Gene-centromere linkage mapping by PCR analysis of individual oocytes

GENOMICS

13, 713-717

(19%)

Gene-Centromere

Linkage Mapping by PCR Analysis of Individual Oocytes

XIANGFENG GUI,* JOE GERwIN,t WILLIAM NAVIDI, $ HONGHUA MICHAEL KUEHN,t,* AND NORMAN ARNHEIM” *Molecular

Biology Section, and *Mathematics Department, University of Southern California, Los Angeles, California 90089-7340; and tDepartment of Genetics, University of Illinois College of Medicine, Chicago, Illinois 60672. Received

November

18, 1991;revised

We describe a general method of determining the recombination fraction between a polymorphic locus and the centromere in any species where single oocytes can be obtained. After removal of the first polar body, each oocyte is analyzed by PCR. The frequency of oocytes heterozygous at the polymorphic locus is used to estimate the recombination fraction. We estimate a recombination fraction of 0.15 between the mouse major histocompatibility complex (H-2) and the centromere of chromosome 17. 0 1992 Academic Press, Inc.

INTRODUCTION

A complete genetic map of a species must account for the entire length of DNA in each chromosome arm. It is necessary therefore to “anchor” the map at the centromere and telomere. In fungal speciessuch as Neurospora, where it is possible to study all of the products of a single meiosis in an ordered ascus, the recombination fraction between gene and centromere (gene centromere distance or GCD) is easily calculated (Sturtevant and Beadle, 1962) by determining whether the two alleles at the locus segregated after the first (no recombination) or after the second meiotic division (as a consequence of crossing over between the gene and the centromere). It is only possible to measure GCD in rare instances in other organisms, for example, in the case of attached X chromosomes in Drosophila (Sturtevant and Beadle, 1962). In humans (reviewed in Chakravarti et al., 1989) and mice (Eppig and Either, 1983,1988; Either, 1978), ovarian tumors (teratomas) derived from meiotic cells can be used for measuring GCD in certain circumstances. The analysis of DNA polymorphisms in rare individuals trisomic for a particular chromosome can also allow GCD to be estimated (reviewed in Sherman et al., 1991). Recently, ’ Present 91125. ‘Present 20892.

LI,*-’

address:

Biology

address:

Building

Division,

Cal. Inst.

10, Room

4B17,

Tech., NIH,

Pasadena, Bethesda,

CA MD

713

March

13, 1992

DNA polymorphisms within centromeric heterochromatin have been found for some human and mouse chromosomes, which in a number of caseswill allow GCD to be determined by RFLP linkage analysis in pedigrees (Willard et al., 1986; Jabs et al., 1989; Choo et al., 1990; Matsuda and Chapman, 1991). We have developed a general method, applicable to a wide variety of eucaryotic species, that will serve to anchor the genetic map at the centromere. Using the polymerase chain reaction (PCR; Saiki et al., 1985, 1988; Mullis and Faloona, 1987) DNA sequence polymorphisms in individually isolated primary oocytes are analyzed, and the recombination fraction between a DNA polymorphism and the centromere is determined. Figure 1 shows how the two alleles of a heterozygous female individual are distributed between the oocyte and the first polar body during the first meiotic division depending upon whether or not a recombination event has taken place between the gene and the centromere. If the oocyte is typed as homozygous, then there could not have been recombination between the gene and the centromere (assuming that the gene in question is close enough to the centromere to preclude the chance of more than a single recombination event; see Materials and Methods). If recombination did take place, then the oocyte would be heterozygous. Since each heterozygous oocyte contains one recombinant and one nonrecombinant chromosome, the frequency of recombinant chromosomes (the recombination fraction) is calculated by halving the fraction of heterozygous oocytes (Ott et al., 1976). MATERIALS

