Generation and analysis of expressed sequence tags from a NaHCO3-treated Limonium bicolor cDNA library

Available online at www.sciencedirect.com

Plant Physiology and Biochemistry 46 (2008) 977e986 www.elsevier.com/locate/plaphy

Research article

Generation and analysis of expressed sequence tags from a NaHCO3-treated Limonium bicolor cDNA library Yucheng Wang a,b, Hui Ma b, Guifeng Liu a,b, Dawei Zhang b, Qiaoying Ban b, Guodong Zhang b, Chenxi Xu a, Chuanping Yang a,b,* b

a School of Forestry, Northeast Forestry University, 26 Hexing Road, Harbin 150040, PR China Key Laboratory of Forest Tree Genetic improvement and Biotechnology (Northeast Forestry University), Ministry of Education, 26 Hexing Road, Harbin 150040, PR China

Received 25 October 2007; accepted 3 June 2008 Available online 11 June 2008

Abstract Limonium bicolor, a halophytic species of Plumbaginaceae, can thrive in saline or saline-alkali (sodic) soil, demonstrating that it has developed an efficient saline-alkali resistance system, and is an ideal material for the study of saline-alkali tolerance. In order to identify and characterize the complexity of this adaptation, expressed sequence tags (ESTs) analysis and real-time reverse transcriptaseepolymerase chain reaction (RTePCR) were conducted. We constructed a cDNA library of L. bicolor exposed to 0.4 M NaHCO3 for 48 h, and obtained 2358 ESTs, representing 1735 unique genes. A BLASTX search revealed that 1393 ESTs, representing 873 unique genes, showed significant similarity (E-values <104) to protein sequences in the non-redundant database. These ESTs were further grouped into 12 functional categories according to their functional annotation. The most abundant categories were metabolism (18.74%), photosynthesis (14.86%), unknown classification (12.20%), defense (12.20%), and transport facilitation (10.19%). In total, 286 putative abiotic stress related transcripts, representing 121 unique genes, were identified. Among them, the two most abundant genes encoded metallothionein (EH794553) and lipid transfer protein (EH794695), each of which accounted for 1.4% of the total ESTs. The expression of 18 putative stress-related genes were further analyzed in roots and leaves of L. bicolor using real-time RTePCR, and 14 genes were differentially expressed by more than 2-fold as a result of the NaHCO3 stress. The results of this study may contribute to our understanding of the molecular mechanism of saline-alkali tolerance in L. bicolor. Ó 2008 Elsevier Masson SAS. All rights reserved. Keywords: cDNA library; Expressed sequence tags; Limonium bicolor; NaHCO3 stress

1. Introduction

Abbreviations: CAB, chlorophyll a/b-binding protein; CAM, calmodulin; CAP, cold acclimation proteins; CTAB, cetyltrimethylammonium bromide; EST, expressed sequence tags; LTPs, lipid transfer proteins; MT, metallothionein; MTLP, metallothionein-like protein; nr, non-redundant; PRP, pathogenesis-related protein; RTePCR, reverse transcriptaseepolymerase chain reaction; ROS, reactive oxygen species; RuBisCO, ribulose-1,5-bisphosphate carboxylase/oxygenase. * Corresponding author. School of Forestry, Northeast Forestry University, 26 Hexing Road, Harbin 150040, PR China. Tel.: þ86 451 8219 0607; fax: þ86 451 8219 1627. E-mail address: [email protected] (C. Yang). 0981-9428/$ - see front matter Ó 2008 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.plaphy.2008.06.001

Saline-alkali (sodic) soils have a high percentage of exchangeable sodium (>15%), high pH (above 8.5) and strong alkaline reactions. There are 831 million hectares of area affected by salt stress in the world. Of this, areas of saline-alkali soils comprise 434 million hectares [15]. Few plant species can endure the concomitant saline and alkali stresses in sodic soils. As a result, agricultural yields and productivity are severely reduced, agricultural and animal husbandry developments are limited in regions where sodic soils are predominant. Therefore, there is interest in breeding transgenic plants that are tolerant to sodic soils. The study of saline-alkali tolerance mechanisms in plants may reveal candidate target genes and

