- Email: [email protected]
Fungal and aflatoxin contamination of marketed spices
Food Control 37 (2014) 177e181
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Fungal and aflatoxin contamination of marketed spices Walid Hammami a, 1, Stefano Fiori b, 1, Roda Al Thani a, Najet Ali Kali d, Virgilio Balmas b, c, Quirico Migheli b, c, *, Samir Jaoua a a
Department of Biological & Environmental Sciences, College of Arts and Sciences, Qatar University, P.O. Box 2713, Doha, Qatar Dipartimento di Agraria, Università degli Studi di Sassari, Viale Italia 39, I-07100 Sassari, Italy c Centro interdisciplinare per lo sviluppo della ricerca biotecnologica e per lo studio della biodiversità della Sardegna e dell’area mediterranea, Viale Italia 39, I-07100 Sassari, Italy d Central Food Laboratory, Ministry of Public Health, P.O. Box 3381, Doha, Qatar b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 July 2013 Received in revised form 29 August 2013 Accepted 14 September 2013
Fourteen spice samples were collected from local markets in Doha, Qatar, during 2012, and were surveyed for the presence of potentially harmful mycoflora and for contamination with aflatoxins B1, B2, G1, and G2 by high-performance liquid chromatography (HPLC). Among the tested spice samples, chili powder showed the highest presence of fungal propagules, while ginger, curry and garlic samples did not present any fungal contamination. A total of 120 isolates, mostly belonging to Aspergillus and Penicillium genera, were collected and 33 representative species were identified by amplification and sequencing of the internal transcribed spacer (ITS) region. Aspergillus flavus, Aspergillus nomius and Aspergillus niger were the most dominant. Thirty-seven Aspergillus strains were screened for their potential to produce aflatoxins using biochemical and molecular tools: only 9 A. flavus strains showed both fluorescence and amplification with all the three primers targeting aflP, aflM and aflR genes. Aflatoxins were detected in five spices (black pepper, chili, tandoori masala. turmeric and garam masala), and with the exception of garam masala, the tested samples of turmeric, black pepper, tandoori masala and chili powder exceeded B1 and/or total aflatoxin maximum levels. Our results demonstrate the potential for mycotoxin biosynthesis by fungi contaminating imported spice products. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Mycotoxin risk Food safety Aspergillus Penicillium Aflatoxin biosynthetic genes
1. Introduction A wide array of spices are commonly used as seasoning in Qatar’s traditional cuisine. Most of these spices are produced in countries with tropical climates where high temperature, humidity, and rainfall stimulate growth of fungi and contamination by mycotoxins (Martins, Martins, & Bernardo, 2001). Aflatoxins (AFs) are secondary metabolites which are of great concern because of their detrimental effects on human and animal health, including carcinogenic, mutagenic, teratogenic, and immunosuppressive effects (Eaton & Gallagher, 1994). These mycotoxins are produced mainly by Aspergillus flavus Link, Aspergillus parasiticus Speare and Aspergillus nomius Kurtzman, B.W. Horn & Hesselt (Rajasinghe, Abeywickrama, & Jayasekera, 2009). The four main naturally-occurring aflatoxins are aflatoxin B1, aflatoxin B2, aflatoxin G1 and aflatoxin G2. Among them, aflatoxin B1 * Corresponding author. Dipartimento di Agraria, Università degli Studi di Sassari, Viale Italia 39, 07100 Sassari, Italy. Tel.: þ39 (0)79 229295; fax: þ39 (0)79 229316. E-mail address: [email protected] (Q. Migheli). 1 The first two authors have equally contributed to the present work. 0956-7135/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.foodcont.2013.09.027
is the most common, as well as the most dangerous for its ability to cause liver cancer in human. Aflatoxins are heat-resistant and can withstand exposure to normal cooking temperatures and microwave treatment (Midio, Campos, & Sabino, 2001). In recent years, the natural occurrence of aflatoxin in spices has been studied by several teams. A Qatari study on food products showed that chili powder and mixed spices powder contained an aflatoxin level of 69.3 mg/kg and 5.1 mg/kg, respectively (Abdulkadar, Al-Ali, Al-Kildi, & Al-Jedah, 2004). Romagnoli, Menna, Gruppioni, and Bergamini (2007) noted that, out of the 103 samples collected from Italian market and analyzed for aflatoxin content, 7 spice samples resulted positives: 5 chili-peppers, 1 nut meg and 1 cinnamon. Other researchers also detected very high levels of aflatoxin contamination in chilies (Yerneni et al., 2012). Previous reports were focused on the fungal contamination in spices. Aspergillus (25 species) and Penicillium (7 species) were the predominant genera in 120 samples of 24 kinds of spices in Egypt (El-Kady, El-Maraghy, & Mostafa, 1992). A. flavus, Aspergillus niger Tiegh., Aspergillus ochraceus G. Wilh., Aspergillus fumigatus Fresen., A. flavus var. columnaris Raper & Fennell, Aspergillus terreus Thom, Penicillium chrysogenum Thom and Penicillium corylophilum Dierckx
178
W. Hammami et al. / Food Control 37 (2014) 177e181
were the most common species. Ahene, Odamtten, and Owusu (2011) reported that A. flavus was the most frequently isolated species in all the spice products marketed in Ghana. Aspergillus alutaceus Berk. & M.A. Curtis (an ochratoxin producer) and Fusarium verticillioides (Sacc.) Nirenberg were also isolated. Most of these studies were carried out by using traditional methods, such as the observation of macro- or microscopic features, and the ability to grow on specific media, hence possibly leading to over- or underestimation of fungal species. In the present study, we aimed at investigating the presence of fungal contamination in different spices available in the Qatari markets. A polymerase chain reaction (PCR)-based approach targeting both the Internal Transcribed Spacer (ITSI-5.8S-ITS2; ITS) region of the nuclear rRNA genes and three genes in the aflatoxin biosynthesis pathway was adopted in order to understand the relationship between fungal population and aflatoxin content. Our results further emphasize the need to monitor the levels of mycotoxin contamination in susceptible commodities and to evaluate the health risk related to the consumption of food products that are largely used in domestic cooking.
Lee, & Taylor, 1990). Each PCR reaction was performed using 12.5 ml of Taq PCR Master Mix 2X (QIAGEN, California, USA), 0.5 ml of both the forward and reverse primers (10 pmol), 5e10 ng DNA template and ultrapure H2O up to 25 ml. The thermocycler was set as follows: initial denaturation at 94 C for 5 min; 35 cycles of 30 s at 94 C for denaturation, 30 s at 54 C for annealing and 30 s at 72 C for elongation, followed by a final elongation step of 5 min at 72 C. To check the amplified DNA, 5 ml of each reaction were loaded on a 1% agarose gel containing ethidium bromide (0.5 mg/ml) and visualized under ultraviolet light. 2.4.2. PCR product purification and sequencing PCR products were purified with Pure-Link PCR Purification Kit (Life Technologies California, USA) according to the manufacturer’s instructions, and their concentration was then determined with a QubitÒ 2.0 Fluorometer (Life Technologies California, USA). Twenty ng of DNA template and 6.4 pmol of either ITS-1 or ITS-4 primer were collected into sequencing tubes, dried in the themocycler at 60 C and sent to BMR-Genomics company of the University of Padova (Italy) for the sequencing service. Sequences were then blasted in the NCBI database to provide species identification.
2. Materials and methods 2.5. Determination of aflatoxin levels in spices 2.1. Sampling
To perform genomic DNA extraction, fungi were grown for 3e7 days at 28 C in potato dextrose broth (PDB; Becton, India). Fungal mycelia were collected and ground in a mortar using liquid nitrogen. The DNA extraction was carried out with DNeasy Plant Mini Kit (QIAGEN, California, USA) according to the manufacturer’s instructions. Five ml of each DNA sample were checked on a 1% agarose gel containing ethidium bromide (0.5 mg/ml) and visualized under ultraviolet light.
