Gene-based screening for Y chromosome deletions in Taiwanese men presenting with spermatogenic failure

FERTILITY AND STERILITY威 VOL. 77, NO. 5, MAY 2002 Copyright ©2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A.

Gene-based screening for Y chromosome deletions in Taiwanese men presenting with spermatogenic failure Yung-Ming Lin, M.D.,a Ying-Hung Lin, M.Sc.,b Yen-Ni Teng, Ph.D.,c Chao-Chin Hsu, Ph.D.,d Johnny Shinn-Nan Lin, M.D.,a and Pao-Lin Kuo, M.D.b,e National Cheng Kung University, College of Medicine, Tainan, Taiwan

Received June 21, 2001; revised and accepted November 13, 2001. Supported by grants NSC89-2314-B-006-114 and NSC-89-2314-B-006-144 from the National Science Council of the Republic of China. Reprint requests: Pao-Lin Kuo, M.D., Division of Genetics, Department of Obstetrics and Gynecology, National Cheng Kung University Hospital, 138 Sheng-Li Road, Tainan, Taiwan 704 (FAX: 886-6-276-6185; E-mail: [email protected]. edu.tw). a Department of Urology, National Cheng Kung University. b Institute of Molecular Medicine, National Cheng Kung University. c Department of Early Childhood Education and Nursery, Chia Nan University of Pharmacy and Science, Tainan, Taiwan. d Taiwan United Birth Promoting Experts, Tainan, Taiwan. e Department of Obstetrics and Gynecology, National Cheng Kung University. 0015-0282/02/$22.00 PII S0015-0282(02)03059-5

Objective: To develop a simple and rapid protocol for detecting deletions of the Y chromosome and to evaluate the feasibility of gene-based screening in men with spermatogenic failure. Design: Prospective case study. Setting: University-based reproductive clinics and genetics laboratory. Patient(s): Two hundred two infertile men presenting with severe oligozoospermia and nonobstructive azoospermia. Intervention(s): Fifteen gene-specific primers were used to detect deletions of Y chromosome genes in men with spermatogenic failure. A multiplex polymerase chain reaction amplification system was developed to facilitate rapid screening. Another 24 markers for sequence-tagged sites (STS) were used to ensure the adequacy of gene-based screening. Main Outcome Measure(s): Detection of deletions of Y chromosome genes. Result(s): Of 180 patients evaluated, 19 (10.6%) had deletions of one or more genes, including DFFRY, DBY, RBM1, DAZ, CDY1, and BPY2. A second round of STS-based screenings did not show an increase in the deletion rate but more clearly defined the extent of deletion in 14 of the 19 patients. In most patients, deletions detected by gene-based screening were similar to those detected by STS markers. Conclusion(s): Gene-based screening with multiplex polymerase chain reaction is a rational alternative for detecting deletions of Y chromosome genes in infertile men. (Fertil Steril威 2002;77:897–903. ©2002 by American Society for Reproductive Medicine.) Key Words: Y chromosome gene, spermatogenic failure, multiplex polymerase chain reaction

Genetic defects have been implicated in the pathogenesis of spermatogenic failure. The azoospermia factor (AZF) on the long arm of the Y chromosome (Yq), originally defined by cytogenetic findings in six azoospermic men (1), has been widely studied in the past decade. It has been postulated that Yq11 deletions encompassing three nonoverlapping regions (AZFa, AZFb, and AZFc) could be responsible for disruption of spermatogenesis (2). To date, most studies have used sequencetagged site (STS) primers, and the incidence of Y microdeletions has varied widely, from 1% to 55% (3, 4). Deletions varied in both extent and location, and no genotype–phenotype correlation could be easily recognized. A possible explanation for the overt divergence may be experimental design. The STS map in the eu-

chromatic region of the Y chromosome has been revised several times, and most of the STS primers used thus far amplify anonymous sequences. Most STS markers are not known to belong to specific genes (5– 8). Therefore, a microdeletion of an STS could represent a clinically irrelevant polymorphism rather than the cause of spermatogenic failure (9 –14). More than 30 genes and gene families have been identified thus far in the human Y chromosome (15–17). Some of these genes are located in AZF deletion intervals. Excluding genes located in the pseudoautosomal region, two general types of genes exist: Y-specific multicopy genes and X-Y homologous singlecopy genes. Two potential AZF candidates, RBM1 and DAZ, have been implicated in testisspecific RNA metabolism; the functions of 897