978

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

valuable information for improving stress tolerance in plants by genetic engineering. The Plumbaginaceae, a highly stress tolerant family, contains plants tolerant to a wide range of harsh environments [3], among which the Limonium species are highly salt-tolerant halophytes to saline environments. Some investigations had been performed on in vitro growth of Limonium plantlets [18] and abiotic stress tolerance of Limonium species. Gagneul et al. [8] analyzed the accumulation of compatible solutes in Limonium latifolium during NaCl treatments. b-Alanine betaine, as an osmoprotective compound, was investigated in different Limonium species [9,25], and a gene involved in synthesis of b-alanine betaine was cloned from L. latifolium [23]. Chen et al. [4] constructed a cDNA library from Limonium sinense under normal growth conditions, and obtained 1082 ESTs. However, there is lack of expressed sequence tag (ESTs) data for Limonium plants during saline stress. Analysis of ESTs from Limonium plants under saline stress is very important for elucidating the molecular mechanism of salt tolerance in Limonium plants, and will provide useful information for the breeding and genetic engineering of salt tolerant crops. Limonium bicolor, a species of the genus Limonium, is distributed in coastal saline soil areas and grasslands. The ability of L. bicolor to thrive in the sodic soil of the Song-nen plain in northeast China indicates that this species must have developed molecular and physiological systems to adapt to this stress condition, and that it is a desirable plant for investigation of saline-alkali tolerance in plants. EST analysis provides a rapid and efficient method to identify genes involved in specific biological functions, especially in organisms in which genomic data are not available. The EST analysis has been used successfully to discover stress resistance genes and to determine the expression patterns of abiotic stress in different plants, such as Selaginella lepidophylla [12], Triticum aestivum [10], Avicennia marina [21], Mesembryanthemum crystallinum [16] and Thellungiella halophila [31]. It is important to use a model that imitates the environment conditions of plants growing in sodic soil when investigating saline-alkali tolerance. To grow in sodic soils, plants must overcome both sodium toxicity and high pH stress. Thus the high sodium stress and alkali stress associated with NaHCO3 treatment, make it a good model for natural sodic soils. The fact that sodic soils are formed by the accumulation of carbonate salts further validate the use of NaHCO3 treatment as a model for the study of saline-alkali stress in plants. To have a view of transcript expression in L. bicolor during saline-alkali (NaHCO3) induced stress, we constructed a cDNA library from L. bicolor exposed to NaHCO3 for 48 h, and generated 2358 high-quality ESTs. The ESTs were further analyzed to identify putative abiotic stress-related genes using real-time RTePCR.

in a greenhouse under controlled conditions of 65e75% relative humidity, 14 h light and an average temperature of 24  C. The 2-month-old seedlings (well watered) were exposed to 0.4 M NaHCO3 for 48 h. Well watered L. bicolor seedlings were used as an untreated control. After treatment, young leaves and roots of the seedlings were harvested respectively for RNA isolation. For construction of the cDNA library, total RNA was extracted from the leaves of the plants (NaHCO3 treatment) using a CTAB (cetyltrimethylammonium bromide) method. Double-stranded cDNA was synthesized from 5 mg mRNA with a ZAP-cDNA synthesis kit (Stratagene, La Jolla, USA). After blunting the termini, the cDNA fragments were ligated to EcoRI adapters, the EcoRI ends were phosphorylated, and digested with XhoI. The digested cDNA was size fractionated and ligated into the Uni-ZAP XR vector. Ligated products were packaged with Gigapack Gold Packaging Extract (Stratagene). The library was titered, amplified and the insertion efficiency was calculated. For DNA sequencing, mass excision was performed and the cDNA inserts from the amplified phage library were rescued as pBluescript phagemid in SOLR Escherichia coli (Stratagene). 2.2. DNA sequencing The cDNA library clones were plated onto LB plates (ampicillin, 100 mg/ml). The colonies were picked at random and transferred to 96-well microtiter plates containing 1 ml LB media supplemented with ampicillin, and incubated at 220 rpm and 37  C overnight. Plasmid DNA was prepared using a 96-well Miniprep kit (Millipore). Sequencing reactions were performed using M13 reverse primer and DYEnamic ET Terminator Kit (GE Healthcare) according to the manual instruction. DNA sequencing was performed in a MegaBACE 1000 DNA capillary sequencer (Amersham Biosciences). 2.3. Sequence processing and analysis Raw single-pass sequence data were trimmed of the vector sequences, poor quality or sequences less than 100 bp were discarded. The remaining sequences were subjected to data analysis. Contigs were built using the CAP3 assembly program [11] with the parameters set at 95% identity over 40 bp. Individual tentatively unique genes were subjected to BLASTX analysis against the non-redundant (nr) protein database of NCBI (http://www.ncbi.nlm.nih.gov) to search for similarity. The database-matched ESTs (E-values <104) were assigned to 12 groups according to their functional annotation. 2.4. Real-time RTePCR for analysis of gene expression in response to NaHCO3

2. Materials and methods 2.1. Plant culture conditions, treatments and cDNA library construction The L. bicolor seedlings were grown in pots containing a mixture of turf peat and sand (2:1 v/v). Plants were grown

To investigate gene expression in response to NaHCO3, in L. bicolor roots and leaves, eighteen genes that were potentially involved in salt stress were selected and analyzed using real-time RTePCR with gene-specific primers (Table 1). Total RNA was extracted from the leaves and roots of the plants using a CTAB method, and treated with DNase I to remove

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

979

Table 1 Primers used in real-time RTePCR assays Forward and reverse primers 50 e30

Genes EH793552 EU039827 EH795199 EH794292 EH794553 EH793849 EH795149 EH795039 EH794738 EH793429 EH793903 EH794097 EH794804 EH793413 EH793010 EH794547 EH793496 EH793640 EH794270 EH793634