Aflatoxin contamination level was determined in the Central Food Laboratory (Ministry of Public Health, Doha, Qatar) using a high performance liquid chromatography (HPLC). Forty g of spice powder were mixed with 150 ml of acetonitrile: water (60:40) with a high speed laboratory blender for 3 min. After filtration with Whatman No. 1 filter, 2 ml of the filtrate were diluted with 48 ml of phosphate buffer saline (PBS, pH 7.4). The solution was injected into the immuno-affinity column (R-Biopharm RHONE, Glasgow, Scotland) which is prior condition by 15 ml phosphate buffer saline, at a flow rate of 0.5 ml/min. The column was then washed with 10 ml of distilled water, dried in an air stream and, finally, elution was carried out with 1.5 ml of methanol passing slowly through the immuno-affinity column. Methanol was then evaporated on a water bath (at about 70 C) under steam of nitrogen until dried completely. The residue was resuspended with 200 ml of hexane and 50 ml of trifluoroacetic acid in a 4 ml vial and the solution was vortexed for 30 s. After the addition of 1.95 ml of acetonitrile: water (1:9), reaction was allowed by mixing for 30 s and then 50 ml of the sample solution (aqueous layer) were injected on HPLC after passing through 0.22 mm syringe filter. The mobile phase consisted of acetonitrile: water : methanol (180:640:180) while the flow rate was set at 1 ml/min. The HPLC column used was a Nova pack C18: 4 mm, 150 3.9 mm (Waters, Milford, USA). Mycotoxin standards (aflatoxin B1, B2, G1 and G2) were purchased from Sigma, Germany. From the stock solution (1000 ppb for B1 and B2; 300 ppb for G1 and G2), a mixed standard solution was prepared by serial dilutions of water: acetonitrile (9:1) aiming to get the concentration of 0.5e 50 ppb of B1 and G1 and 0.15e15 ppb of B2 and G2 from an initial stock concentrations of 1000 ppb for B1 and G1 and 300 ppb for B2 and G2.
2.4. Fungal identification
2.6. Fluorescence detection
Isolated strains were preliminarily grouped according to their morphological differences and one or two representatives from each of these groups was further analyzed molecularly by PCR and sequencing of the ITS region as described below.
Coconut agar medium (CAM) was used for rapid detection of aflatoxin synthesis (Lin & Dianese, 1976). Briefly, one hundred g of shredded coconut were homogenized for 5 min with 300 ml of hot distilled water. The homogenate was filtered through four layers of cheesecloth, and the pH of the clear filtrate was adjusted to pH 7 with 2 N NaOH. After agar addition, the medium was autoclaved. The plates were inoculated with PDA plugs of Aspergillus strains and then incubated at 28 C for 3e5 days. The reverse side of the plates
The fourteen powdered spices used in this study were obtained from three Qatari local markets. These were: chili, kashmiri chili hot, kashmiri chili mild, basil, oregano, ginger, curry, cumin, turmeric, tandoori masala, garam masala, black pepper, garlic and coriander. One kilogram of each spice was sampled and stored at 4 C until analysis. 2.2. Mycological examination Total fungal counts were determined according to Samson, Hocking, Pitt, and King (1992). Ten grams of each spice were homogenized in 90 ml of sterile water for 2 min. Aliquots (100 ml) were plated onto sterile plastic Petri dishes containing solidified dichloran rose bengal chloramphenicol (DRBC) agar (Sigma, USA) and incubated at 28 C for 5 days. After monospore isolation on potato dextrose agar (PDA) (Himedia, India), fungal cultures were preserved in sterile water at 4 C until molecular identification (Nakasone, Peterson, & Jong, 2004). 2.3. Fungal genomic DNA extraction
2.4.1. ITS1-ITS4 amplification The 5.8S ribosomal DNA region (600 bp) of the selected isolates was amplified using universal primers ITS1 and ITS4 (White, Bruns,
W. Hammami et al. / Food Control 37 (2014) 177e181
179
Table 1 Total mycoflora isolated from spice samples after 5 days incubation on potato dextrose agar at 28 C. Spice sample
CFU/G (mean SD)
Aspergillus spp.
Chili Kashmiri chili hot
1280 50 550 34
Kashmiri chili mild Black pepper
720 73 40 12
Turmeric Cumin Basil
140 23 60 30 510 34
A. flavus (12), A. tamarii (3), A. niger (2) A. flavus (10), A. tamarii (2), A. niger (2), A. melleus (1) A. flavus (8), A. versicolor (3), A. niger (2) A. flavus (6), A. tamarii (1), A. niger (2), Eurotium rubrum (2) A. flavus (7), A. nomius (2), A. niger (1) A. niger (4) A. niger (3) , A. ochraceus (2)
Tandoori masala Garam masala Oregano Coriander Ginger Garlic Curry
220 10 70 20 0 0 0
54 10 26 4 0 0 0
Penicillium spp.
Other genera
P. charlesii (2), P. verruculosum (2)
Alternaria (1)
P. citrinum (2), P. griseofulvum (1)
P. P. P. P.
charlesii (1) aurantiogriseum (2), commune (1), melanoconidium (2)
Embellisia sp., (1) Stachybotrys echinata (1)
A. niger (3), A. flavus (8), A. nomius (4) Eurotium sp. (4) Unidentified fungus (2)
A. niger (4)
was periodically observed under 365 nm UV light for blue fluorescence. 2.7. Molecular identification of aflatoxin-producing isolates Multiplex PCR was used to amplify three target fragments of the aflatoxin-biosyntetic aflP, aflM and aflR genes. Primers OMT (50 GGCCCGGTTCCTTGGCTCCTAAGC30 /50 CGCCCCAGTGAGACCCTTC CTCG30 ), APA (50 TATCTCCCCCCGGGCATCTCCCGG30 /50 CCGTCAGA CAGCCACTGGACACGG30 ) and REV (50 ATGTCGGATAATCACCGTTT AGATGGC30 /50 CGAAAAGCGCCACCATCCACCCCAATG30 ) (Richard, Heutte, Bouchart, & Garon, 2009; Shapira et al., 1996) were used to amplify 1254 bp, 1034 bp and 896 bp fragments, respectively. PCR assays were performed in 25 ml of reaction mixture containing 5e10 ng of genomic DNA, 2.5 ml dNTP Mix (2 mM), 1 ml of each primer (10 mM) and H2O, each reaction mixture was heated to 95 C for 10 min before 2.5 U of Taq DNA polymerase (Qiagen, California, USA) was added. The PCR program was set as follow: 30 cycles of 1 min at 94 C for denaturation, 2 min at 65 C for annealing, 2 min at 72 C for extension, and a 5-min final extension step at 72 C. The PCR products were analyzed by electrophoresis on a 1% agarose gel containing ethidium bromide (0.5 mg/ml). 3. Results and discussion Dehydrated products, such as spices, may represent a suitable environment to the survival of mycotoxigenic fungi due to postharvest practices, improper storage and conducive environmental conditions. In this study, fourteen spice samples collected in Qatari markets were surveyed for fungal contamination. The main genera isolated were Aspergillus and Penicillium (Table 1). Other common mycotoxin-producing fungi, such as Fusarium and Alternaria (except for Kashmiri chili hot) were not detected. These results are in agreement with a previous report by Hassan (1984), where Fusarium contamination was never detected among 12 spice samples tested. Chili powder showed the highest fungal contamination (1280 CFU/g), followed by mild and hot kashmiri chili and basil (720 CFU/g, 550 CFU/g and 510 CFU/g respectively). A similar level of contamination (1580 CFU/g) was found by Mandeel (2005) in chili samples. Unlike previous reports (Ahene et al., 2011; Chaiprasert, Komolpis, Anukarahanonta, & Imwidthya, 1987), the tested samples of ginger powder, garlic powder, and curry did not present any relevant fungal contamination. A number of studies outlined the antifungal activity of ginger and garlic against
P. aurantiogriseum (4)
Aspergillus species (Irkin & Korukluoglu, 2007). This effect could explain also the low fungal population detected in garam masala powder. In fact, this spice is a mix of many crude spices, some of them with proven antifungal activity (Kubra, Murthy, & Rao, 2013). Hence, we can presume that the formulation of some mixed spices represents an inhibiting factor against fungal growth. Most published reports on the incidence of fungal contaminants in spice samples are based on traditional approaches to species identification (Salari, Habibi Najafi, Boroushaki, Mortazavi, & Fathi Najafi, 2012; Santos et al., 2011; Sumanth, Waghmare, & Shinde, 2010). Alternative strategies leading to unambiguous identification of specific genomic sequences are now becoming essential to clearly characterize fungal species. In this survey, we have carried out a preliminary characterization of our fungal collection from marketed spice samples by sequencing the internal transcribed spacer (ITS) region of the fungal genome. Out of 120 fungal isolates, 33 representatives were selected based on their morphological and cultural characteristics for further molecular studies and used as a reference to identify the rest of the fungal isolates. The most frequent among Aspergillus sp. isolates were identified as A. flavus, A. nomius, A. niger, Aspergillus tamarii Kita, Aspergillus melleus Yukawa and Aspergillus versicolor (Vuill.) Tirab. (Supplementary Table S1). Furthermore, seven common species of Penicillium were detected, albeit infrequently: Penicillium aurantiogriseum Dierckx, Penicillium commune Thom, Penicillium melanoconidium (Frisvad) Frisvad & Samson, Penicillium charlesii G. Sm., Penicillium verruculosum Peyronel, Penicillium citrinum Thom and Penicillium griseofulvum Dierckx. Abou-Arab, Kawther, El Tantawy, Badeaa, and Khayria (1999) highlighted that Penicillium species were more frequently isolated from packed spice samples than in bulked spice
Table 2 Aflatoxin levels (mg kg1 SD) detected in spice samples. Spice sample G1 Garam masala Tandoori masala Turmeric Chili Black pepper
B1
6.22 1.23 ND
G2 1.88 0.3
B2 ND
Total aflatoxins 8.1
ND
18.58 1.1
13.21 0.6 ND 11.91 0.1
ND ND ND 13.21 69.28 1.08 ND 1.73 0.05 71.01 1.85 0.16 70.33 1.17 ND 84.09
ND: not detected (below detection limit).