AND

METHODS

Preparation of oocytes. Oocytes collected from the oviducts of superovulated B6C3 F, mice (C57BL/6 X C3H/He) mice were freed of cumulus cells by hyaluronidase treatment followed by three washes in M2 medium (Hogan et al., 1986). Two methods were used to isolate oocytes. In some cases an individual oocyte was placed in a well of a Terazaki plate containing pronase (0.5% in M2). When the zona pelucida was almost completely dissolved, the oocyte was transferred to a well containing PBS with 4 mg/ml BSA. Gentle pipetting of medium over the oocyte was then used to disrupt the integrity of the zona and to separate the polar body away. The oocyte was then transferred to a 0888-7543/92

$5.00

Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

714

CUI No Recombination

pozl+ 0==F

0z

a a

FIG. 1. Consequences of recombination between gene and centromere during the first meiotic division. (I) Two heterozygous primary oocytes (PO) at the beginning of first meiotic division. (II) During the first meiotic division, genetic recombination occurred in one of the two cells. (III) The resulting first meiotic products. In the absence of recombination between the gene and the centromere, the secondary oocyte (SO) and the first polar body (FP) will be homozygous for alternative alleles. With a crossover between the gene and the centromere, both meiotic products will be heterozygous.

0.5-ml tube containing a drop of fresh PBS with BSA at the bottom and stored at -70°C. In other experiments, batches of oocytes placed in a single organ well dish were stripped of their polar bodies by prolonged incubation in pronase solution. Individual oocytes, detached from their respective polar bodies, were then removed, washed in fresh M2, followed by a wash in PBS with BSA, and transferred to separate 0.5 ml tubes. In all cases the final samples were contained in a volume of a few microliters. All samples were lysed with KOH and DTT and then neutralized (Cui et al., 1989; Li et al., 1991). PCR conditions. The positions of the PCR primers, the sizes of the PCR products, and the location of the polymorphic sites (solid circles) at the Eb and Aa loci are shown in Fig. 2. At the Aa locus, a polymorphic site exists at position 397 (Landais et al., 1985; Benoist et al.. 1983); the Aab allele has a GC; and t.he Aa’allele has an AT basepair. A polymorphism at the Eb locus is located at position 2324 (Kobori et al., 1986). The Ebk allele has a GC and the Ebb allele has a TA basepair. We analyze the alleles at each locus by a form of allele-specific amplification known as allele discrimination by primer length or ADPL (Li et al., 1990). For example, allelic typing at the Eb locus involves two rounds of PCR. The first is carried out with primers Ebl and Eb2, which produces a 261-bp product. To distinguish between the two alleles, a second round of PCR is carried out on an aliquot from the