other genes remain unclear (14). To explore their functional roles, deletions of individual genes must be examined in patients with spermatogenic defects. To date, most STS-based studies have incorporated only one or two gene-specific primers (DAZ and RBM1) and other STSs belonging to anonymous markers. A complete array of Y chromosome genes was tested in a single study in which 51 men undergoing testicular sperm extraction were screened for Y chromosome microdeletions (18). Other studies have focused on three to six gene-specific markers (14, 19 –23). Because most other studies used anonymous STSs, individual gene-deletion status was unavailable in most patients, and genotype–phenotype correlation was therefore not possible. We used 15 gene-specific markers to detect Y chromosome deletions in Taiwanese men with spermatogenic failure.

MATERIALS AND METHODS Overview Three genes are located in the AZFa region: DFFRY (Drosophila fat facets related Y-linked), DBY (dead/H box-3, Y-linked), and UTY (ubiquitously transcribed tetratricopeptide repeat gene on Y chromosome). Four genes are located in the AZFb region: EIF1AY (eukaryotic translation initiation factor 1A, Y isoform), PRY (PTP-BL related protein on Y; also copies in 4A and 6E), TTY2 (testis transcript on Y; gene 2, with a copy in 4A), and RBM1 (RNA-binding motif protein; Y chromosome, family 1). Three genes are located in the AZFc region: DAZ (deleted in azoospermia), BPY2 (basic protein on Y chromosome 2), and CDY1 (chromodomain protein on Y chromosome). We also examined five genes beyond the AZF region: TB4Y (thymosin ␤4 on Y chromosome), BPY1 (basic protein on Y chromosome 1), CDY2 (chromodomain protein on Y chromosome 2), XKRY (XK-related protein on Y chromosome), and SMCY (selected cDNA on Y, homologue of mouse). A multiplex polymerase chain reaction (PCR) amplification system was developed to facilitate rapid screening. Another set of 24 STS markers was used in all patients to further define the position and extent of deletions and to ensure the adequacy of the gene-based screening strategy (24).

Patients From January 1997 to March 2001 in our urology clinic, we studied 202 consecutive, unselected infertile patients presenting with severe oligozoospermia (5 ⫻ 106 cells/mL) or nonobstructive azoospermia. One hundred fertile men were enrolled as controls. The study was designed in accordance with the Helsinki Declaration of 1975 on human experimentation, and signed informed consent was obtained from all enrollees. The age ranges of patients and controls were 24 –37 years (mean [⫾SD] age, 32.2 ⫾ 5.6) and 22– 41 years (mean age, 35.1 ⫾ 5.8), respectively. 898

Lin et al.

Gene-based screening in spermatogenic failure

All patients underwent a comprehensive examination, including a detailed history, physical examination, at least two consecutive semen analyses, endocrinology profiles (FSH, LH, PRL, and T), and chromosome analysis. Semen analysis was performed according to the standard methods outlined by the World Health Organization (25). Serum levels of FSH, LH, PRL, and T were measured by using commercial radioimmunoassay kits (Coat-A-Count FSH IRMA, Coat-A-Count LH IRMA, Coat-A-Count PRL IRMA, and IMMULITE Total Testosterone; Diagnostic Products Corp., Los Angeles, CA). The intraassay and interassay precision coefficients of variation were 2.4% and 4% for FSH, 1.2% and 2.2% for LH, 1.9% and 2.4% for PRL, and 6.7% and 7.7% for T, respectively. Chromosome analysis was performed by using the G-banding by trypsin– Giemsa technique (26). Patients with karyotypic abnormalities were excluded. Patients in whom nonobstructive azoospermia was strongly suspected were advised to undergo bilateral testicular biopsy. Nonobstructive azoospermia was defined as spermatogenic defects on testicular biopsy (such as hypospermatogenesis, maturation arrest, and the Sertoli cell– only syndrome) or elevated serum FSH level, total testicular volume less than 30 mL, and no other applicable diagnosis.