(b-tubulin) (18S rRNA) (lipid transfer protein) (pathogenesis related protein 1) (type 2 metallothionein) (metallothionein-like protein) (calmodulin) (14-3-3 protein) (tonoplast intrinsic protein) (aquaporin) (plasma membrane intrinsic protein) (calcium-dependent protein kinase) (catalase) (proteinase inhibitor se60-like protein) (serine/threonine protein kinase) (cold acclimation protein) (chitinase) (class I chitinase) (phloem protein 2) (putative thioredoxin m2)

GAGATGTTTAGGAGGGTGAGTG CCGTTCTTAGTTGGTGGAG TTGTGGTGGAGGGCATAACG GGAGTTGGACCAGTGACATG TTGCTGTGGTGGAAGTTGTG ACGGAAGTCCTATGATAATAGC GAGCTTGGAACAGTGATGAG CTCTGTGGACATCTGATAATGC TCCCGACGCTTTAATGGCTG GCACTAGCTGCTCTGTATCAC GCTGTGTTCCTAGTCCACC ATGGACACTGATGGAAGTGG CAGGCAAGATCGATTTGTGG AGCCAAGAGATGACGACTCC ATCTACGGACTGAAGGTGAG GACGAAGAGCCACCTCCTCC TGCCTTCTGTACTTCACCTG GGCAGATTGGTGATGCACTC GCTCAAGAAGGGTGTTCTGG TCTGTCACGGATTCCTCAT

genomic DNA contamination. Total RNA (5 mg from each pool) was reverse transcribed in the presence of a 6-mer random primer and poly(dT) sequences in a total volume of 10 ml. The synthesized cDNA was diluted with 90 ml of water and used as template in real-time RTePCR. Each reaction was conducted in triplicate in a total volume of 20 ml containing 10 ml 2 SYBR premix ExTaq (TaKaRa Biotech, Dalian, China), 0.25 mM each primer and 2 ml of template (equivalent to 0.1 mg of total RNA). The real-time RTePCR was performed on an Opticon II system (MJ Research/Bio-Rad). The amplification was performed with the following cycling parameters: 94  C for 30 s, 45 cycles of 94  C for 12 s, 58  C for 30 s, 72  C for 30 s, and 1 s at 80  C for plate reading. A melting curve was generated for each sample at the end of each run to assess the purity of the amplified products. The b-Tubulin (EH793552) and 18S rRNA (EU039827) genes were used as internal references to normalize the amount of total RNA present in each reaction. The expression levels of the genes were calculated from the threshold cycle using the delta-delta Ct method [20].

AAGTTCCTCTTCCTCGTCATC CTCGTTGAATACATCAGTGTAG GCAAGTGATCCCGCGTAACC GCGTGTTAGAGTCATGGTTG CCGCTGCTACTCCCATCTC CACAACACATTTTGCTCACC TCAGCAGCAGAGATGAAACC ACATACCCCTTAAACGAAGG ATGTCCACCGGAGATATTAGC AGACGACGACGGGGCGTG CCAGACCTGAACGGGATAGC GTACTTGTGCATTGTGGCTG TCCAGGACAGGACATGATTG CACTCAACATTGCCTGTTAAC CCTGGTGACCCTGGAGTCC AGGTAACTCAAGCCAATCTGG GGTGATGACATCGTGGCTGG CACATGTCCGGTCACCATAC CAGTGCATGGTGCGAGTATG GTTTCCCAGTGTACTGCTTT

The BLASTX search determined that there were 1393 ESTs (representing 873 unique genes) out of a total of 2358 clones showing significant similarity (E-value <104) to proteins in the nr database of NCBI. The 1393 ESTs that match sequences in the nr database were further classified into 12 categories according to their function (Fig. 1). In addition to providing a quick method for gene discovery, EST analysis is also a powerful tool for determining gene expression levels. By EST analysis, the genes abundantly expressed were identified. We found 14 most abundant genes (the copy number >8) in the EST collection, which accounted for 12.34% of the total ESTs (Table 3). Among them, RuBisCO subunits and photosynthesis related genes accounted for 6.4% of total ESTs, suggesting that CO2 fixation and photosynthesis are still active in leaves of L. bicolor under NaHCO3 stress condition. 3.2. Genes potentially involved in salt tolerance

3. Results

We identified 286 ESTs in the cDNA library, representing 121 unigenes, homologous to genes earlier implicated in stress tolerance (Table 4). These genes are involved in variety

3.1. Properties of the cDNA library and sequenced clones

Table 2 General characteristics of Limonium bicolor ESTs

The primary titer of the cDNA library was 9.6  105 pfu and insertion efficiency was 95%. PCR amplification revealed that the average length of inserts was 0.9 kb. Through DNA sequencing, 2358 high-quality ESTs were generated with GenBank accession numbers from EH792855 to EH795212. The general characteristics of these ESTs are summarized (Table 2). The results indicated that the library should be sufficient to meet the requirements for an EST analysis.