ET

AL. first round. This second round of allele-specific amplification converts the nucleotide sequence polymorphism into a length polymorphism by using primer Eb2 and two allele-specific primers that differ in length from one another. One, Eb3, is specific for the Eb’ allele and is 10 hp shorter than the Ebb allele-specific primer Eb4. The sizes of the second-round PCR products are 110 bp for the Ebb allele and 100 bp for the Ebk allele, and this size difference can be resolved on a polyacrylamide gel. The same strateW can be used to type the Aa locus, and both loci can be simultaneously typed in a single cell. The sequences of the primers used for oocyte typing were: Aal, GCTCCTCAAGCGACTGTGTTC; Aa2, CACGGTTGACGAAGAAGCTGG; Aa3, GTCTCATAAACACCGTCTGC; Aa4, tttagcagaaGTTTCATAAACGCCGTCTGT; Ebl, CAGAACCTGAGTCCTGGGCG; Eb2, AGCAGACCAGGAGGTTGTGG; Eb3, TCATGGCTCCTTCTCACCTC; Eb4, atgaatcactTCATGGCTCCTTCTCACCTA. The lowercase letters in primers Aa and Eb4 refer to bases added at the 5’end to lengthen one of the allele-specific primers. Each lysed oocyte sample was brought up to a volume of 50 ~1 with PCR reagents. For the first round, 40 PCR cycles were carried out with 95”C, 30 s for denaturation, 65°C for annealing with 3 min for the first 10 cycles and 2 min for the remaining 30 cycles, and 72°C. 1 min for extension. The first-round reaction mixture contained (final concentration) 100 mM TrissHCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl,, 100 pg/ml gelatin, 100 FMeach dNTP and 1 unit of Taq DNA polymerase (Perkin-Elmer/Cetus). Primers Aal, Aa2, Ebl, and Eb2 were at 0.1 @f. Two 15~1 aliquots from each first-round PCR product were reamplified separately for each of the two loci using ADPL. Each second-round amplification reaction was carried out in a volume of 50 ~1. The reaction mix contained 67 mM Tris-HCl (pH 8.8). 16.6 mM (NH,),SO,, 6.7 mMMgCl,, 5 mMDTT (modified from Newton et al., 1989), and 5 j&f each dNTP (3 PM of it resulted from carryover hy the 1.5~1 aliquotl, and 1 unit of Taq DNA polymerase. Samples were amplified for 25 cycles with 95”C, 15 s for denaturation and 58°C. SO s for annealing and extension. Second-round amplification of Aa used primers Aal (2.0 GM), Aa (2.0 CM), and Aa (0.04 FM). Secondround amplification of the Eh locus used 2.0 pM of primers Eh2 and Eb3 and 0.1 j&f of Eb4. Five-microliter aliqu6ts from the two separate ADPL products for each cell were mixed with 5 ~1 of loading buffer, ioaded on an BY polyacrylamide gel (8 ?( 7 X 0.15 CM), subjected to electrophoresis at 120 V for 1 h, and viewed under UV illumination after staining with ethidium bromide. Maximum likelihood estimation of the gene-centromere genetic distance. If PCR were fully efficient with no contamination by exogenous DNA and a single cell were deposited in every tube, then in each tube we would observe only one of four possible genotypes: AabEbb, AakEbk, AabEbk, AakEbb. In practice, the three above errors can result in four possible outcomes for each locus (e.g., Aa’, Aab, AakAab, or neither allele) or 2“ = 16 possible typing outcomes when studying two loci simultaneously (see Table 1). To account for the effect of these errors, we postulate a lo-parameter model. In addition to the recombination fraction 8, there is one parameter for the probability that a cell

tlouos )

fbl-

I w -

FIG. 2. The positions and Aa loci.

+=

bp+

t---l& +libP

bp+ bpw

of the PCR primers,

-

I%?

Id ,I

Ebl A

Chromosome

17

Eb4 L Eb3 -I -

Aa Aa +iae -2.61

the sizes of the PCR products,

+lle bp-1

and the location

Eb2

bP+ bP+

of the polymorphic

sites (solid

circles)

at the Eb

GENE-CENTROMERE

TABLE Typing Observed

Results

LINKAGE

1 for 88 Oocytes

type

Number

Aab- Ebb-A:-Ebk AabAakEbbEbk

23 31 18 1 0 0 0 3 3 0 5 2 1 1 0 0

---Ebk --Ebb_ -EbbEbk

Aab---Ask-AabAak_AabAak-Ebk AabAakEbbAah-EbbEbk _ AakEbbEbk Aab--Ebk _ AakEbb_ Note. The first three categories are the no errors. The remaining categories result the efficiency of PCR amplification were for contamination were 0, 0, 1.5, and 3.8% respectively. Only 1% of the tubes appear sample.

expected types if there are from errors. The MLEs for 97.3, 100, 73, and 80% and for Aab, Ask, Ebb, and Ebk, not to have received a cell

is actually deposited in a tube, 4 parameters for the efficiency of amplification of each allele at each locus, and 4 parameters for the probability that each allele is involved in a contamination event. We assume that the results in the various tubes are statistically independent and that contamination events occur independently of each other and do not interfere with detection of alleles in the oocyte. Under these conditions, the observed frequencies of the 16 typing events follow a multinomial distribution. The probabilities of the 16 outcomes are computed in terms of the 10 parameters using the basic laws of conditional probability. Substituting these probabilities into the multinomial density yields the likelihood function, which is maximized numerically. In oocyte analysis, the recombination fraction is equal to one-half the proportion of heterozygous oocytes. In classical linkage studies, the recombination fraction is defined as the proportion of chromatids that is of the recombinant haplotype as would be estimated from a linkage study using a centromere-linked RFLP. If only a single crossover is likely between gene and centromere, then these two estimates of the recombination fraction should be the same. However, when multiple crossovers are possible, and assuming no crossover interference, the latter value will be somewhat greater. The recombination fraction based on oocyte analysis can never be greater than 0.33, unlike classical linkage studies where it can approach 0.5. The relationship between recombination fractions measured by oocyte analysis (0,) and linkage studies (8,) is described by the equation (Chakravarti and Slaugenhaupt, 1987; Morton, 1982): &, = [l - (1 - 28$“]/3.