Gene-Based Screening Genomic DNA was extracted from peripheral blood samples by using a Puregene DNA isolation kit (Gentra, Minneapolis, MN). Polymerase chain reaction was performed by using primers specific to discrete genes that were amplified in multiplex fashion, with each multiplex reaction containing four or five pairs of primers. The primer sequences were derived from GenBank or were described in other reports (2, 15, 18, 23, 27, 28). Table 1 shows primer sequences for each gene. Sites sY277 and sY283 were specific to the DAZ gene. The SRY (sex-determining region Y) gene (interval 1A) was used as an internal control. All primers were amplified by performing four separate multiplex PCR reactions. The primer mixtures used in multiplex PCR were designated mixture 1 (RBM1, SRY, SMCY, and CDY2), mixture 2 (DBY, sY283, DFFRY, and BPY1), mixture 3 (XKRY, EIF1AY, CDY1, and UTY); and mixture 4 (BPY2, sY277, TB4Y, TTY2, and PRY). Each PCR reaction consisted of 0.12 to 0.5 ␮M of each primer (Table 1), 1⫻ PCR buffer, 1.5 mM MgCl2 (for mixtures 1, 3 and 4) or 1.25 mM MgCl2 (for mixture 2), 200 ␮M of each deoxyribonucleoside triphosphate, 150 ng of genomic DNA, and 2 units of Taq DNA polymerase (Perkin-Elmer Cetus Corp., Emeryville, CA) in a total volume of 20 ␮L. Thermocycling (OmniGene Thermal Cycler, Hybaid Ltd., Ashford, United Kingdom) was done for 10 minutes at 95°C for initial denaturation, followed by 30 cycles of denaturation at 94°C for 1 minute, annealing at 62°C for 1 minute, extension at Vol. 77, No. 5, May 2002

TABLE 1 Primer set used for gene-based multiplex polymer chain reaction. Gene (reference)

Size (base pairs)

PRY (15)

80

TTY2 (15)

88

DFFRY (18)

345

DBY (18)

689

UTY (15)

65

TB4Y (15)

102

BPY1 (15)

81

CDY2 (27)

198

XKRY (15)

94

SMCY (28)

362

EIF1AY (15)

84

RBM1 (2)

800

DAZ (sY283) (2)

375

DAZ (sY277) (2)

275

CDY1 (15)

77

BPY2 (23)

142

Primer sequence

Primer concentration (mM)

GAGCACACCACACCAGAAA CCTCAGACTGACCTCGGACTG GACAACTCTGACAGCCAGGG TCAGAACTCCCAAACAGG GTTATTTGAAAAGCTACACGGG TTGAAGTTACTTTTATAATCTAAT ATCGACAAAGTAGTGGTTCC AGATTCAGTTGCCCCACCAG GCATCATAATATGGATCTAGTAG GGGAGATACTGAATAGCATAGC CAAAGACCTGCTGACAATG GCTCCGCTAAGTCTTTCACC CTCCCTGAGCAGCAACTAAG GTCATCAACATGGGAAGCAC ACAGCCCCTTTGACCACAAG TCTGCGACATTAGTGGGTGC CACTCATGGAGAAGGGTAG GGTCACACTCAGCCTGTTTAC CCTCCAGACCTGGACAGAAT TGTGGTCTGTGGAAGGTGTCA CTCTGTAGCCAGCCTCTTC GACTCCTTTCTGGCGGTTAC ATGCACTTCAGAGATACCGC CTCTCTCCACAAAACCAACA CAGTGATACACTCGGACTTGTGT AGTTATTTGAAAAGCTACACGGG GGGTTTTGCCTGCATACGTAATTA CCTAAAAGCAATTCTAAACCTCCAG TGGGCGAAAGCTGACAGCA AGGGTGAAAGTTCCAGTCAA GGGATTATCACATATTGCGG ATGATAGTCGCGTCAGCTGG

0.2 0.2 0.5 0.2 0.5 0.2 0.3 0.2 0.2 0.12 0.2 0.4 0.2 0.4 0.2 0.4

Lin. Gene-based screening for Y chromosome deletions. Fertil Steril 2002.