ND
0.18 0.05 18.76
180
W. Hammami et al. / Food Control 37 (2014) 177e181
Table 3 Biochemical and molecular characterization of Aspergillus strains isolated from spice samples. Strain
Species
Spice sample
ATchi1 AFchi5 AFchi7 AFchi8 AFchi9 AFchi10 AFchi11 AFchi13 AFchi14 AFtur3 AFtur4 AFtur5 AFtur6 AFtur7 AFtur10 ATbp2 AFbp3 AFbp4 AFbp5 AFtan3 ANtan4 AFtan7 AFtan8 AFtan9 AFtan10 AFchi11 AFkh1 AFkh3 AFkh4 AFkh6 AFkh9 AFkm5 AFkm9 AVkm11 AObas7 ANbas4 ERgar1
A. tamarii A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. tamarii A. flavus A. flavus A. flavus A. flavus A. niger A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. versicolor A. ochraceus A. niger Eurotium. sp.
Chili Chili Chili Chili Chili Chili Chili Chili Chili Turmeric Turmeric Turmeric Turmeric Turmeric Turmeric Black pepper Black pepper Black pepper Black pepper Tandoori Tandoori Tandoori Tandoori Tandoori Tandoori Tandoori Kashmiri chili hot Kashmiri chili hot Kashmiri chili hot Kashmiri chili hot Kashmiri chili hot Kashmiri chili mild Kashmiri chili mild Kashmiri chili mild Basil Basil Garam masala
Blue fluorescence PCR products intensity aflP aflR aflM þþþ þþ þþ þ þþ þþ þþþ þþþ þþþ
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
þ þ þ þ þ þ þ þ þ þ þ þ
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ e
samples, due to the presence of higher humidity inside the pack. The packaging can affect the fungal population as well as the growth rate due to the variation of many factors as the humidity and the aeration. Aflatoxins are considered by health authorities among the most harmful mycotoxins towards humans and animals (Peraica, Radic, Lucic, & Pavlovic, 1999; Wild & Turner, 2002). Our spice samples were screened for the presence of aflatoxins G1, B1, G2, and B2 by HPLC. Five over 12 samples contained one or more of these toxins (Table 2). According to the European Commission Regulations (No 165/2010), the maximum levels of aflatoxin in spices are 5 mg/kg for the B1 and 10 mg/kg for the sum B1, B2, G1 and G2. Thereby, garam masala (0 mg/kg of B1 and 8.1 mg/kg of total aflatoxin), turmeric (0 mg/kg and 13.21 mg/kg, respectively) and black pepper (1.85 mg/kg and 84.09 mg/kg, respectively) samples exceed the limit set for total aflatoxin level, whereas tandoori (18.58 mg/kg and 18.76 mg/kg) and the chili powder (69.28 mg/kg and 71.01 mg/kg) tested samples exceed both the B1 and the total aflatoxin maximum levels. The highest level of total aflatoxins (84.09 mg/kg) was found in black pepper. This result is in agreement with Seenappa and Kempton (1980), who demonstrated the suitability of black pepper as a substrate for aflatoxin production by A. flavus under artificial conditions. The chili powder analyzed in the present study contained a very high level of B1 aflatoxin, therefore confirming a previous report on
Fig. 1. Band pattern of different Aspergillus spp. isolates as resulting from multiplex PCR reactions primed by OMT, APA and VER primers. Lanes: Lane 1 ¼ A. flavus AFkh1, Lane 2 ¼ A. flavus AFkh3, Lane 3 ¼ A. flavus AFtan7, Lane 4 ¼ A. flavus AFtan8, Lane 5 ¼ A. flavus AFchi5, Lane 6 ¼ A. flavus AFchi7, Lane 7 ¼ A. flavus AFchi8, Lane 8 ¼ Eurotium. Sp ERgar1, Lane 9 ¼ A. flavus AFbp3, Lane 10 ¼ A. flavus AFbp4, Lane 11 ¼ A. flavus AFbp5, Lane 12 ¼ A. flavus AFkm5, Lane 13 ¼ A. flavus AFkm9, Lane 14 ¼ negative control, Lane 15 ¼ 1 Kb DNA ladder (Promega, Wisconsin, USA).
aflatoxin contamination in chili powder available in Qatari markets at up to 69.3 mg/kg (Abdulkader et al. 2004). No aflatoxins were detected in ginger, garlic, coriander, kashmiri chili mild and hot, basil, oregano, cumin and curry. Several authors reported that the absence of aflatoxins in crude spices may be explained by the presence of essential oils, which may prevent toxin production in spite of a dramatic Aspergillus species contamination of the samples (Abou-Arab et al., 1999; El-Shafie et al., 2002). Moreover, the effect of nine oils was tested against both the growth and the toxicity of A. parasiticus and Fusarium moniliforme J. Sheld. (Juglal, Govinden, & Odhav, 2002). The clove oil was able to inhibit the growth of these fungi, to limit the production of fumonisins and to stop the aflatoxins synthesis. Also, Atanda, Akpan, and Oluwafemi (2007) showed that aflatoxin biosynthesis can be completely inhibited when basil leaves were added to the culture medium, hence proposing their use as preservative agents against Aspergillus contamination on sorghum grain. Most of the fungal species identified in our study have been previously reported as being able to produce mycotoxins (Bugno, Buzzo Almodovar, Caldas Pereira, Andreoli Pinto, & Sabino, 2006). In this context, representatives of Aspergillus spp. were tested for their aflatoxigenic nature based on the ability to generate blue fluorescence on CMA as well as by PCR methods using OMT, VER and APA-specific primers (Richard et al., 2009; Shapira et al., 1996) targeting aflP, aflM and aflR genes, respectively. aflR is a regulatory gene (Yu et al., 1995, 2004), while aflP and aflM genes are structural genes in the aflatoxin biosynthetic pathway. In total, 30 A. flavus strains were tested, but only 30% of them showed their potential aflatoxin producing ability. This is consistent with a previous report by Elshafie, Al-Rashdi, Al-Bahry, and Bakheit (2002), who observed that 45% of the A. flavus strains isolated from 105 spice samples were aflatoxigenic. Our results showed that fluorescence and PCR results are mostly in accordance (Table 3): except for strains AFtan3, AFbp3 and AFchi5, the presence of amplimers derived from the three genes matched the detection of fluorescence on CAM. Twelve of the tested A. flavus strains showed amplification with all the three aflatoxigenic primers aflR, aflM and aflP, while others contained only aflP sequences, such as A. nomius (Table 3; Fig. 1). No such amplimers were ever detected in A. niger, A. tamarii, A. ochraceus and A. versicolor (Table 3). Yet, this molecular tool is not always sufficient enough to identify the aflatoxigenic strains of A. flavus. Yang et al. (2004)
W. Hammami et al. / Food Control 37 (2014) 177e181
noted that some strains were unable to produce aflatoxins in spite of the presence of all the four aflD, aflM, aflP and aflR genes. An alternative approach was proposed to detect aflatoxigenic strains of A. flavus and A. parasiticus by using a reverse transcriptionepolymerase chain reaction (RT-PCR) technique (Scherm, Palomba, Serra, Marcello, & Migheli, 2005). Some potential aflatoxigenic strains were identified in Kashmiri chili mild and Kashmiri chili hot samples, in spite of the absence of aflatoxins in these spices. Our study suggests that the mycoflora content may be indicative of aflatoxin contamination except for Kashmiri chili, mild and hot, where no relationship could be confirmed. In fact, the presence of mycotoxigenic fungi in food samples does not ultimately lead to the production of the respective mycotoxin. Many factors including storage and environmental conditions play a key role in the metabolism of secondary metabolites such as mycotoxins (Hope, Aldred, & Magan, 2005). In this context, Paterson, Venancio, and Lima (2003) indicated that many fungi which produce mycotoxins can also degrade them under specific conditions. In this survey, a combination of morphological, physiological, and molecular tools was used to preliminarily assess the contamination of common spices imported to Qatar. While we focused our study on aflatoxins and aflatoxigenic fungi, we are aware of the additional risk related to the presence on spice samples of other relevant mycotoxins, such as trichothecenes, ochratoxin and patulin. Our results clearly show that there is a high risk potential for contamination of these products by mycotoxigenic fungi. It is highly advisable to test the spice samples for fungal/mycotoxin contamination after their release to the local market, particularly because the climatic conditions may be favorable to fungal proliferation and toxin production during shelf life. Acknowledgments This publication was made possible by NPRP grant # NPRP 4259-2-083 from the Qatar National Research Fund (a member of Qatar Foundation). The statements made herein are solely the responsibility of the authors. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.foodcont.2013.09.027. References Abdulkadar, A. H. W., Al-Ali, A. A., Al-Kildi, A. M., & Al-Jedah, J. H. (2004). Mycotoxins in food products available in Qatar. Food Control, 15, 543e548. Abou-Arab, A. A. K., Kawther, M. S., El Tantawy, M. E., Badeaa, R. I., & Khayria, N. (1999). Quantity estimation of some contaminants in commonly used medicinal plants in the Egyptian market. Food Chemistry, 67, 357e363. Ahene, R. E., Odamtten, G. T., & Owusu, E. (2011). Fungal and bacterial contaminants of six spices and spice products in Ghana. African Journal of Environmental Science and Technology, 5, 633e640. Atanda, O. O., Akpan, I., & Oluwafemi, F. (2007). The potential of some spice essential oils in the control of A. parasiticus CFR 223 and aflatoxin production. Food Control, 18, 601e607. Bugno, A., Buzzo Almodovar, A. A., Caldas Pereira, T., Andreoli Pinto, T., & Sabino, M. (2006). Occurrence of toxigenic fungi in herbal drugs. Brazilian Journal of Microbiology, 37, 47e51. Chaiprasert, A., Komolpis, P., Anukarahanonta, T., & Imwidthya, S. (1987). Bacterial fungal and aflatoxin contamination of medicinal herbs, spices and curry in Bangkok. Siriraj Medical Journal, 39, 27e39. Commission Regulation (EU) No. 165/2010 of 26 February 2010 amending Regulation (EC) No. 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards aflatoxins. Official Journal of the European Communities. L 50/12. Brussels. Eaton, D. L., & Gallagher, E. P. (1994). Mechanisms of aflatoxin carcinogenesis. Annual Review of Pharmacology and Toxicology, 34, 135e172.
