P.E., Rosenfeld, M.G., 1995. P-Lim, a LIM homeodomain factor, is expressed during pituitary organ and cell commitment and synergizes with Pit-l. Proc. Natl. Acad. Sci. 92, 2720 – 2724. Bach, I., Carriere, C., Ostendorff, H.P., Andersen, B., Rosenfeld, M.G., 1997. A family of LIM domain-associated cofactors confer transcriptional synergism between LIM and Otx homeodomain proteins. Genes Dev. 11, 1370 – 1380. Barnhart, K.M., Mellon, P.M., 1994. The orphan nuclear receptor, steroidogenic factor-l, regulates the glycoprotein hormone a-subunit gene in pituitary gonadotropes. Mol. Endocrinol. 8, 878–885.

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152 Brinkmeier, M.L., Gordon, D.F., Dowding, J.M., Saunders, T.L., Kendall, S.K., Sarapura, V.D., Wood, W.M., Ridgway, E.C., Camper, S.A., 1998. Cell specific expression of the mouse glycoprotein hormone a-subunit gene requires multiple interacting DNA elements in transgenic mice and cultured cells. Mol. Endocrinol. 12, 622 – 633. Drean, Y.L., Liu, D., Wong, A.O., Xiong, F., Hew, C.L., 1996. Steroidogenic factor 1 and estradiol receptor act in synergism to regulate the expression of the salmon gonadotopin II beta subunit gene. Mol. Endocrinol. 10, 217–229. Gordon, D.F., Haugen, B.R., Sarapura, V.D. S., Nelson, A.R., Wood, W.M., Ridgway, E.C., 1993. Analysis of Pit-1 in regulating mouse TSHbeta promoter activity in thyrotropes. Mol. Cell. Endocrinol. 96, 75 – 84. Gordon, D.F., Lewis, S.R., Haugen, B.R., James, A., McDermott, M.T., Wood, W.M., Ridgway, E.C., 1997. Pit-1 and GATA-2 interact and functionally cooperate to activate the thyrotropin beta subunit promoter. J. Biol. Chem. 272, 24339–24347. Heckert, L.L., Schultz, K., Nilson, J.H., 1995. Different composite regulatory elements direct expression of the human alpha subunit gene to pituitary and placenta. J. Biol. Chem. 270, 26497 – 26504. Hill, R.E., Jones, P.F., Rees, A.R., Sime, C.M., Justice, M.J., Copeland, N.G., Jenkins, N.A., Graham, E., Davidson, D.R., 1989. A new family of mouse homeobox-containing genes: molecular structure, chromosomal location, and developmental expression of Hox-7.1. Genes Dev. 3, 26–37. Honda, S., Morohashi, K., Nomura, M., Takeya, H., Kitajima, M., Omura, T., 1993. Ad4BP regulating steroidogenic P-450 gene is a member of steroid hormone receptor superfamily. J. Biol. Chem. 268, 7494 – 7502. Horn, F., Windle, J.J., Barnhart, K.M., Mellon, P.L., 1992. Tissuespecific gene expression in the pituitary: the glycoprotein hormone a-subunit gene is regulated by a gonadotropespecific protein. Mol. Cell. Biol. 12, 2143–2153. Ikeda, Y., Lala, D.S., Luo, X., Kim, E., Moisan, M.-P., Parker, K.L., 1993. Characterization of the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression. Mol. Endocrinol. 7, 852–860. Ingraham, H.A., Lala, D.S., Ikeda, Y., Luo, X., Shen, W.H., Nachtigal, M.W., Abbud, R., Nilson, J.H., Parker, K.L., 1994. The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev. 8, 2302–2312. Jackson, S.M., Gutierrez-Hartmann, A., Hoefffler, J.P., 1995. Upstream stimulatory factor, a basic-helix-loop-helix-zipper protein, regulates the activity of the a-glycoprotein hormone subunit gene in pituitary cells. Mol. Endocrinol. 9, 278–291. Kendall, S.K., Gordon, D.F., Birkmeier, T.S., Petrey, D., Sarapura, V.D., O’Shea, K.S., Wood, W.M., Lloyd, R.V., Ridgway, E.C., Camper, S.A., 1994. Enhancer-mediated high level expression of mouse pituitary glycoprotein hormone a-subunit transgene in thyrotropes, gonadotropes, and developing pituitary gland. Mol. Endocrinol. 8, 1420 – 1433. Lala, D.S., Rice, D.A., Parker, K.L., 1992. Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Mol. Endocrinol. 6, 1249 – 1258. Lamonerie, T., Tremblay, J.J., Lanctot, C., Therrien, M., Gauthier, Y., Drouin, J., 1996. Ptxl, a bicoid-related homeo box transcription factor involved in transcription of the proopiomelanocortin gene. Genes Dev. 10, 1284–1295. Liu, Z., Simpson, E.R., 1997. Steroidogenic factor 1 (SF-1) and SP1 are required for regulation of bovine CYPl lA gene expression in bovine luteal cells and adrenal Y1 cells. Mol. Endocrinol. 11, 127 – 137. .