72°C for 1 minute, and a final extension at 72°C for 10 minutes. The reaction products were fractionated on 2.5% agarose gels (for mixtures 1 and 2) or 12% acrylamide gels (for mixtures 3 and 4). The PCR products were made visible by using ethidium bromide. For each assay, we incorporated three samples as controls: a genomic DNA sample from a normal fertile man, a genomic DNA sample from a normal fertile woman, and a PCR mixture containing no DNA (blank control). Amplification failures for these genes were further confirmed by at least two more amplification failures on by single PCR and amplification failures by the other set of gene-specific primers (sequences not shown). The primers were designed according to the following principle: If the first set of primers was located in the 5⬘ end of the gene, the second set of primers would be located in the 3⬘ end, and vice versa.

STS Screening We also used a series of 24 STS markers mapped to intervals 5 and 6 of Yq11 to analyze deletions in all patients. FERTILITY & STERILITY威

Details of the experimental conditions are provided elsewhere (24). We included 13 markers from interval 5 (sY81, sY82, sY84, sY88, sY182, sY94, sY95, sY97, sY102, sY105, sY109, sY117, and sY127) and 11 markers from interval 6 (sY143, sY164, sY134, sY138, RBM1 gene, sY147, sY149, sY153, sY277, sY283, and SPGY). All markers were amplified by performing five separate multiplex PCR reactions. The sY14 marker was specific to the SRY gene (interval 1A) and was used as an internal control for each assay. The technicians who performed the secondround screening were blinded to the results of the first-round screening.

Determination of De Novo Deletion or Polymorphism Once a microdeletion was identified, the patient was asked to assist in obtaining blood samples from his male relatives so that the origin of his genetic defects could be determined. The DNA samples were analyzed in the same manner described above. 899

TABLE 2 Clinical features of 19 men with Y chromosome deletions. Patient no. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Age (ys)

Sperm count (⫻ 106/mL)

FSH level (mIU/mL)

LH level (mIU/mL)

T level (ng/dL)

PRL level (ng/mL)

Biopsy result

30 29 26 33 34 31 28 31 28 36 34 35 26 27 24 31 27 33 34

Azoospermic Azoospermic Azoospermic Azoospermic Azoospermic Azoospermic 8.2 8.8 Azoospermic Azoospermic 7.9 Azoospermic Azoospermic Azoospermic 5.3 2.0 Azoospermic Azoospermic Azoospermic

24.6 5.6 31.5 28.1 44.6 4.6 NA 14.6 12.2 14.4 9.9 13.7 10.1 16.9 11.0 15.5 NA 26.7 22.3

8.9 1.4 6.7 6.8 8.7 4.5 NA 6.6 2.1 3.7 1.8 3.9 1.8 5.8 5.0 4.6 NA 9.2 7.6

3.6 4.0 5.4 4.4 4.0 4.1 NA 4.1 3.6 3.3 1.6 6.6 3.8 4.2 8.0 6.5 NA 4.1 2.4

26.8 19.4 13.2 4.1 6.1 10.5 NA 12.9 28.0 17.1 9.2 8.8 7.3 11.2 8.3 1.5 NA 10.5 11.2

SCO HS NA HS HS MA NA NA HS MA NA HS MA HS NA NA NA MA NA

Note: HS ⫽ hypospermatogenesis; MA ⫽ maturation arrest; NA ⫽ not available; SCO ⫽ Sertoli cell– only syndrome. Lin. Gene-based screening for Y chromosome deletions. Fertil Steril 2002.

RESULTS Patient Characteristics Of the 202 patients, 21 had 47,XXY karyotype and 1 had with pericentric inversion of chromosome 11: 46,XY, inv (11)(p12q23.3). These patients with gross karyotypic abnormalities were excluded. Of the 180 patients included in the study, 60 had severe oligozoospermia and 120 had nonobstructive azoospermia. Eighty-four of the 120 patients with nonobstructive azoospermia underwent testicular biopsies; 28 had hypospermatogenesis, 24 had maturation arrest, and 32 had the Sertoli cell– only syndrome.

Gene-Specific Screening Of the 180 patients, 19 tested positive for deletion of one or more genes in Yq11. The frequency of deletion was 10.6%. Table 2 shows clinical features of the 19 patients with deletions, and Figure 1 provides a summary of deletion status and corresponding testicular histopathology in each patient. In brief, patients 1, 2, and 3 had single-gene deletions in the AZFa region: Two of them had DBY deletions (with hypospermatogenesis in one patient) and one had DFFRY deletion with the Sertoli cell– only syndrome. One patient (number 4) with a single RBM1 deletion (partial AZFb region) presented with hypospermatogenesis. Two patients (numbers 5 and 6) with deletions of RBM1 (partial AZFb) and DAZ (partial AZFc) also presented with hypospermatogenesis and maturation arrest, respectively. Twelve patients 900

Lin et al.