181
El-Kady, S., El-Maraghy, S. M., & Mostafa, E. M. (1992). Contribution of the mesophilic fungi of different spices in Egypt. Mycopathologia, 120, 93e101. Elshafie, E. A., Al-Rashdi, T. A., Al-Bahry, S. N., & Bakheit, C. S. (2002). Fungi and aflatoxins associated with spices in the Sultanate of Oman. Mycopathologia, 155, 155e160. Hassan, H. (1984). Effect of gamma radiation on the microflora of some spices. M. Sc. thesis Faculty of Sciences. Cairo, Egypt: Ain Shams University. Hope, R., Aldred, D., & Magan, N. (2005). Comparison of environmental profiles for growth and deoxynivalenol production by Fusarium culmorum and Fusarium graminearum on wheat grain. Letters in Applied Microbiology, 40, 295e300. Irkin, R., & Korukluoglu, M. (2007). Control of Aspergillus niger with garlic, onion and leek extracts. African Journal of Biotechnology, 6, 384e387. Juglal, S., Govinden, R., & Odhav, B. (2002). Spice oils for the control of co-occurring mycotoxin-producing fungi. Journal of Food Protection, 65, 683e687. Kubra, I. R., Murthy, P. S., & Rao, L. J. (2013). In vitro antifungal activity of dehydrozingerone and its fungitoxic properties. Journal of Food Science, 78, 64e69. Lin, M. T., & Dianese, J. C. (1976). A coconut-agar medium for rapid detection of aflatoxin production by Aspergillus spp. Phytopathology, 66, 1466e1469. Mandeel, Q. A. (2005). Fungal contamination of some imported spices. Mycopathologia, 159, 291e298. Martins, M. L., Martins, H. M., & Bernardo, F. (2001). Aflatoxins in spices marketed in Portugal. Food Additives and Contaminants, 18, 315e319. Midio, A. F., Campos, R. R., & Sabino, M. (2001). Occurrence of aflatoxins B1, B2, G1 and G2 in cooked food components of whole meals marketed in fast food outlets of the city of São Paulo, SP, Brazil. Food Additives and Contaminants, 18, 445e448. Nakasone, K. K., Peterson, S. W., & Jong, S. (2004). Preservation and distribution of fungal cultures. In G. M. Müller, G. F. Bills, & M. S. Foster (Eds.), Biodiversity of fungi: Inventory and monitoring methods (pp. 37e47). Amsterdam: Elsevier Academic Press. Paterson, R. R. M., Venancio, A., & Lima, N. (2003). Mycotoxins e the experience and expertise of Micoteca da Universidade do Minho. In Biological resource centres and the use of microbes, European Culture Collections’ Organisation XXII (pp. 217e 233). Braga: Portugal Micoteca da Universidade do Minho. Peraica, M., Radic, B., Lucic, A., & Pavlovic, M. (1999). Toxic effects of mycotoxins in humans. Bulletin of the World Health Organization, 77, 754e766. Rajasinghe, M., Abeywickrama, K., & Jayasekera, R. (2009). Aflatoxigenic Aspergillus flavus and aflatoxin formation in selected spices during storage. Tropical Agricultural Research and Extension, 12, 1e6. Richard, E., Heutte, N., Bouchart, V., & Garon, D. (2009). Evaluation of fungal contamination and mycotoxin production in maize silage. Animal Feed Science and Technology, 148, 309e320. Romagnoli, B., Menna, V., Gruppioni, N., & Bergamini, C. (2007). Aflatoxins in spices, aromatic herbs, herb-teas and medicinal plants marketed in Italy. Food Control, 18, 697e701. Salari, R., Habibi Najafi, M. B., Boroushaki, M. T., Mortazavi, S. A., & Fathi Najafi, M. (2012). Assessment of the microbiological quality and mycotoxin contamination of Iranian red pepper spice. Journal of Agricultural Science and Technology, 14, 1511e1521. Samson, R. A., Hocking, A. D., Pitt, J. I., & King, A. D. (1992). Modern methods in food mycology. In Developments in food science (Vol. 31). Amsterdam: Elsevier. Santos, L., Marín, S., Mateo, E. M., Gil-Serna, J., Valle-Algarra, F. M., Patiño, B., et al. (2011). Mycobiota and co-occurrence of mycotoxins in Capsicum powder. International Journal of Food Microbiology, 151, 270e276. Scherm, B., Palomba, M., Serra, D., Marcello, A., & Migheli, Q. (2005). Detection of transcripts of the aflatoxin genes aflD, aflO, and aflP by reverse transcription polymerase chain reaction allows differentiation of aflatoxin-producing and non-producing isolates of Aspergillus flavus and Aspergillus parasiticus. International Journal of Food Microbiology, 98, 201e210. Seenappa, M., & Kempton, A. G. (1980). Aspergillus growth and aflatoxin production on black pepper. Mycopathologia, 70, 135e137. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A., & Salomon, R. (1996). Detection of aflatoxigenic molds in grains by PCR. Applied and Environmental Microbiology, 62, 3270e3273. Sumanth, G. T., Waghmare, B. M., & Shinde, S. R. (2010). Incidence of mycoflora from the seeds of Indian main spices. African Journal of Agricultural Research, 5, 3122e3125. White, T. J., Bruns, T. D., Lee, S. B., & Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, & T. J. White (Eds.), PCR protocols: A guide to methods and applications (pp. 315e322). London: Academic Press. Wild, C. P., & Turner, P. C. (2002). The toxicology of aflatoxins as a basis for public health decisions. Mutagenesis, 17, 471e481. Yang, Z. Y., Shim, W. B., Kim, J. H., Park, S. J., Kang, S. J., Nam, B. S., et al. (2004). Detection of aflatoxin producing moulds in Korean fermented foods and grains by multiplex PCR. Journal of Food Protection, 67, 2622e2626. Yerneni, S. G., Hari, S. S., Jaganathan, R., Senthamarai, M., Vasanthi, N. S., & Kannan, K. P. (2012). Determination of the level of aflatoxin present in the marketed spices. World Journal of Science and Technology, 2, 31e34. Yu, J. H., Chang, P. K., Ehrlich, K. C., Cary, J. W., Bhatnagar, D., Cleveland, T. E., et al. (2004). Clustered pathway genes in aflatoxin biosynthesis. Applied and Environmental Microbiology, 70, 1253e1262. Yu, J. H., Chang, P. K., Payne, G. A., Cary, J. W., Bhatnagar, D., & Cleveland, T. E. (1995). Comparison of the omt A genes encoding o-methyltransferases involved in aflatoxin biosynthesis from Aspergillus parasiticus and A. flavus. Gene, 163, 121e125.