MAPPING

BY

PCR

ANALYSIS

715

This incidence of 0.247 reflects a recombination fraction of 0.1235. In the absence of PCR typing errors, the 95% confidence interval for this estimate (which depends upon the sample size) ranges from 0.0728 to 0.1742. In actual practice, the accuracy of the GCD estimate using PCR depends on the efficiency of amplification of each allele present in the oocyte, the probability of PCR product contamination, and the likelihood that the oocyte was in fact deposited in the PCR reaction tube. Because PCR was carried out on only one locus, it is not possible to estimate the independent contribution of each error to the GCD estimate independently of the error due to random sampling. However, an experimental strategy that will allow a maximum likelihood estimate of these errors, as well as the recombination fraction to be made, exists. This strategy has been usedpreviously in analyzing single sperm typing data (Cui et al., 1989; Arnheim et al., 1990; Goradia et al., 1991) and is based upon simultaneous study of two polymorphic loci in each cell. In the next experiment we amplified both the Eb and the A-alpha (Aa) genes. These two loci are approximately 30 kb apart, with Aa being centromeric (Steinmetz et al., 1982). The recombination fraction between them is not greater than 0.001 in inbred mouse strains (Steinmetz et al., 1986), and therefore it can be assumed that recombination between them would have little effect on our estimate of GCD. Eighty-eight individual oocytes were typed at both loci. The data are summarized in Table 1, and representative data are shown in Fig. 3. The maximum likelihood estimate of the recombination fraction between H-2 and the centromere was 0.148. The approximate 95% confidence interval is 0.108-0.228 (the asymmetry reflects the nonnormality of the estimator, which is due to a small sample size). These results are consistent with our initial GCD estimate based on the analysis of 162 oocytes at only the Eb locus. Estimates of each of the possible PCR errors are also shown in the note to Table 1. It is interesting to note that by ignoring all of the categories in Table 1 that obviously arise from PCR errors, the recombination

111

RESULTS

We first measured the GCD for the H-2 region on mouse chromosome 17 using a DNA polymorphism in the E-beta gene (Eb). A total of 162 oocytes from Fl females (C57B/6J X C3H) were examined individually for the presence of the two Eb alleles (Ebb and Ebk). Forty were found to be heterozygous (data not shown).

FIG. 3. Genotype determination at two loci (Aa and Eb) in single oocytes and polar bodies. Lanes l-3, PCR products from single oocyte samples. Lanes 4-9, from three oocytes and their accompanying polar bodies (lanes 4 and 5,6 and 7, and 8 and 9; oocyte and polar body respectively). PCR analysis of polar bodies was carried out exactly as for the oocytes. Lane 10 pBR322 DNA digested with MspI as size markers.