Gene-based screening in spermatogenic failure

(numbers 7–18) had isolated AZFc deletions with at least one gene deletion in this region. These 12 patients had deletion of the DAZ gene family, and 8 of them (numbers 11–18) also had deletions of other genes, including BPY2 and CDY1. The clinical presentations of these 12 patients included oligozoospermia, hypospermatogenesis, and maturation arrest. One patient (number 19) showed more extensive deletions— SMCY, EIF1AY, RBM1, DAZ, BPY2, and CDY1— but results of testicular histopathologic examination were not available. No control had deletion of Y chromosome genes.

STS Screening The second round of screening, which was based on 24 STS markers, revealed no additional patients with deletions. To the contrary, only 16 of the 19 patients with gene deletions in the first round showed deletions on STS screening. Because the STS markers did not screen for the DFFRY and DBY genes, deletions of the DFFRY gene in patient 1 and the DBY gene in patients 2 and 3 were not detected. The positions and extent of the deletion intervals in the remaining 16 patients were the same on both methods. After collating the results, we found that STS screening showed no increase in the deletion rate but more clearly defined the extent of deletion in 14 patients (numbers 4 – 8 and 11–19).

De Novo Y Chromosome Deletion Blood samples were obtained from male relatives of only 3 of the 19 patients with Y chromosome deletions. The fathers or brothers of these 3 men had intact Y chromoVol. 77, No. 5, May 2002

FIGURE 1 Y chromosome maps in 19 patients presenting with spermatogenic failure. In each map, the presence of a gene or sequence-tagged site (STS) is indicated by a vertical black bar, and the absence of a gene or STS is indicated by the absence of any symbol. A thin vertical line represents positive results on polymerase chain reaction and should be considered a consequence of a specific gene repeating within the Y chromosome. HS ⫽ hypospermatogenesis; MA ⫽ maturation arrest; NA ⫽ not available; SCO ⫽ Sertoli cell– only syndrome.

Lin. Gene-based screening for Y chromosome deletions. Fertil Steril 2002.

somes, demonstrating that these deletions had arisen de novo.

DISCUSSION We developed a novel multiplex PCR protocol that provided reproducible evidence of Y chromosome microdeletions in men with spermatogenic defects. The results were similar to those obtained by an array of markers, most of which FERTILITY & STERILITY威

were anonymous STSs. Because we could not obtain blood samples from male relatives of 16 patients, the origin of the genetic defects for these cases could be not traced. In the 3 patients whose male relatives provided blood samples, the Y chromosome deletion was determined to have arisen de novo. Our infertility practice always includes comprehensive but nondirective genetic counseling for male patients and their wives. We believed that our study patients fully appre901

ciated the disease status. To our disappointment, some couples felt stigmatized by intrinsic genetic defects and could not discuss the subject with family members. Some tried to communicate with their fathers or siblings, but these relatives reacted with anger to the suggestion that they might be the source of an intrinsic genetic defect. It is common in Chinese society for people to feel humiliated, guilty, or angry about carrying a genetic defect (24); consequently, they often are unwilling to share genetic information with others, including family members. We believe that adequate public education and group counseling that is more humane than currently provided will improve societal attitudes.

absence of testicular spermatozoa in sperm retrieval (18, 20, 21, 29, 30). In our study, one patient (number 19) had complete deletion of both AZFc and AZFb, but testicular histopathologic analysis was not available. Thus, these rules should be viewed as tentative; study of more cases is needed before a definite conclusion can be drawn.

Numerous studies using STS markers have demonstrated that microdeletion of Yq11 is associated with spermatogenic failure. In some studies, attempts at genotype–phenotype correlation were made; however, the relationship between Y chromosome genes and spermatogenesis is uncertain (4, 9, 12–14, 18). A general rule has been proposed that deletion of the AZFa region is associated with the Sertoli cell– only syndrome, deletion of the AZFb region is associated with spermatogenic arrest, and deletion of genes within the AZFc region leads to maturation arrest of post-meiotic germ cells (2).