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Fungal and aflatoxin contamination of marketed spices Walid Hammami a, 1, Stefano Fiori b, 1, Roda Al Thani a, Najet Ali Kali d, Virgilio Balmas b, c, Quirico Migheli b, c, *, Samir Jaoua a a
Department of Biological & Environmental Sciences, College of Arts and Sciences, Qatar University, P.O. Box 2713, Doha, Qatar Dipartimento di Agraria, Università degli Studi di Sassari, Viale Italia 39, I-07100 Sassari, Italy c Centro interdisciplinare per lo sviluppo della ricerca biotecnologica e per lo studio della biodiversità della Sardegna e dell’area mediterranea, Viale Italia 39, I-07100 Sassari, Italy d Central Food Laboratory, Ministry of Public Health, P.O. Box 3381, Doha, Qatar b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 July 2013 Received in revised form 29 August 2013 Accepted 14 September 2013
Fourteen spice samples were collected from local markets in Doha, Qatar, during 2012, and were surveyed for the presence of potentially harmful mycoflora and for contamination with aflatoxins B1, B2, G1, and G2 by high-performance liquid chromatography (HPLC). Among the tested spice samples, chili powder showed the highest presence of fungal propagules, while ginger, curry and garlic samples did not present any fungal contamination. A total of 120 isolates, mostly belonging to Aspergillus and Penicillium genera, were collected and 33 representative species were identified by amplification and sequencing of the internal transcribed spacer (ITS) region. Aspergillus flavus, Aspergillus nomius and Aspergillus niger were the most dominant. Thirty-seven Aspergillus strains were screened for their potential to produce aflatoxins using biochemical and molecular tools: only 9 A. flavus strains showed both fluorescence and amplification with all the three primers targeting aflP, aflM and aflR genes. Aflatoxins were detected in five spices (black pepper, chili, tandoori masala. turmeric and garam masala), and with the exception of garam masala, the tested samples of turmeric, black pepper, tandoori masala and chili powder exceeded B1 and/or total aflatoxin maximum levels. Our results demonstrate the potential for mycotoxin biosynthesis by fungi contaminating imported spice products. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Mycotoxin risk Food safety Aspergillus Penicillium Aflatoxin biosynthetic genes
1. Introduction A wide array of spices are commonly used as seasoning in Qatar’s traditional cuisine. Most of these spices are produced in countries with tropical climates where high temperature, humidity, and rainfall stimulate growth of fungi and contamination by mycotoxins (Martins, Martins, & Bernardo, 2001). Aflatoxins (AFs) are secondary metabolites which are of great concern because of their detrimental effects on human and animal health, including carcinogenic, mutagenic, teratogenic, and immunosuppressive effects (Eaton & Gallagher, 1994). These mycotoxins are produced mainly by Aspergillus flavus Link, Aspergillus parasiticus Speare and Aspergillus nomius Kurtzman, B.W. Horn & Hesselt (Rajasinghe, Abeywickrama, & Jayasekera, 2009). The four main naturally-occurring aflatoxins are aflatoxin B1, aflatoxin B2, aflatoxin G1 and aflatoxin G2. Among them, aflatoxin B1 * Corresponding author. Dipartimento di Agraria, Università degli Studi di Sassari, Viale Italia 39, 07100 Sassari, Italy. Tel.: þ39 (0)79 229295; fax: þ39 (0)79 229316. E-mail address: [email protected] (Q. Migheli). 1 The first two authors have equally contributed to the present work. 0956-7135/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.foodcont.2013.09.027
is the most common, as well as the most dangerous for its ability to cause liver cancer in human. Aflatoxins are heat-resistant and can withstand exposure to normal cooking temperatures and microwave treatment (Midio, Campos, & Sabino, 2001). In recent years, the natural occurrence of aflatoxin in spices has been studied by several teams. A Qatari study on food products showed that chili powder and mixed spices powder contained an aflatoxin level of 69.3 mg/kg and 5.1 mg/kg, respectively (Abdulkadar, Al-Ali, Al-Kildi, & Al-Jedah, 2004). Romagnoli, Menna, Gruppioni, and Bergamini (2007) noted that, out of the 103 samples collected from Italian market and analyzed for aflatoxin content, 7 spice samples resulted positives: 5 chili-peppers, 1 nut meg and 1 cinnamon. Other researchers also detected very high levels of aflatoxin contamination in chilies (Yerneni et al., 2012). Previous reports were focused on the fungal contamination in spices. Aspergillus (25 species) and Penicillium (7 species) were the predominant genera in 120 samples of 24 kinds of spices in Egypt (El-Kady, El-Maraghy, & Mostafa, 1992). A. flavus, Aspergillus niger Tiegh., Aspergillus ochraceus G. Wilh., Aspergillus fumigatus Fresen., A. flavus var. columnaris Raper & Fennell, Aspergillus terreus Thom, Penicillium chrysogenum Thom and Penicillium corylophilum Dierckx
178
W. Hammami et al. / Food Control 37 (2014) 177e181
were the most common species. Ahene, Odamtten, and Owusu (2011) reported that A. flavus was the most frequently isolated species in all the spice products marketed in Ghana. Aspergillus alutaceus Berk. & M.A. Curtis (an ochratoxin producer) and Fusarium verticillioides (Sacc.) Nirenberg were also isolated. Most of these studies were carried out by using traditional methods, such as the observation of macro- or microscopic features, and the ability to grow on specific media, hence possibly leading to over- or underestimation of fungal species. In the present study, we aimed at investigating the presence of fungal contamination in different spices available in the Qatari markets. A polymerase chain reaction (PCR)-based approach targeting both the Internal Transcribed Spacer (ITSI-5.8S-ITS2; ITS) region of the nuclear rRNA genes and three genes in the aflatoxin biosynthesis pathway was adopted in order to understand the relationship between fungal population and aflatoxin content. Our results further emphasize the need to monitor the levels of mycotoxin contamination in susceptible commodities and to evaluate the health risk related to the consumption of food products that are largely used in domestic cooking.
Lee, & Taylor, 1990). Each PCR reaction was performed using 12.5 ml of Taq PCR Master Mix 2X (QIAGEN, California, USA), 0.5 ml of both the forward and reverse primers (10 pmol), 5e10 ng DNA template and ultrapure H2O up to 25 ml. The thermocycler was set as follows: initial denaturation at 94 C for 5 min; 35 cycles of 30 s at 94 C for denaturation, 30 s at 54 C for annealing and 30 s at 72 C for elongation, followed by a final elongation step of 5 min at 72 C. To check the amplified DNA, 5 ml of each reaction were loaded on a 1% agarose gel containing ethidium bromide (0.5 mg/ml) and visualized under ultraviolet light. 2.4.2. PCR product purification and sequencing PCR products were purified with Pure-Link PCR Purification Kit (Life Technologies California, USA) according to the manufacturer’s instructions, and their concentration was then determined with a QubitÒ 2.0 Fluorometer (Life Technologies California, USA). Twenty ng of DNA template and 6.4 pmol of either ITS-1 or ITS-4 primer were collected into sequencing tubes, dried in the themocycler at 60 C and sent to BMR-Genomics company of the University of Padova (Italy) for the sequencing service. Sequences were then blasted in the NCBI database to provide species identification.
2. Materials and methods 2.5. Determination of aflatoxin levels in spices 2.1. Sampling
To perform genomic DNA extraction, fungi were grown for 3e7 days at 28 C in potato dextrose broth (PDB; Becton, India). Fungal mycelia were collected and ground in a mortar using liquid nitrogen. The DNA extraction was carried out with DNeasy Plant Mini Kit (QIAGEN, California, USA) according to the manufacturer’s instructions. Five ml of each DNA sample were checked on a 1% agarose gel containing ethidium bromide (0.5 mg/ml) and visualized under ultraviolet light.