Total number of ESTs analyzed Total reading valid length (bp) Average valid size (bp) GþC content (%) Total contig size (bp) Unique gene number EST clusters Singletons Redundancya a

Redundancy ¼ number of ESTs assembled in clusters/total ESTs.

2358 936239 397 43.3% 318939 1735 198 1537 35%

980

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

Protein synthesis 7.61% Unknown classification 12.20%

Signal transduction 4.74%

Cell structure 2.94%

Cell growth, division 4.02%

Photosynthesis 14.86%

Metabolism 18.74%

Energy 3.23% Protein destination 5.67%

Cell rescue, defense 12.20% Transcription 3.59%

Transport facilitation 10.19%

Fig. 1. Twelve functional categories among the 1393 database-matched ESTs. Unknown classification contains genes with significant similarity to sequences in the nr database whose function are unknown or unclear.

functional areas, such as reactive oxygen scavenging, stress related protein, transport, signal transduction and transcription regulation. The analysis of these genes may be important for revealing the saline-alkali tolerance mechanism of L. bicolor.

were obviously differentially expressed (by more than 2-fold) upon exposure to NaHCO3. Real-time RTePCR also revealed that many of the genes exhibited different expression trends in L. bicolor roots versus leaves under NaHCO3 stress.

3.3. Real-time RTePCR analysis of genes expressed in response to NaHCO3

4. Discussion

Eighteen putative stress related genes were selected for analysis of gene expression in response to NaHCO3 stress in L. bicolor leaves and roots (Fig. 2). Among them, 14 genes Table 3 Abundant ESTs found in L. bicolor cDNA library Genes

Putative function (E-Value <104)

Number of ESTs

EH792950 Ribulose-1,5-bisphosphate carboxylase/ 81 oxygenase, small subunit EH793658 Chlorophyll a/b binding protein 16, 36 chloroplast precursor EH794553 Type 2 metallothionein 32 EH794695 Lipid transfer protein precursor 32 EH793413 Proteinase inhibitor se60-like protein 15 EH793276 Photosystem II 10 kDa polypeptide, 13 chloroplast precursor EH793047 Ferredoxin I 12 EH794187 Photosystem I reaction center 11 subunit IV, chloroplast precursor EH793465 Unnamed protein 11 EH793347 Metallothionein-like protein 10 EH794059 No significant similarity 10 EH794033 Photosystem I subunit XI precursor 10 EH795199 Lipid transfer protein 9 EH794486 Metallothionein-like protein 9 Total 291

Percentage of total (%) 3.43 1.53 1.36 1.36 0.64 0.55 0.51 0.47 0.47 0.42 0.42 0.42 0.38 0.38 12.34

Because different plants may develop different strategies for resisting salt stress, we compared our gene expression findings for L. bicolor, to prior findings in the following species: Tamarix androssowii (0.4 M NaHCO3 treatment for 48 h) [32], M. crystallinum (0.5 M NaCl treatment for 48 h) [16], Thellungiella halophila (0.2 M NaCl treatment for 48 h) [31] and Puccinellia tenuiflora (0.45 M NaHCO3 treatment for 48 h) [30]. This comparison indicated that the genomic response to stress in L. bicolor differed from that of the other halophyte plants. For example, the proportion (14.9%) of photosynthesis genes expressed upon exposure to stress for 48 h in L. bicolor (Fig. 1) was significantly higher than that in T. androssowii (9.9%), M. crystallinum (9.6%), P. tenuiflora (9.3%) and T. halophila (7.3%). This result suggests that L. bicolor can maintain a higher level of photosynthesis than the other plants, when under salt stress. The transport facilitation genes in L. bicolor constituted 10.2% of known ESTs and were more highly expressed than those of M. crystallinum (5.1%), P. tenuiflora (6.2%), T. androssowii (6.7%) and T. halophila (7.2%). However, the proportion (3.6%) of the transcription genes in L. bicolor (Fig. 1) was obviously lower than that in P. tenuiflora (12.4%), T. halophila (10.9%) and T. androssowii (6.7%). These differences summarized above indicate that L. bicolor may employ some different strategies for salinity tolerance than other studied halophytes.

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

981

Table 4 Genes potentially involved in stress tolerance in L. bicolor Genes

Functional annotation

Matching organism

E-value

Number of ESTs

Reactive oxygen scavengers EH794553 Type 2 metallothionein EH793347 Metallothionein-like protein EH794486 Metallothionein-like protein EH794804 Catalase EH793977 Catalase EH793656 Catalase EH793287 Peroxiredoxin Q EH793629 Metallothionein-like protein type 3 EH793913 Superoxide dismutase (Mn) EH793207 Metallothionein EH794326 Peroxiredoxin EH794580 24K germin like protein EH794987 Cytosolic ascorbate peroxidase EH793171 Germin-like protein 1 EH794753 Glutathione S-transferase EH793225 Glutathione S-transferase GST 21 EH793361 Glutathione transferase EH794754 Glutathione S-transferase GST 23 EH794940 Glutathione S-transferase EH794824 Cationic peroxidase EH793778 Thioredoxin peroxidase EH794382 Os06g0320000 (Thioredoxin-related) EH794584 Glutathione S-transferase EH793663 Cu/Zn-SOD copper chaperone precursor EH793849 Putative metallothionein-like protein EH793634 Putative thioredoxin m2 EH794224 Glutaredoxin EH794226 Dehydroascorbate reductase EH793216 Dehydroascorbate reductase EH793973 NADP-thioredoxin reductase C EH793504 Multidrug resistance-associated protein 1 EH793421 Thioredoxin f1