716

CUI

fraction obtained (i X g = 0.125) is very close to our maximum likelihood estimate. A potential source of error not accounted for by our statistical model is the contamination of an oocyte by its own polar body. Such an error would lead to what appeared to be a heterozygous oocyte and would directly effect the estimate of 8. This kind of error is unlikely to be significant since both the polar body and the oocyte can be visualized during sample preparation. In addition, an estimate of the recombination fraction between H-2 and the centromere using 44 isolated polar bodies gave a recombination fraction of 0.18 (data not shown), which is similar to the estimate obtained using oocytes (0.15). Its large size makes it impossible for an oocyte to contaminate a polar body sample without the experimenter being aware of it. Therefore, the closeness of the two independent estimates of 8 suggests that polar body contamination of oocytes was not significant in our experiments. DISCUSSION In situ hybridization data place the H-2 locus approximately midway between the centromere and telomere of chromosome 17 (Lader et al., 1985; Lyon et al., 1988; Mancoll et al., 1991). Given that chromosome 17 may represent 40 CM of the mouse genetic map (Committee for Chromosome 17; 1991), the GCD for H-2 should be 0.20, assuming a uniform distribution of recombination potential. Chromosome 17 has been the subject of extensive genetic mapping, and the H-2 locus has been located between 11 and 16 CM (see Nadeau et al., 1991; Vincek et al., 1989) telomeric to the most centromeric genetic markers used in these studies. The GCD for H-2 can only be inferred in these cases since the GCD for the most centromeric of the markers is not known. By considering the data from both of our experiments (a total of 250 individual oocytes), we estimate the recombination fraction between H-2 and the centromere to be between 0.12 and 0.15 (0.13 and 0.16, respectively, if multiple crossovers are taken into consideration; see Eq. [ 11). Our results are consistent with other estimates of the H-2 GCD (0.10-0.18; Klein, 1971; Hammerberg and Klein, 1975; Lyon et al., 1979), which used Robertsonian translocations as cytogenetic centromeric markers in classical linkage studies. In general, however, the reliability of GCD estimates using translocations as centromeric markers has been called into question due to the fact that translocations can alter the recombination fraction of linked genes (Cattanach, 1978; Lyon et al., 1979; Forejt et al., 1980; Davisson et al., 1989; Doolittle et al., 1990). Our single-oocyte data from C3H/C57BL F, females is unlikely to be biased due to the presence of chromosomal rearrangements, but the presence of mouse strain-specific recombination hot spots (Steinmetz et al., 1986; L. Silver, personal communication) cannot be absolutely ruled out. Finally, single-oocyte analysis in the mouse may provide an estimate of the GCD that cannot be obtained using other available

ET

AL.

methods. For example, the possible use of interspecific crosses (ikfus spretus X Mus domesticus) to measure GCD using DNA probes that distinguish the centromeres of the two species (Matsuda and Chapman, 1991) would not provide accurate estimates for chromosome 17 since different inversions characterize the proximal region of this chromosome in the two species (Hammer et al., 1989). Given the overall consistency between our data and those of conventional genetic mapping, single-oocyte analysis by PCR appears to be a practical and rapid way to determine the recombination fraction between a DNA polymorphism and a centromere. A new method that will allow at least 24 distinct loci to be examined simultaneously in a single cell has just been developed (Zhang et al., 1992), and thus little effort would be required to map the GCD for the chromosomes of the mouse or other eucaryotic species. Microsatellite repeat polymorphisms can be analyzed in single cells (Hubert, Weber, and Arnheim, submitted) and because of their wide species distribution would be especially useful for GCD analysis. ACKNOWLEDGMENTS This work was supported HG00328 (N.A.), HD25109 the March of Dimes (M.K.),

in part by NIH Grants (M.K.); Basil O’Connor and NSF Grant DMS

GM36745 (N.A.), Award 5-737 from 90-05833 (W.N.).