151

MacKenzie, A., Ferguson, M.W.J., Sharpe, P.T., 1991a. Hox-7 expression during murine craniofacial development. Development 113, 601 – 611. MacKenzie, A., Leeming, G.L., Jowett, A.K., Ferguson, M.W.J., Sharpe, P.T., 1991b. The homeobox gene Hox 7.1 has specific regionl and temporal expression patterns during early murine craniofacial embryogenesis, specially tooth development in vivo and in vitro. Development 111, 269 – 285. Pennathur, S., Madison, L.D., Kay, T.W.H., Jameson, J.L., 1993. Localization of promoter sequences required for thyrotropin-releasing hormone and thyroid hormone responsiveness of the glycoprotein hormone a-gene in primary cultures of rat pituitary cells. Mol. Endocrinol. 7, 797 – 805. Porter, F.D., Drago, J., Xu, Y., Cheema, S.S., Wassif, C., Huang, S.P., Lee, E., Grinberg, A., Massalas, J.S., Bodine, D., Alt, F., Westphal, H., 1997. Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development. Development 124, 2935 – 2944. Roberson, M.S., Schoderbek, W.E., Tremml, G., Maurer, R.A., 1994. Activation of the glycoprotein hormone a-subunit promoter by a LIM-homeodomain transcription factor. Mol. Cell. Biol. 14, 2985 – 2993. Robert, B., Sassoon, D., Jacq, B., Gehring, W., Buckingham, M., 1989. Hox-7, a mouse homeobox gene with a novel pattern of expression during embryogenesis. EMBO J. 8, 91 – 100. Sarapura, V.D., Wood, W.M., Gordon, D.F., Ocran, K.W., Kao, M.Y., Ridgway, E.C., 1990. Thyrotrope expression and thyroid hormone inhibition map to different regions of the mouse glycoprotein hormone a-subunit promoter. Endocrinology 127, 1352– 1361. Sarapura, V.D., Wood, W.M., Gordon, D.F., Ridgway, E.C., 1992. A cell line which produces the glycoprotein hormone a-subunit contains specific nuclear factors similar to those present in thyrotropes. Thyroid 2, 31 – 38. Sarapura, V.D., Gordon, D.F., Strouth, H.L., Wood, W.M., Ridgway, E.C., 1997. Msxl is present in thyrotropic cells and binds to a consensus site on the glycoprotein hormone alphasubunit promoter. Mol. Endocrinol. 11, 1782 – 1794. Schoderbek, W.E., Kim, K.E., Ridgway, E.C., Mellon, P.L., Maurer, R.A., 1992. Analysis of DNA sequences required for pituitary-specific expression of the glycoprotein hormone alphasubunit gene. Mol. Endocrinol. 6, 893 – 903. Seidah, N.G., Barale, J.C., Marcinkiewicz, M., Mattei, M.G., Day, R., Chretien, M., 1994. The mouse homeoprotein mLIM-3 is expressed early in cells derived from the neuroepithelium and persists in adult pituitary. DNA Cell. Biol. 13, 1163 – 1180. Sheng, H.Z., Zhadanov, A.B., Mosinger, B. Jr., Fujii, T., Bertuzzi, S., Grinberg, A., Lee, E.J., Huang, S.P., Mahon, K.A., Westphal, H., 1996. Specification of pituitary cell lineages by the LIM homeobox gene Lhx3. Science 272, 1004 – 1007. Steger, D.J., Hecht, J.H., Mellon, P.L., 1994. GATA-binding protiens regulate the human gonadotropin a-subunit gene in the placenta and pituitary gland. Mol. Cell. Biol. 14, 5592 –5602. Sugawara, T., Kiriakidou, M., McAllister, J.M., Kallen, C.B., Strauss III, J.F., 1997. Multiple steroidogenic factor 1 binding elements in the human steroidogenic acute regulatory protein gene 5’ flanking region are required for maximal promoter activity and cyclic AMP responsiveness. Biochemistry 36, 7249–7255. Windle, J.J., Weiner, R.L., Mellon, P.L., 1990. Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Mol. Endocrinol. 4, 597 – 603. Wood, W.M., Dowding, J.M., Bright, T.M., McDermott, M.T., Haugen, B.R., Gordon, D.F., Ridgway, E.C., 1996. Thyroid hormone receptor beta2 promoter activity in pituitary cells is regulated by Pit-l. J. Biol. Chem. 271, 24213 – 24220.

152

W.M. Wood et al. / Molecular and Cellular Endocrinology 142 (1998) 141–152

Xu, Y., Baldassare, M., Fisher, P., Rathbun, G., Olitz, E.M., Yancopoulos, G.D., Jessel, T.M., Alt, F.W., 1993. LH-2:A LIM/ homeodomain gene expressed in developing lymphocytes and neural cells. Proc. Natl. Acad. Sci. USA 90, 227–231.

.

Zhadanov, A.B., Bertuzzi, S., Taira, M., Dawid, I.B., Westphal, H., 1995. Expression pattern of the murine LIM class homeobox gene Lhx3 in subsets of neural and neuroendocrine tissues. Dev. Dynamics 202, 354 – 364.