Arachis hypogaea Carica papaya Vitis vinifera Mesembryanthemum crystallinum Brassica juncea Avicennia marina Sedum lineare C. papaya Rheum australe Glycine max Phaseolus vulgaris Nicotiana tabacum M. crystallinum Arabidopsis thaliana V. vinifera G. max Thlaspi caerulescens G. max Salicornia brachiata Stylosanthes humilis N. tabacum Oryza sativa V. vinifera G. max Cicer arietinum Pisum sativum Vernicia fordii A. thaliana Zinnia elegans Medicago truncatula A. thaliana A. thaliana

2e-10 5e-09 5e-07 7e-51 3e-37 7e-59 6e-10 7e-08 2e-47 5e-11 4e-48 3e-61 1e-37 1e-20 9e-38 2e-50 5e-71 2e-55 2e-39 4e-07 3e-42 1e-08 1e-30 8e-34 7e-05 4e-24 2e-39 1e-42 7e-32 9e-62 5e-43 7e-47

32 10 9 4 2 3 1 4 3 3 2 2 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 2

Stress protein EH793995 EH794292 EH793413 EH792892 EH794725 EH793640 EH793496 EH793825 EH795143 EH794904 EH794547 EH793838 EH794417 EH794210 EH794270 EH793979 EH795031 EH794772 EH793662 EH794637

Pathogenesis-related protein Putative pathogenesis related protein 1 precursor Proteinase inhibitor se60-like protein Proteinase inhibitor Low temperature and salt responsive protein LTI6A Class I chitinase Chitinase Putative class I chitinase Defensin protein precursor Dehydration-induced protein Cold acclimation protein WCOR413 Acireductone dioxygenase Thaxtomin resistance protein TXR1 Chitinase Phloem protein 2 Low temperature and salt responsive protein LTI6A Proteinase inhibitor Drought inducible 22 kDa protein Universal stress protein (Usp) Lectin like protein

Pyrus pyrifolia V. vinifera Citrus  paradisi G. max A. thaliana A. thaliana P. sativum A. thaliana Solanum lycopersicum Aegiceras corniculatum Chimonanthus praecox Plantago major A. thaliana Chenopodium amaranticolor Cucurbita moschata A. thaliana Oryza sativa Saccharum officinarum A. thaliana A. thaliana

4e-23 2e-43 1e-04 8e-07 9e-11 2e-22 3e-69 5e-40 2e-07 7e-12 1e-20 7e-89 1e-18 9e-44 2e-16 1e-14 2e-09 1e-18 3e-10 8e-17

2 6 15 4 2 1 1 1 2 1 1 2 1 1 4 1 1 2 2 2

Transport EH793903 EH795199 EH794695 EH794560 EH793892 EH795083

Putative plasma membrane intrinsic protein Lipid transfer protein Lipid transfer protein precursor Probable lipid transfer protein family protein Vacuolar Hþ-ATPase Lipid transfer protein

Populus tremula  P. tremuloides Helianthus annuus Davidia involucrata Vigna unguiculata Chenopodium rubrum Citrus sinensis

4e-44 3e-26 1e-27 1e-13 3e-64 4e-14

2 9 32 7 1 2 (continued on next page)

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

982 Table 4 (continued) Genes

Functional annotation

Matching organism

E-value

EH794721 EH793398 EH793055 EH794738 EH792861 EH793429 EH794696 EH792863

Lycopersicon esculentum A. marina M. crystallinum Kandelia candel A. thaliana Iris  hollandica M. truncatula A. thaliana

1e-78 4e-25 1e-86 5e-41 3e-16 2e-36 2e-63 1e-17

1 1 1 1 2 3 1 1

EH794805 EH794314 EH795066 EH793644

Vacuolar Hþ-ATPase A1 subunit isoform; Vacuolar Hþ-ATPase C subunit Water channel protein MipI Tonoplast intrinsic protein Putative lipid transfer protein Aquaporin Hþ-transporting two-sector ATPase Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor Plant lipid transfer protein Hþ-transporting ATP synthase chain 9-like protein ER-type Ca2þ-pumping ATPase; ECA1p Putative Vacuolar ATP synthase subunit G1