Aflatoxin contamination level was determined in the Central Food Laboratory (Ministry of Public Health, Doha, Qatar) using a high performance liquid chromatography (HPLC). Forty g of spice powder were mixed with 150 ml of acetonitrile: water (60:40) with a high speed laboratory blender for 3 min. After filtration with Whatman No. 1 filter, 2 ml of the filtrate were diluted with 48 ml of phosphate buffer saline (PBS, pH 7.4). The solution was injected into the immuno-affinity column (R-Biopharm RHONE, Glasgow, Scotland) which is prior condition by 15 ml phosphate buffer saline, at a flow rate of 0.5 ml/min. The column was then washed with 10 ml of distilled water, dried in an air stream and, finally, elution was carried out with 1.5 ml of methanol passing slowly through the immuno-affinity column. Methanol was then evaporated on a water bath (at about 70 C) under steam of nitrogen until dried completely. The residue was resuspended with 200 ml of hexane and 50 ml of trifluoroacetic acid in a 4 ml vial and the solution was vortexed for 30 s. After the addition of 1.95 ml of acetonitrile: water (1:9), reaction was allowed by mixing for 30 s and then 50 ml of the sample solution (aqueous layer) were injected on HPLC after passing through 0.22 mm syringe filter. The mobile phase consisted of acetonitrile: water : methanol (180:640:180) while the flow rate was set at 1 ml/min. The HPLC column used was a Nova pack C18: 4 mm, 150 3.9 mm (Waters, Milford, USA). Mycotoxin standards (aflatoxin B1, B2, G1 and G2) were purchased from Sigma, Germany. From the stock solution (1000 ppb for B1 and B2; 300 ppb for G1 and G2), a mixed standard solution was prepared by serial dilutions of water: acetonitrile (9:1) aiming to get the concentration of 0.5e 50 ppb of B1 and G1 and 0.15e15 ppb of B2 and G2 from an initial stock concentrations of 1000 ppb for B1 and G1 and 300 ppb for B2 and G2.
2.4. Fungal identification
2.6. Fluorescence detection
Isolated strains were preliminarily grouped according to their morphological differences and one or two representatives from each of these groups was further analyzed molecularly by PCR and sequencing of the ITS region as described below.
Coconut agar medium (CAM) was used for rapid detection of aflatoxin synthesis (Lin & Dianese, 1976). Briefly, one hundred g of shredded coconut were homogenized for 5 min with 300 ml of hot distilled water. The homogenate was filtered through four layers of cheesecloth, and the pH of the clear filtrate was adjusted to pH 7 with 2 N NaOH. After agar addition, the medium was autoclaved. The plates were inoculated with PDA plugs of Aspergillus strains and then incubated at 28 C for 3e5 days. The reverse side of the plates
The fourteen powdered spices used in this study were obtained from three Qatari local markets. These were: chili, kashmiri chili hot, kashmiri chili mild, basil, oregano, ginger, curry, cumin, turmeric, tandoori masala, garam masala, black pepper, garlic and coriander. One kilogram of each spice was sampled and stored at 4 C until analysis. 2.2. Mycological examination Total fungal counts were determined according to Samson, Hocking, Pitt, and King (1992). Ten grams of each spice were homogenized in 90 ml of sterile water for 2 min. Aliquots (100 ml) were plated onto sterile plastic Petri dishes containing solidified dichloran rose bengal chloramphenicol (DRBC) agar (Sigma, USA) and incubated at 28 C for 5 days. After monospore isolation on potato dextrose agar (PDA) (Himedia, India), fungal cultures were preserved in sterile water at 4 C until molecular identification (Nakasone, Peterson, & Jong, 2004). 2.3. Fungal genomic DNA extraction
2.4.1. ITS1-ITS4 amplification The 5.8S ribosomal DNA region (600 bp) of the selected isolates was amplified using universal primers ITS1 and ITS4 (White, Bruns,
W. Hammami et al. / Food Control 37 (2014) 177e181
179
Table 1 Total mycoflora isolated from spice samples after 5 days incubation on potato dextrose agar at 28 C. Spice sample
CFU/G (mean SD)
Aspergillus spp.
Chili Kashmiri chili hot
1280 50 550 34
Kashmiri chili mild Black pepper
720 73 40 12
Turmeric Cumin Basil
140 23 60 30 510 34
A. flavus (12), A. tamarii (3), A. niger (2) A. flavus (10), A. tamarii (2), A. niger (2), A. melleus (1) A. flavus (8), A. versicolor (3), A. niger (2) A. flavus (6), A. tamarii (1), A. niger (2), Eurotium rubrum (2) A. flavus (7), A. nomius (2), A. niger (1) A. niger (4) A. niger (3) , A. ochraceus (2)
Tandoori masala Garam masala Oregano Coriander Ginger Garlic Curry
220 10 70 20 0 0 0
54 10 26 4 0 0 0
Penicillium spp.
Other genera
P. charlesii (2), P. verruculosum (2)
Alternaria (1)
P. citrinum (2), P. griseofulvum (1)
P. P. P. P.
charlesii (1) aurantiogriseum (2), commune (1), melanoconidium (2)
Embellisia sp., (1) Stachybotrys echinata (1)
A. niger (3), A. flavus (8), A. nomius (4) Eurotium sp. (4) Unidentified fungus (2)
A. niger (4)
was periodically observed under 365 nm UV light for blue fluorescence. 2.7. Molecular identification of aflatoxin-producing isolates Multiplex PCR was used to amplify three target fragments of the aflatoxin-biosyntetic aflP, aflM and aflR genes. Primers OMT (50 GGCCCGGTTCCTTGGCTCCTAAGC30 /50 CGCCCCAGTGAGACCCTTC CTCG30 ), APA (50 TATCTCCCCCCGGGCATCTCCCGG30 /50 CCGTCAGA CAGCCACTGGACACGG30 ) and REV (50 ATGTCGGATAATCACCGTTT AGATGGC30 /50 CGAAAAGCGCCACCATCCACCCCAATG30 ) (Richard, Heutte, Bouchart, & Garon, 2009; Shapira et al., 1996) were used to amplify 1254 bp, 1034 bp and 896 bp fragments, respectively. PCR assays were performed in 25 ml of reaction mixture containing 5e10 ng of genomic DNA, 2.5 ml dNTP Mix (2 mM), 1 ml of each primer (10 mM) and H2O, each reaction mixture was heated to 95 C for 10 min before 2.5 U of Taq DNA polymerase (Qiagen, California, USA) was added. The PCR program was set as follow: 30 cycles of 1 min at 94 C for denaturation, 2 min at 65 C for annealing, 2 min at 72 C for extension, and a 5-min final extension step at 72 C. The PCR products were analyzed by electrophoresis on a 1% agarose gel containing ethidium bromide (0.5 mg/ml). 3. Results and discussion Dehydrated products, such as spices, may represent a suitable environment to the survival of mycotoxigenic fungi due to postharvest practices, improper storage and conducive environmental conditions. In this study, fourteen spice samples collected in Qatari markets were surveyed for fungal contamination. The main genera isolated were Aspergillus and Penicillium (Table 1). Other common mycotoxin-producing fungi, such as Fusarium and Alternaria (except for Kashmiri chili hot) were not detected. These results are in agreement with a previous report by Hassan (1984), where Fusarium contamination was never detected among 12 spice samples tested. Chili powder showed the highest fungal contamination (1280 CFU/g), followed by mild and hot kashmiri chili and basil (720 CFU/g, 550 CFU/g and 510 CFU/g respectively). A similar level of contamination (1580 CFU/g) was found by Mandeel (2005) in chili samples. Unlike previous reports (Ahene et al., 2011; Chaiprasert, Komolpis, Anukarahanonta, & Imwidthya, 1987), the tested samples of ginger powder, garlic powder, and curry did not present any relevant fungal contamination. A number of studies outlined the antifungal activity of ginger and garlic against
P. aurantiogriseum (4)
Aspergillus species (Irkin & Korukluoglu, 2007). This effect could explain also the low fungal population detected in garam masala powder. In fact, this spice is a mix of many crude spices, some of them with proven antifungal activity (Kubra, Murthy, & Rao, 2013). Hence, we can presume that the formulation of some mixed spices represents an inhibiting factor against fungal growth. Most published reports on the incidence of fungal contaminants in spice samples are based on traditional approaches to species identification (Salari, Habibi Najafi, Boroushaki, Mortazavi, & Fathi Najafi, 2012; Santos et al., 2011; Sumanth, Waghmare, & Shinde, 2010). Alternative strategies leading to unambiguous identification of specific genomic sequences are now becoming essential to clearly characterize fungal species. In this survey, we have carried out a preliminary characterization of our fungal collection from marketed spice samples by sequencing the internal transcribed spacer (ITS) region of the fungal genome. Out of 120 fungal isolates, 33 representatives were selected based on their morphological and cultural characteristics for further molecular studies and used as a reference to identify the rest of the fungal isolates. The most frequent among Aspergillus sp. isolates were identified as A. flavus, A. nomius, A. niger, Aspergillus tamarii Kita, Aspergillus melleus Yukawa and Aspergillus versicolor (Vuill.) Tirab. (Supplementary Table S1). Furthermore, seven common species of Penicillium were detected, albeit infrequently: Penicillium aurantiogriseum Dierckx, Penicillium commune Thom, Penicillium melanoconidium (Frisvad) Frisvad & Samson, Penicillium charlesii G. Sm., Penicillium verruculosum Peyronel, Penicillium citrinum Thom and Penicillium griseofulvum Dierckx. Abou-Arab, Kawther, El Tantawy, Badeaa, and Khayria (1999) highlighted that Penicillium species were more frequently isolated from packed spice samples than in bulked spice
Table 2 Aflatoxin levels (mg kg1 SD) detected in spice samples. Spice sample G1 Garam masala Tandoori masala Turmeric Chili Black pepper
B1
6.22 1.23 ND
G2 1.88 0.3
B2 ND
Total aflatoxins 8.1
ND
18.58 1.1
13.21 0.6 ND 11.91 0.1
ND ND ND 13.21 69.28 1.08 ND 1.73 0.05 71.01 1.85 0.16 70.33 1.17 ND 84.09
ND: not detected (below detection limit).