A gene-based screening approach has advantages and shortcomings. Compared with the approach based on anonymous STS markers, gene-based screening is a more rational tool for genotype–phenotype correlation. Genes and gene families located on the Y chromosome and expressed in the testicular tissue may be implicated in the process of spermatogenesis. In patients with Y chromosome deletions, a combined effect of deleted or mutated genes contributes to the phenotype. Among Y chromosome genes expressed in the adult testis, unambiguous evidence of the involvement of discrete genes other than DFFRY, DBY, RBM1, and DAZ in spermatogenesis is still lacking. In addition, there have been no well-documented cases with isolated deletions of TTY2, UTY, TB4Y, BPY1, BPY2, CDY1, CDY2, XKRY, SMCY, EIF1AY, and PRY. More studies using gene-based screening are needed to address the role of discrete genes on human spermatogenesis.

Careful analysis of the published literature and our own cases, however, shows that this rule requires revision. First, deletion of the AZFa region is not always associated with the Sertoli cell– only syndrome. One of our three patients (number 2) with AZFa deletions presented with hypospermatogenesis but not the Sertoli cell– only syndrome. In the literature (20, 22), six patients with single or multiple deletions of AZFa genes (DBY, DFFRY, and UTY) also presented with hypospermatogenesis. Therefore, deletions confined to the AZFa region do not preclude formation of mature sperm.

On the other hand, gene-based screening may miss detection of potential loci containing genes or regulatory elements (e.g., enhancers or promoters) involved in spermatogenesis. In contrast, screening with anonymous STS markers may help identify regions in which potential candidate genes or regulatory elements are located. It has been proposed that a novel AZFd subregion and regions distal to AZFc may contain genes implicated in spermatogenesis (31). Finally, anonymous STSbased and gene-based screenings detect only gross deletions rather than minor mutations of potential AZF candidates.

Second, complete AZFb deletions (intervals 5Q– 6C) are associated with spermatogenic arrest and a low probability of successful sperm retrieval (2, 29). However, partial AZFb deletions, with or without more proximal or distal deletions, are associated with a more heterogeneous phenotype (patients 4 – 6 in our study).

To date, no consensus has been reached on STS primers or gene-specific primers used to screen for Y deletions. In most studies, a varied number of selected STSs were used, most of which are anonymous markers. Presumably, the more markers used, the higher the sensitivity of the screening will be. Using too many markers, however, may lead to detection of clinically irrelevant polymorphic variants (11). Consequently, a causal relationship between single STS deletions and spermatogenic failure is often difficult to establish. In our study, the slightly lower rate of detection of mutations by STS-based screening may be attributable to inadequate marker selection in the AZFa region.

Third, deletions limited to the AZFc region (interval 6D– 6F) are associated with various histopathologic conditions and the presence of testicular or ejaculated spermatozoa (18). In our study, 12 patients (numbers 7–18) had deletions confined to the AZFc region, with deletion of the DAZ gene family alone (numbers 7–10) or of the DAZ gene family in combination with BPY2 and CDY1 (numbers 11–18). Five of these 12 patients presented with oligozoospermia. Of the remaining 6 patients for whom testicular histopathologic analysis was available, 3 had hypospermatogenesis and 3 had maturation arrest. One of the 3 latter patients underwent successful testicular sperm extraction. Fourth, more extensive deletions—those that completely remove AZFa, AZFb, or AZFc in combination with other genes—are associated with more severe phenotypes and 902

Lin et al.

Gene-based screening in spermatogenic failure

A combination of gene-specific and anonymous STS markers provides the most complete information on deletion status in AZF candidates and the extent of deletion. However, 40 or more markers would be used in this combined approach, which is clearly not suitable for large-scale screening for clinical service. We found that at least 1 of 4 genes (DFFRY, DBY, RBM1, and DAZ) was deleted in all 19 patients with deletions. We therefore suggest use of a simple multiplex PCR protocol consisting of these 4 genes and the SRY gene as an internal control as the first-line screening Vol. 77, No. 5, May 2002