A. thaliana A. thaliana A. thaliana O. sativa

1e-14 1e-30 4e-81 9e-06

2 2 1 1

Signal transduction EH794097 EH793074 EH793203 EH793165 EH793046 EH793966 EH793595 EH792891 EH794628 EH794171 EH793010 EH793191 EH792977 EH795149

Calcium-dependent protein kinase Adenosine kinase 2 Calcium-dependent protein kinase Putative small Ras GTP-binding protein Calmodulin cam-207 GTP-binding protein, RAB1C Casein kinase 1-like protein 1 Protein phosphatase type 2C Adenosine kinase CDPK-like protein Serine/threonine protein kinase Serine/threonine-specific protein kinase Protein phosphatase 2C Calmodulin cam-203

N. tabacum O. sativa A. thaliana A. thaliana Daucus carota P. sativum A. thaliana A. thaliana Cicer arietinum Solanum tuberosum A. thaliana A. thaliana Medicago sativa D. carota

3e-62 3e-59 3e-93 1e-84 1e-31 5e-18 1e-48 1e-43 4e-24 7e-29 1e-72 8e-34 2e-63 1e-71

1 1 1 2 1 1 1 1 2 1 1 1 1 1

A. thaliana S. tuberosum Beta vulgaris N. tabacum Populus alba  Populus tremula var. glandulosa Ipomoea nil Iris hollandica Populus tomentosa C. arietinum A. thaliana

9e-38 1e-44 4e-28 8e-31 3e-25

1 1 1 1 2

3e-48 1e-22 2e-13 3e-28 7e-06

1 1 2 2 2

L. esculentum P. sativum A. thaliana Capsicum annuum Vitis aestivalis A. thaliana O. sativa

6e-25 3e-16 7e-14 1e-05 1e-19 2e-42 6e-63

1 1 1 1 1 1 1

N. tabacum C. arietinum Pimpinella brachycarpa N. tabacum O. sativa

1e-13 9e-60 6e-47 2e-54 2e-16

1 1 1 1 1

L. esculentum Sorghum bicolor Zea mays N. tabacum Polygonum hydropiper

9e-08 2e-93 2e-27 4e-23 3e-41

1 1 1 1 1

Protein synthesis and destination EH794174 Translation initiation factor SUI1 EH793337 Eukaryotic initiation factor 5A5-like protein EH794296 Translation initiation factor (eIF-1A) EH795141 Small heat shock protein EH794478 Copper chaperone EH793886 EH793159 EH794485 EH793789 EH793146

Transcription EH793562 EH793925 EH795128 EH792909 EH793557 EH794561 EH793422 EH793235 EH794891 EH794079 EH793848 EH795039

Cysteine proteinase Cysteine proteinase Cysteine proteinase Putative adenosine kinase DNAJ heat shock N-terminal domain-containing protein

Dehydration responsive element-binding protein 3 Glycine-rich RNA-binding protein PsGRBP Putative RING-H2 zinc finger protein Cys-3-His zinc finger protein Ethylene responsive element binding factor MADS-box protein AGL12 Putative chitin-inducible gibberellin-responsive protein Ethylene-responsive transcription factor 3 14-3-3-like protein 14-3-3 protein 14-3-3 d-2 protein 14-3-3 protein

Metabolism, energy and photosynthesis EH793144 Malate dehydrogenase EH793574 Mitochondrial aldehyde dehydrogenase EH794136 Mitochondrial aldehyde dehydrogenase RF2B EH792920 Trehalose-phosphate phosphatase EH793415 Chalcone synthase

Number of ESTs

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

983

Table 4 (continued ) Genes

Functional annotation

Matching organism

E-value

EH794273 EH793035 EH794574 EH793410 EH794260 EH794108 EH794563 EH793646 EH794031 EH795147

Putative beta 1,3-glucanase Putative dTDP-glucose 4-6-dehydratase Beta-1,3-glucanase-like protein Beta-1,3-glucanase Glyceraldehyde-3-phosphate dehydrogenase Oxygen-evolving enhancer protein 1 Oxygen-evolving enhancer protein 3 Oxygen-evolving enhancer protein 2 Putative oxygen evolving enhancer protein 3 Beta-alanine N-methyltransferase

O. sativa A. thaliana A. thaliana Olea europaea B. vulgaris Spinacia oleracea S. oleracea P. sativum Solanum demissum Limonium latifolium