ND
0.18 0.05 18.76
180
W. Hammami et al. / Food Control 37 (2014) 177e181
Table 3 Biochemical and molecular characterization of Aspergillus strains isolated from spice samples. Strain
Species
Spice sample
ATchi1 AFchi5 AFchi7 AFchi8 AFchi9 AFchi10 AFchi11 AFchi13 AFchi14 AFtur3 AFtur4 AFtur5 AFtur6 AFtur7 AFtur10 ATbp2 AFbp3 AFbp4 AFbp5 AFtan3 ANtan4 AFtan7 AFtan8 AFtan9 AFtan10 AFchi11 AFkh1 AFkh3 AFkh4 AFkh6 AFkh9 AFkm5 AFkm9 AVkm11 AObas7 ANbas4 ERgar1
A. tamarii A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. tamarii A. flavus A. flavus A. flavus A. flavus A. niger A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. flavus A. versicolor A. ochraceus A. niger Eurotium. sp.
Chili Chili Chili Chili Chili Chili Chili Chili Chili Turmeric Turmeric Turmeric Turmeric Turmeric Turmeric Black pepper Black pepper Black pepper Black pepper Tandoori Tandoori Tandoori Tandoori Tandoori Tandoori Tandoori Kashmiri chili hot Kashmiri chili hot Kashmiri chili hot Kashmiri chili hot Kashmiri chili hot Kashmiri chili mild Kashmiri chili mild Kashmiri chili mild Basil Basil Garam masala
Blue fluorescence PCR products intensity aflP aflR aflM þþþ þþ þþ þ þþ þþ þþþ þþþ þþþ
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
þ þ þ þ þ þ þ þ þ þ þ þ
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ e
samples, due to the presence of higher humidity inside the pack. The packaging can affect the fungal population as well as the growth rate due to the variation of many factors as the humidity and the aeration. Aflatoxins are considered by health authorities among the most harmful mycotoxins towards humans and animals (Peraica, Radic, Lucic, & Pavlovic, 1999; Wild & Turner, 2002). Our spice samples were screened for the presence of aflatoxins G1, B1, G2, and B2 by HPLC. Five over 12 samples contained one or more of these toxins (Table 2). According to the European Commission Regulations (No 165/2010), the maximum levels of aflatoxin in spices are 5 mg/kg for the B1 and 10 mg/kg for the sum B1, B2, G1 and G2. Thereby, garam masala (0 mg/kg of B1 and 8.1 mg/kg of total aflatoxin), turmeric (0 mg/kg and 13.21 mg/kg, respectively) and black pepper (1.85 mg/kg and 84.09 mg/kg, respectively) samples exceed the limit set for total aflatoxin level, whereas tandoori (18.58 mg/kg and 18.76 mg/kg) and the chili powder (69.28 mg/kg and 71.01 mg/kg) tested samples exceed both the B1 and the total aflatoxin maximum levels. The highest level of total aflatoxins (84.09 mg/kg) was found in black pepper. This result is in agreement with Seenappa and Kempton (1980), who demonstrated the suitability of black pepper as a substrate for aflatoxin production by A. flavus under artificial conditions. The chili powder analyzed in the present study contained a very high level of B1 aflatoxin, therefore confirming a previous report on
Fig. 1. Band pattern of different Aspergillus spp. isolates as resulting from multiplex PCR reactions primed by OMT, APA and VER primers. Lanes: Lane 1 ¼ A. flavus AFkh1, Lane 2 ¼ A. flavus AFkh3, Lane 3 ¼ A. flavus AFtan7, Lane 4 ¼ A. flavus AFtan8, Lane 5 ¼ A. flavus AFchi5, Lane 6 ¼ A. flavus AFchi7, Lane 7 ¼ A. flavus AFchi8, Lane 8 ¼ Eurotium. Sp ERgar1, Lane 9 ¼ A. flavus AFbp3, Lane 10 ¼ A. flavus AFbp4, Lane 11 ¼ A. flavus AFbp5, Lane 12 ¼ A. flavus AFkm5, Lane 13 ¼ A. flavus AFkm9, Lane 14 ¼ negative control, Lane 15 ¼ 1 Kb DNA ladder (Promega, Wisconsin, USA).
aflatoxin contamination in chili powder available in Qatari markets at up to 69.3 mg/kg (Abdulkader et al. 2004). No aflatoxins were detected in ginger, garlic, coriander, kashmiri chili mild and hot, basil, oregano, cumin and curry. Several authors reported that the absence of aflatoxins in crude spices may be explained by the presence of essential oils, which may prevent toxin production in spite of a dramatic Aspergillus species contamination of the samples (Abou-Arab et al., 1999; El-Shafie et al., 2002). Moreover, the effect of nine oils was tested against both the growth and the toxicity of A. parasiticus and Fusarium moniliforme J. Sheld. (Juglal, Govinden, & Odhav, 2002). The clove oil was able to inhibit the growth of these fungi, to limit the production of fumonisins and to stop the aflatoxins synthesis. Also, Atanda, Akpan, and Oluwafemi (2007) showed that aflatoxin biosynthesis can be completely inhibited when basil leaves were added to the culture medium, hence proposing their use as preservative agents against Aspergillus contamination on sorghum grain. Most of the fungal species identified in our study have been previously reported as being able to produce mycotoxins (Bugno, Buzzo Almodovar, Caldas Pereira, Andreoli Pinto, & Sabino, 2006). In this context, representatives of Aspergillus spp. were tested for their aflatoxigenic nature based on the ability to generate blue fluorescence on CMA as well as by PCR methods using OMT, VER and APA-specific primers (Richard et al., 2009; Shapira et al., 1996) targeting aflP, aflM and aflR genes, respectively. aflR is a regulatory gene (Yu et al., 1995, 2004), while aflP and aflM genes are structural genes in the aflatoxin biosynthetic pathway. In total, 30 A. flavus strains were tested, but only 30% of them showed their potential aflatoxin producing ability. This is consistent with a previous report by Elshafie, Al-Rashdi, Al-Bahry, and Bakheit (2002), who observed that 45% of the A. flavus strains isolated from 105 spice samples were aflatoxigenic. Our results showed that fluorescence and PCR results are mostly in accordance (Table 3): except for strains AFtan3, AFbp3 and AFchi5, the presence of amplimers derived from the three genes matched the detection of fluorescence on CAM. Twelve of the tested A. flavus strains showed amplification with all the three aflatoxigenic primers aflR, aflM and aflP, while others contained only aflP sequences, such as A. nomius (Table 3; Fig. 1). No such amplimers were ever detected in A. niger, A. tamarii, A. ochraceus and A. versicolor (Table 3). Yet, this molecular tool is not always sufficient enough to identify the aflatoxigenic strains of A. flavus. Yang et al. (2004)
W. Hammami et al. / Food Control 37 (2014) 177e181
noted that some strains were unable to produce aflatoxins in spite of the presence of all the four aflD, aflM, aflP and aflR genes. An alternative approach was proposed to detect aflatoxigenic strains of A. flavus and A. parasiticus by using a reverse transcriptionepolymerase chain reaction (RT-PCR) technique (Scherm, Palomba, Serra, Marcello, & Migheli, 2005). Some potential aflatoxigenic strains were identified in Kashmiri chili mild and Kashmiri chili hot samples, in spite of the absence of aflatoxins in these spices. Our study suggests that the mycoflora content may be indicative of aflatoxin contamination except for Kashmiri chili, mild and hot, where no relationship could be confirmed. In fact, the presence of mycotoxigenic fungi in food samples does not ultimately lead to the production of the respective mycotoxin. Many factors including storage and environmental conditions play a key role in the metabolism of secondary metabolites such as mycotoxins (Hope, Aldred, & Magan, 2005). In this context, Paterson, Venancio, and Lima (2003) indicated that many fungi which produce mycotoxins can also degrade them under specific conditions. In this survey, a combination of morphological, physiological, and molecular tools was used to preliminarily assess the contamination of common spices imported to Qatar. While we focused our study on aflatoxins and aflatoxigenic fungi, we are aware of the additional risk related to the presence on spice samples of other relevant mycotoxins, such as trichothecenes, ochratoxin and patulin. Our results clearly show that there is a high risk potential for contamination of these products by mycotoxigenic fungi. It is highly advisable to test the spice samples for fungal/mycotoxin contamination after their release to the local market, particularly because the climatic conditions may be favorable to fungal proliferation and toxin production during shelf life. Acknowledgments This publication was made possible by NPRP grant # NPRP 4259-2-083 from the Qatar National Research Fund (a member of Qatar Foundation). The statements made herein are solely the responsibility of the authors. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.foodcont.2013.09.027. References Abdulkadar, A. H. W., Al-Ali, A. A., Al-Kildi, A. M., & Al-Jedah, J. H. (2004). Mycotoxins in food products available in Qatar. Food Control, 15, 543e548. Abou-Arab, A. A. K., Kawther, M. S., El Tantawy, M. E., Badeaa, R. I., & Khayria, N. (1999). Quantity estimation of some contaminants in commonly used medicinal plants in the Egyptian market. Food Chemistry, 67, 357e363. Ahene, R. E., Odamtten, G. T., & Owusu, E. (2011). Fungal and bacterial contaminants of six spices and spice products in Ghana. African Journal of Environmental Science and Technology, 5, 633e640. Atanda, O. O., Akpan, I., & Oluwafemi, F. (2007). The potential of some spice essential oils in the control of A. parasiticus CFR 223 and aflatoxin production. Food Control, 18, 601e607. Bugno, A., Buzzo Almodovar, A. A., Caldas Pereira, T., Andreoli Pinto, T., & Sabino, M. (2006). Occurrence of toxigenic fungi in herbal drugs. Brazilian Journal of Microbiology, 37, 47e51. Chaiprasert, A., Komolpis, P., Anukarahanonta, T., & Imwidthya, S. (1987). Bacterial fungal and aflatoxin contamination of medicinal herbs, spices and curry in Bangkok. Siriraj Medical Journal, 39, 27e39. Commission Regulation (EU) No. 165/2010 of 26 February 2010 amending Regulation (EC) No. 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards aflatoxins. Official Journal of the European Communities. L 50/12. Brussels. Eaton, D. L., & Gallagher, E. P. (1994). Mechanisms of aflatoxin carcinogenesis. Annual Review of Pharmacology and Toxicology, 34, 135e172.