REFERENCES Arnheim, N., Li, H., and Cui, X. (1990). PCR analysis of DNA sequences in single cells: Single sperm mapping and genetic disease diagnosis. Genomics 8: 415419. Benoist, C. O., Mathis, D. J., Kanter, M. R., Williams, V. E., II, and McDevitt, H. 0. (1983). Regions of allelic hypervariability in the murine Aa immune response gene. Cell 34: 169-177. Cattanach, B. (1978). Crossover suppression in mice heterozygous for tobacco mouse metacentrics. Cytogenet. Cell Genet. 20: 264-281. Chakravarti, A., Majumder, P. P., Slaugenhaupt, S. A., Deka, R., Warren, A. C., Surti, U., and Ferrell, R. E., et al. (1989). Gene centromere mapping and the study of non-disjunction in autosomal trisomies and ovarian teratomas. In “Molecular and Cytogenetic Studies of Non-disjunction” (T. J. Hassold and C. J. Epstein, Eds.), pp. 45-79, A. R. Liss, New York. Chakravarti, A., and Slaugenhaupt, S. A. (1987). Methods for studying recombination on chromosomes that undergo nondisjunction. Genomics 1:35-42. Choo, K. H., Vissel, B., Nagy, A., Earle, E., and Kalitsis (1990). A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nucleic Acids Res. 19: 117991182. Committee for Chromosome 17 (1991). Maps of chromosome 17: First report. Mammalian Genome 1: 5-29. Cui, X., Li, H., Goradia, T. M., Lange, K., Kazazian, H. H.. Galas, D. J., and Arnheim, N. (1989). Single sperm typing: Determination of genetic distance between the G-gamma globin and parathyroid hormone loci. Proc. Nutl. Acad. Sci. USA 86: 9389-9393. Davisson, M., Roderick, T. H., andDoolittle, D. P. (1989). Recombination percentages and chromosomal assignments. In “Genetic Variants and Strains of the Laboratory Mouse” (M. F. Lyon and A. G. Searle, Eds.), pp. 432-505, Oxford Univ. Press, Oxford. Doolittle, D. P., Davisson, M. T., Roderick, T. H., and Hillyard, A. L. (1990). The locus map of the mouse. Mouse Genome 8’7: 14-27.

GENE-CENTROMERE

Either, E. M. (1978). Murine cytogenetic tools. Cytogenet.

LINKAGE

ovarian teratomas and parthenotes Cell Genet. 20: 232-239.

Eppig, J. T., and Either, E. M. (1983). Application teratoma mapping method in the mouse. Genetics

MAPPING

as

of the ovarian

103: 797-812.

Eppig, J. T., and Either, E. M. (1988). Analysis of recombination the centromere region of mouse chromosome 7 using ovarian toma and backcross methods. J. Hered. 79: 425-429.

in tera-

Forejt, J., Capkova, J., and Gregorova, S. (1980). T(16:17)43H translocation as a tool in the analysis of the proximal part of chromosome 17 (including T-t gene complex) of the mouse. Genet. Res. Camb. 35: 165-177. Goradia, T. M., Stanton, V. P., Cui, X., Aburatani, H., Li, H., Lange, K., Housman, D. E., and Arnheim, N. (1991). Ordering three DNA polymorphisms on human chromosome 3 by sperm typing. Genonzies 10:748-755. Hammer, M. F., Schimenti, J., and Silver, L. M. (1989). Evolution of mouse chromosome 17 and the origin of inversions associated with t haplotypes. hoc. Natl. Acad. Sci. USA 86: 3261-3265. Hammerberg, markers 203-211.

C., and Klein, J. (1975). Linkage on chromosome 17 of the house mouse.

relationships of Genet. Res. 26:

Hogan, B., Constantini, F., and Lacy, E. (1986). “Manipulating Mouse Embryo,” Cold Spring Harbor Laboratory Press, Spring Harbor, NY.

the Cold

Jabs, E. W., Gobel, C. A., and Cutting, G. R. (1989). Macromolecular organization of human centromeric regions reveals high-frequency, polymorphic macro DNA repeats. Proc. Natl. Acad. Sci. USA 86: 202-206. Klein, J. (1971). Cytological identification of the chromosome ing the IXth linkage group (including H-2) in the house Proc. Natl. Acad. Sci. USA 68: 1594-1597.

carrymouse.

Kobori, J. A., Strauss, E., Minard, K., and Hood, L. (1986). Molecular analysis of the hotspot of recombination in the murine major histocompatibility complex. Science 234: 173-179. Lader, E., Clark, B. T., Jhanwar, S. C., Chaganti, R. S. K., and Bennett, D. (1985). Definitive chromosomal location of the H-2 complex by in situ hybridization to pachytene chromosomes. Zmmunogenetics 22: 49-54. Landais, D., Mat,thes, H., Benoist, ular basis for the Ia. and la.19 Acad. Sci. USA 82: 2930-2934.

C., and Mathis, D. (1985). A molecantigenic determinants. Proc. Natl.