9e-09 2e-13 1e-33 5e-30 5e-85 5e-78 4e-32 6e-21 3e-29 5e-22

Chen et al. [4] constructed a cDNA library from leaf tissue of Limonium sinense, a relative of L. bicolor, and analyzed genes expressed under unstressed condition. A comparison of gene expression in L. sinense and L. bicolor showed that there were some similarities between the two Limonium species. The most abundant functional categories were metabolism, photosynthesis, and protein synthesis and destination in both L. sinense [4] and L. bicolor (Fig. 1). In addition, some photosynthesis related genes, such as those for the chlorophyll a/b binding proteins, photosystem I and II proteins, were highly expressed in both L. sinense [4] and L. bicolor (Table 3). These similarities suggested that these functional groups were abundant in Limonium species, and their predominant abundance was also not obviously changed by salt stress. However, there were some obvious differences in gene expression between these two species. Metallothionein family genes were highly expressed (2.54%) in L. bicolor after exposure to NaHCO3 (Table 4); however, these genes seemed to have very low expression levels in L. sinense under normal growing conditions. This result suggested that some metallothionein genes may be induced by NaHCO3 stress. In addition, the real-time RTePCR results also confirmed that two metallothionein genes (Fig. 2F,G) were up-regulated in leaves of L. bicolor by NaHCO3 stress. The genes, including binding SOUL-like protein, triose-phosphate isomerase, ubiquitin/ribosomal protein, alphacpn60 precursor, senescence-associated protein, heat shock protein binding and transketolase, were all highly expressed in L. sinense under normal growing conditions, but had low expression levels in L. bicolor under NaHCO3 stress. These results indicated that the expression of these genes might be inhibited by saline-alkali stress in L. bicolor. It is worth to mention that reactive oxygen scavengers accounted for no more than 1% of total ESTs in L. sinense [4] in comparison to more than 4% of total ESTs in L. bicolor underNaHCO3 stress (Table 4), suggesting that NaHCO3 treatment triggered the expression of some reactive oxygen scavengers. The ESTs representing stress proteins were less than 1% of total ESTs in L. sinense under unstressed condition [4]; however, this kind of genes accounted for more than 2% of total ESTs in L. bicolor under NaHCO3 stress (Table 4). The increasing abundance of stress protein genes due to stress treatment indicated that some of them might be involved in stress tolerance. b-Alanine betaine, an osmoprotectant, is accumulated in most members of Limonium species during saline and hypoxic

Number of ESTs 1 1 2 3 1 6 3 1 1 1

stress [25], and plays an important role in osmotic stress tolerance of Plumbaginaceae. Gagneul et al. [8] revealed that b-alanine betaine was mainly located in the vacuoles of L. latifolium under non-saline conditions, and could be partly directed to the cytosol in response to saline stress. Hanson et al. [9] found that unlike glycine betaine, synthesis of b-alanine betaine does not require oxygen and cannot interfere with the conjugation of sulfate to choline by competing for choline. These features of b-alanine betaine may be advantageous in sulfate-rich salt marsh environments. Raman et al. [23] had cloned a gene for N-methyltransferase from L. latifolium, and confirmed that this gene was involved in b-alanine betaine synthesis. In our study, analysis of ESTs showed that an N-methyltransferase gene (EH795147) was expressed in L. bicolor, suggesting that b-alanine betaine is synthesized and may make contribution to saline-alkali tolerance of L. bicolor. The synthetic pathway of b-alanine betaine is an interesting target for metabolic engineering due to its potential role in plant tolerance to salinity. So this N-methyltransferase gene from L. bicolor may be a good candidate gene for metabolic engineering. Exposure of plants to biotic or abiotic stress often leads to the generation of reactive oxygen species (ROS); therefore, it is important for plants to have efficient ROS scavenging mechanisms. About 7% of database-matched ESTs involved in ROS scavenging were found in our EST library, indicating an important role in NaHCO3 stress tolerance of L. bicolor. The expression of four ROS scavenging genes was analyzed in roots and leaves of L. bicolor using real-time RTePCR (Fig. 2EeH). Three of them were strongly differentially expressed during the NaHCO3 treatment. Catalase can scavenge superoxide anions and hydrogen peroxide. The catalase gene (EH794804) was strongly down-regulated in both the roots and leaves of L. bicolor (Fig. 2H), suggesting that catalase activity may be inhibited after exposure to NaHCO3 for 48 h. Metallothionein (MT) and metallothionein-like protein (MTLP) are capable of scavenging free radicals generated by abiotic stress, and expression of some MT and MTLP genes have been reported in response to various abiotic stresses [5,7,14]. The MT and MTLP genes are abundant in leaves of L. bicolor, and accounted for 2.54% of total ESTs, suggesting that they may play important roles in the physiology and ROS-scavenging pathways. In our study, two MT genes (EH794553, EH793849) were found to be up-regulated in roots and leaves of L. bicolor (Fig. 2F,G), indicating that they may play roles in NaHCO3 tolerance.