181
El-Kady, S., El-Maraghy, S. M., & Mostafa, E. M. (1992). Contribution of the mesophilic fungi of different spices in Egypt. Mycopathologia, 120, 93e101. Elshafie, E. A., Al-Rashdi, T. A., Al-Bahry, S. N., & Bakheit, C. S. (2002). Fungi and aflatoxins associated with spices in the Sultanate of Oman. Mycopathologia, 155, 155e160. Hassan, H. (1984). Effect of gamma radiation on the microflora of some spices. M. Sc. thesis Faculty of Sciences. Cairo, Egypt: Ain Shams University. Hope, R., Aldred, D., & Magan, N. (2005). Comparison of environmental profiles for growth and deoxynivalenol production by Fusarium culmorum and Fusarium graminearum on wheat grain. Letters in Applied Microbiology, 40, 295e300. Irkin, R., & Korukluoglu, M. (2007). Control of Aspergillus niger with garlic, onion and leek extracts. African Journal of Biotechnology, 6, 384e387. Juglal, S., Govinden, R., & Odhav, B. (2002). Spice oils for the control of co-occurring mycotoxin-producing fungi. Journal of Food Protection, 65, 683e687. Kubra, I. R., Murthy, P. S., & Rao, L. J. (2013). In vitro antifungal activity of dehydrozingerone and its fungitoxic properties. Journal of Food Science, 78, 64e69. Lin, M. T., & Dianese, J. C. (1976). A coconut-agar medium for rapid detection of aflatoxin production by Aspergillus spp. Phytopathology, 66, 1466e1469. Mandeel, Q. A. (2005). Fungal contamination of some imported spices. Mycopathologia, 159, 291e298. Martins, M. L., Martins, H. M., & Bernardo, F. (2001). Aflatoxins in spices marketed in Portugal. Food Additives and Contaminants, 18, 315e319. Midio, A. F., Campos, R. R., & Sabino, M. (2001). Occurrence of aflatoxins B1, B2, G1 and G2 in cooked food components of whole meals marketed in fast food outlets of the city of São Paulo, SP, Brazil. Food Additives and Contaminants, 18, 445e448. Nakasone, K. K., Peterson, S. W., & Jong, S. (2004). Preservation and distribution of fungal cultures. In G. M. Müller, G. F. Bills, & M. S. Foster (Eds.), Biodiversity of fungi: Inventory and monitoring methods (pp. 37e47). Amsterdam: Elsevier Academic Press. Paterson, R. R. M., Venancio, A., & Lima, N. (2003). Mycotoxins e the experience and expertise of Micoteca da Universidade do Minho. In Biological resource centres and the use of microbes, European Culture Collections’ Organisation XXII (pp. 217e 233). Braga: Portugal Micoteca da Universidade do Minho. Peraica, M., Radic, B., Lucic, A., & Pavlovic, M. (1999). Toxic effects of mycotoxins in humans. Bulletin of the World Health Organization, 77, 754e766. Rajasinghe, M., Abeywickrama, K., & Jayasekera, R. (2009). Aflatoxigenic Aspergillus flavus and aflatoxin formation in selected spices during storage. Tropical Agricultural Research and Extension, 12, 1e6. Richard, E., Heutte, N., Bouchart, V., & Garon, D. (2009). Evaluation of fungal contamination and mycotoxin production in maize silage. Animal Feed Science and Technology, 148, 309e320. Romagnoli, B., Menna, V., Gruppioni, N., & Bergamini, C. (2007). Aflatoxins in spices, aromatic herbs, herb-teas and medicinal plants marketed in Italy. Food Control, 18, 697e701. Salari, R., Habibi Najafi, M. B., Boroushaki, M. T., Mortazavi, S. A., & Fathi Najafi, M. (2012). Assessment of the microbiological quality and mycotoxin contamination of Iranian red pepper spice. Journal of Agricultural Science and Technology, 14, 1511e1521. Samson, R. A., Hocking, A. D., Pitt, J. I., & King, A. D. (1992). Modern methods in food mycology. In Developments in food science (Vol. 31). Amsterdam: Elsevier. Santos, L., Marín, S., Mateo, E. M., Gil-Serna, J., Valle-Algarra, F. M., Patiño, B., et al. (2011). Mycobiota and co-occurrence of mycotoxins in Capsicum powder. International Journal of Food Microbiology, 151, 270e276. Scherm, B., Palomba, M., Serra, D., Marcello, A., & Migheli, Q. (2005). Detection of transcripts of the aflatoxin genes aflD, aflO, and aflP by reverse transcription polymerase chain reaction allows differentiation of aflatoxin-producing and non-producing isolates of Aspergillus flavus and Aspergillus parasiticus. International Journal of Food Microbiology, 98, 201e210. Seenappa, M., & Kempton, A. G. (1980). Aspergillus growth and aflatoxin production on black pepper. Mycopathologia, 70, 135e137. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A., & Salomon, R. (1996). Detection of aflatoxigenic molds in grains by PCR. Applied and Environmental Microbiology, 62, 3270e3273. Sumanth, G. T., Waghmare, B. M., & Shinde, S. R. (2010). Incidence of mycoflora from the seeds of Indian main spices. African Journal of Agricultural Research, 5, 3122e3125. White, T. J., Bruns, T. D., Lee, S. B., & Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, & T. J. White (Eds.), PCR protocols: A guide to methods and applications (pp. 315e322). London: Academic Press. Wild, C. P., & Turner, P. C. (2002). The toxicology of aflatoxins as a basis for public health decisions. Mutagenesis, 17, 471e481. Yang, Z. Y., Shim, W. B., Kim, J. H., Park, S. J., Kang, S. J., Nam, B. S., et al. (2004). Detection of aflatoxin producing moulds in Korean fermented foods and grains by multiplex PCR. Journal of Food Protection, 67, 2622e2626. Yerneni, S. G., Hari, S. S., Jaganathan, R., Senthamarai, M., Vasanthi, N. S., & Kannan, K. P. (2012). Determination of the level of aflatoxin present in the marketed spices. World Journal of Science and Technology, 2, 31e34. Yu, J. H., Chang, P. K., Ehrlich, K. C., Cary, J. W., Bhatnagar, D., Cleveland, T. E., et al. (2004). Clustered pathway genes in aflatoxin biosynthesis. Applied and Environmental Microbiology, 70, 1253e1262. Yu, J. H., Chang, P. K., Payne, G. A., Cary, J. W., Bhatnagar, D., & Cleveland, T. E. (1995). Comparison of the omt A genes encoding o-methyltransferases involved in aflatoxin biosynthesis from Aspergillus parasiticus and A. flavus. Gene, 163, 121e125.