strategy for Y chromosome deletion. Once a deletion is detected, complete analysis should include all 15 genes. The European Academy of Andrology also recommends a minimal set of primers for screening for Y chromosome microdeletions. The laboratory guidelines suggest use of six STSs and SRY as a first choice for diagnosis (32) and state that their primer set detected more than 90% of the deletions in the three AZF regions. Our preliminary data suggest that the first-line screening set of DFFRY, DBY, RBM1, DAZ, and SRY would suffice to detect 100% of deletions. However, more studies with larger samples must be conducted to evaluate the accuracy and interlaboratory variance of our method. We believe that a less labor-intensive and more cost-effective method of detecting Y chromosome deletions is both necessary and possible. In conclusion, our multiplex PCR protocol allows rapid screening of 15 Y chromosome genes and is an accurate and cost-effective alternative for detecting Y chromosome gene deletions in infertile men. Our findings are important for clinical decision-making and genetic counseling. So far, only one study has tested a complete array of potential AZF candidates on the Y chromosome (18), and our study is the first large-scale gene-based surveillance study in a nonwhite population. Our data do not show an ethnicity-specific deletion pattern of the Y chromosome in Taiwanese persons. Because Y deletion accounts for approximately 10% of the etiology of spermatogenic failure, we recommend a genebased multiplex PCR screening method as a routine test for men with oligozoospermia or nonobstructive azoospermia.

8. 9. 10. 11.

12. 13. 14.

15. 16. 17. 18.

19. 20.

21.

22. 23. Acknowledgments: The authors thank Dr. Agulnik from the Department of Obstetrics and Gynecology, Baylor College of Medicine, Houston, Texas, for providing primer sequences of the SMCY gene and Bill Franke for proofreading and revising our use of the English language.

24.

References

26.

1. Tiepolo L, Zuffardi O. Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm. Hum Genet 1976;34:119 –24. 2. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, et al. Human Y chromosome azoospermia factors (AZFb) mapped to different subregions in Yq11. Hum Mol Genet 1996;5:933– 43. 3. Van der Ven K, Montag M, Peschka B, Leygraaf J, Schwanitz G, Haidl G, et al. Combined cytogenetic and Y chromosome microdeletion screening in males undergoing intracytoplasmic sperm injection. Mol Hum Reprod 1997;3:699 –704. 4. Foresta C, Ferlin A, Garolla A, Moro E, Pistorello M, Barbaux S, et al. High frequency of well-defined Y-chromosome deletions in idiopathic Sertoli cell-only syndrome. Hum Reprod 1998;13:302–7. 5. Foote S, Vollrath D, Hilton A, Page DC. The human Y chromosome: overlapping DNA clones spanning the euchromatic region. Science 1992;258:60 – 6. 6. Jones MH, Khwaja OS, Briggs H, Lambson B, Davey PM, Chalmers J, et al. A set of ninety-seven overlapping yeast artificial chromosome clones spanning the human Y chromosome euchromatin. Genomics 1994;24:266 –75. 7. Reijo R, Lee TY, Salo P, Alagappan R, Brown LG, Rosenberg M, et al. Diverse spermatogenic defects in humans caused by Y chromosome

FERTILITY & STERILITY威

25.

27. 28.

29. 30.

31.

32.