Li, H., Cui, X., and Arnheim, N. (1990). Direct electrophoretic tion of the allelic state of single DNA molecules in human using PCR. Proc. Natl. Acad. Sci. USA 87: 4580-4584.

detecsperm

Li, H., Cui, X., and Arnheim, N. (1991). Analysis of DNA sequence variation in single cells. Methods: Companion Methods Enzymol. 2: 49-59. Lyon, M. F., Evans, E. P., Jar+, types of the mouse may involve ture 279: 38-42.

S. E., and Sayers, I. (1979). t-haploa change in intercalary DNA. Na-

Lyon, M. F., Zenthon, J., Evans, E. P., Burtenshaw, M. D., and Willison, K. R. (1988). Extent of the mouse t complex on chromosome 17 by in situ hybridization with Tcp-1. Immunogenetics 27: 375-382.

BY

PCR

717

ANALYSIS

Mancoll, R. E., Snyder, L. C., and Silver, the t complex on mouse chromosome Mammalian Genome, in press. Matsuda, Y., and Chapman, V. M. merit satellite DNA segregating lian Genome 1: 71-V.

L. M. (1991). Delineation 17 by in situ hybridization.

of

(1991). In situ analysis of centroin Mus species crosses. Mamma-

Morton, N. E. (1982). “Outline of Genetic Epidemiology,” Karger, New York. Mullis, K. B., and Faloona, F. A. (1987). Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. In “Methods in Enzymology” (R. Wu. Ed.), Vol. 155, pp. 335-351, Academic Press, San Diego. Nadeau, J. H., and 15 other authors (1991). Genetic maps of mouse chromosome 17 including 12 new anonymous DNA loci and 25 anchor loci. Genomics 9: 78-89. Newton, C. R., Graham, A., Heptinstall, L. E., Powell, S. J., Summers, C., Kalssheker, N., Smith, J. C., and Markham, A. F. (1989). Analysis of any point mutation in DNA. The amplification refractory mutation system. Nucleic Acids Res. 17: 2503-2516. Ott, J., Hecht, F., Linder, D., Loviren, E. W., and McCaw, B. K. (1976). Human centromere mapping using teratoma data. Birth Defects: Orig. Artic. Ser. 12(7): 396-398. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer directed amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491. Saiki, R., Scharf, S., Faloona, F., Mullis, K., Horn, G., Erlich, H., and Arnheim, N. (1985). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350-1354. Sherman, S. L., and 14 other authors (1991). Trisomy between reduced recombination and non-disjunction. Genet. 49: 608-620.

21: Association Am. J. Hum.

Steinmetz, M., Minard, K., Horvath, S., McNicholas, J., Frelinger, J., Wake, C., Long, E., Mach, B., and Hood, L. (1982). A molecular map of the immune response region from the major histocompatibility complex of the mouse. Nature 300: 35-42. Steinmetz, M., Stephan, D., and Fischer-Lindahl, K. (1986). Gene organization and recombinational hotspots in the murine major histocompatibility complex. Cell 44: 8955904. Sturtevant, A. H., and Beadle, G. W. (1962). “An Introduction to Genetics,” Dover, New York. Vincek, V., Kawaguchi, H., Mizuno, K., Zaleska-Rutczynska, Z., KaSahara, M., Forejt, J., Figueroa, F., and Klein, J. (1989). Linkage map of mouse chromosome 17: Localization of 27 new DNA markers. Genomics 5: 773-786. Willard, H. E., Waye, J., Skolnick, M. H., Schwartz, C. E., Powers, V. E., and England, S. B. (1986). Detection of restriction fragment length polymorphisms at the centromerea of human chromosomes by using chromosome specific alpha satellite DNA probes: Implications for development of centromere-based genetic linkage maps. Proc. Natl. Acad. Sci. USA 83: 5611-5615. Zhang, L., Cui, X., Schmitt, K., Hubert, R., Navidi, W., and Arnheim, N. (1992). Whole genome amplification from a single cell: Implications for genetic analysis. Proc. Natl. Acad. Sci. USA, in press.