deletions encompassing a novel RNA-binding protein gene. Nat Genet 1995;10:383–93. Yen PH. A long-range restriction map of deletion interval 6 of the human Y chromosome: a region frequently deleted in azoospermic males. Genomics 1998;54:5–12. Girardi SK, Mielnik A, Schlegel PN. Submicroscopic deletions in the Y chromosome of infertile men. Hum Reprod 1997;12:1635– 41. Pryor JL, Kent-First M, Muallem A, Van Bergen AH, Nolten WE, Meisner L, et al. Microdeletions in the Y chromosome of infertile men. N Engl J Med 1997;336:534 –9. Simoni M, Kamischke A, Nieschlag E. Current status of the molecular diagnosis of Y-chromosomal microdeletions in the work-up of male infertility. Initiative for international quality control. Hum Reprod 1998;13:1764 – 8. Kleiman SE, Yogev L, Gamzu R, Hauser R, Botchan A, Paz G, et al. Three-generation evaluation of Y-chromosome microdeletion. J Androl 1999;20:394 – 8. Kleiman SE, Yogev L, Gamzu R, Hauser R, Botchan A, Lessing JB, et al. Genetic evaluation of infertile men. Hum Reprod 1999;14:33– 8. Krausz C, Bussani-Mastellone C, Granchi S, McElreavey K, Scarselli G, Forti G. Screening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection. Hum Reprod 1999;14:1717–21. Lahn BT, Page DC. Functional coherence of the human Y chromosome. Science. 1997;278:675– 80. Vogt PH, Affara N, Davey P, Hammer M, Jobling MA, Lau YF, et al. Report of the Third International Workshop on Y Chromosome Mapping 1997. Cytogenet Cell Genet 1997;79:1–20. Yen PH. Advances in Y chromosome mapping. Curr Opin Obstet Gynecol 1999;11:275– 81. Silber SJ, Alagappan R, Brown LG, Page DC. Y chromosome deletions in azoospermic and severely oligozoospermic men undergoing intracytoplasmic sperm injection after testicular sperm extraction. Hum Reprod 1998;13:3332–7. Ferlin A, Moro E, Garolla A, Foresta C. Human male infertility and Y chromosome deletions: role of the AZFb-candidate genes DAZ, RBM and DFFRY. Hum Reprod 1999;14:1710 – 6. Sargent CA, Boucher CA, Kirsch S, Brown G, Weiss B, Trundley A, et al. The critical region of overlap defining the AZFa male infertility interval of proximal Yq contains three transcribed sequences. J Med Genet 1999;36:670 –7. Sun C, Skaletsky H, Rozen S, Gromoll J, Nieschlag E, Oates R, et al. Deletion of azoospermia factor a (AZFa) region of human Y chromosome caused by recombination between HERV15 proviruses. Hum Mol Genet 2000;9:2291– 6. Foresta C, Ferlin A, Moro E. Deletion and expression analysis of AZFa genes on the human Y chromosome revealed a major role for DBY in male infertility. Hum Mol Genet 2000;9:1161–9. Saut N, Terriou P, Navarro A, Levy N, Mitchell MJ. The human Y chromosome genes BPY2, CDY1 and DAZ are not essential for sustained fertility. Mol Hum Reprod 2000;6:789 –93. Lin YM, Chen CW, Sun HS, Hsu CC, Chen JM, Lin SJ, et al. Y-chromosome microdeletion and its effect on reproductive decisions in Taiwanese patients presenting with nonobstructive azoospermia. Urology 2000;56:1041– 6. World Health Organization. WHO laboratory manual for the examination of human sperm, and sperm-cervical mucus interaction. 3rd ed. Cambridge (UK): Cambridge University Press, 1992. Brown MG, Lawce HJ. Peripheral blood cytogenetic methods. In: Barch MJ, Knutsen T, Spurbeck J (eds). The AGT cytogenetics laboratory manual. 3rd ed. Philadelphia: Lippincott–Raven, 1997:77–171. Lahn BT, Page DC. Retroposition of autosomal mRNA yielded testisspecific gene family on human Y chromosome. Nat Genet 1999;21: 429 –33. Agulnik AI, Mitchell MJ, Lerner JL, Woods DR, Bishop CE. A mouse Y chromosome gene encoded by a region essential for spermatogenesis and expression of male-specific minor histocompatibility antigens. Hum Mol Genet 1994;3:873– 8. Krausz C, Quintana-Murci L, McElreavey K. Prognostic value of Y deletion analysis: what is the clinical prognostic value of Y chromosome microdeletion analysis? Hum Reprod 2000;15:1431– 4. Kamp C, Hirschmann P, Voss H, Huellen K, Vogt PH. Two long homologous retroviral sequence blocks in proximal Yq11 cause AZFa microdeletions as a result of intrachromosomal recombination events. Hum Mol Genet 2000;9:2563–72. Kent-First M, Muallem A, Shultz J, Pryor J, Roberts K, Nolten W, et al. Defining regions of the Y-chromosome responsible for male infertility and identification of a fourth AZFb region (AZFd) by Y-chromosome microdeletion detection. Mol Reprod Dev 1999;53:27– 41. Simoni M, Bakker E, Eurlings MC, Matthijs G, Moro E, Muller CR, et al. Laboratory guidelines for molecular diagnosis of Y-chromosomal microdeletions. Int J Androl 1999;22:292–9.

903