Log2(relative expression level)

0

3

3

-0.5

2.5

2

-1

2 1

-1.5

1.5

-2 0.1

-3

-0.2

-3.5

Leaf

Root

-0.3

Leaf

Log2 (relative expression level)

0

Leaf

4 3 3 2

Root

-2

1

0 -1

Root

1

0

0.8

-0.5

0.6

-1

0.4

-1.5

0.2

-2

0

0

Leaf

Root

-2.5

Leaf

F

Root

Leaf

G

1.5

2

0

1

1.5

-1

0

0.5

-1

0

-2

-0.5

1

-2

0.5

-3

0

-3

-1

-4

-1.5

Leaf

Root

-4

-0.5

-5

-1

Leaf

I

Root

-1.5

Leaf

6

-1

3

-1.5

-1

-2.5 1

1 0

Leaf

Root

M

-2

2

2

Root

0

3 0

Leaf

-0.5

4

4

1

-6

L

5

5

2

Root

K

J

3

Root

H

1

2

Leaf

Root

N

0

-3 -3.5

Leaf

Root

Leaf

O

Root

P

0

2

-1

1 0

-2

-1

-3

-2

-4

-3

-5

-4

-6 -7

Root

D

2

1

-2

Leaf

C

4

E Log2 (relative expression level)

Root

B

5

Leaf

Log2 (relative expression level)

-1

0.5

A

Log2 (relative expression level)

0

1

-2.5

-5 -6

Leaf

Root

Q

Leaf

Root

R

Fig. 2. Real-time RTePCR analysis of gene expression in roots and leaves of L. bicolor exposed to NaHCO3 for 48 h. Relative expression level ¼ gene expression level under NaHCO3 stress/gene expression level under control condition. The relative expression level values were log2 transformed, >0 means up-regulation, <0 means down-regulation, and ¼0 means unchangeable. (A) EH795149 (calmodulin), (B) EH794097 (calcium-dependent protein kinase); (C) EH793010 (serine/ threonine protein kinase); (D) EH795039 (14-3-3 protein); (E) EH793634 (putative thioredoxin); (F) EH793849 (metallothionein-like protein); (G) EH794553 (type 2 metallothionein); (H) EH794804 (catalase); (I) EH793903 (plasma membrane intrinsic protein); (J) EH794738 (tonoplast intrinsic protein); (K) EH793429 (aquaporin); (L) EH793413 (proteinase inhibitor se60-like protein); (M) EH795199 (lipid transfer protein); (N) EH794547 (cold acclimation protein); (O) EH794292 (pathogenesis related protein); (P) EH794270 (phloem protein 2); (Q) EH793640 (class I chitinase); (R) EH793496 (chitinase).

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

It has been proposed that plants use common signaling pathways and components in response to a variety abiotic stresses [33]. The signaling components account for 4.74% of total known genes (Fig. 1), and some of them that are potentially involved in salt tolerance were identified (Table 4). Some signal transduction genes were further analyzed in this study. Real-time PCR showed that the gene for calmodulin (CAM; EH795149) was down-regulated in roots and leaves under NaHCO3 stress (Fig. 2A). The degradation of CAM can function as a sensor for oxidative stress, resulting in downregulation of global rates of metabolism and enhancing cellular survival [29]. Thus, the decreased expression of the CAM gene may also help in down-regulation of global metabolic rates in L. bicolor to cope with NaHCO3-induced oxidative stress. Protein kinases function in a variety of signaling pathways involved in cell division, metabolism, and in response to environmental signals. Serine/threonine protein kinase has been shown to be a critical component of the salt stress-signaling pathway. A serine/ threonine protein kinase gene from wheat was previously found to be up-regulated by salt, low temperature and drought [35]. Our study also detected the expression of a serine/ threonine protein kinase gene (EH793010) that was highly up-regulated in roots and leaves of L. bicolor (Fig. 2C), suggesting that this gene functions in signaling pathways that mediate saltalkali tolerance. 14-3-3 proteins have roles in regulating plant development and stress responses [26], and they are also involved in osmotic regulation of Hþ-ATPase in the plant plasma membrane [1]. Four unique 14-3-3 transcripts were included in the L. bicolor library, suggesting that L. bicolor contains multiple 14-3-3 isoforms. A 14-3-3 gene (EH795039) is up-regulated in leaves when they are stressed by NaHCO3 for 48 h (Fig. 2D), indicating that it may play a role in regulating stress responses in leaves of L. bicolor. Aquaporins mediate the movement of water through cell membranes according to osmotic and hydrostatic pressure gradients [2]. Plants usually have large aquaporin families, providing them with many ways to regulate water transport [28]. Seven aquaporin family genes were found in the EST collection, which represent four unique aquaporin genes (Table 4), indicating that L. bicolor has many ways to regulate water transport. Three aquaporin genes were further analyzed in this study (Fig. 2IeK); we observed different expression trends for them in leaves and roots of L. bicolor after exposure to NaHCO3, an indication of the different regulation profiles of the genes. Proteinase inhibitors are involved in various plant defense mechanisms including those for water stress [17], defense against insects and pathogens. Although the transcript of proteinase inhibitor (EH793413) was abundant in the EST library (Table 3), its expression was decreased in plants subjected to NaHCO3 stress for 48 h (Fig. 2L), suggesting that NaHCO3 treatment may inhibit the activity of proteinase inhibitor proteins in both leaves and roots of L. bicolor. Lipid transfer proteins (LTPs) have been implicated in stress responses to pathogens and some abiotic stresses [13,34], and may have a function in repair of stress-induced damage in membranes or changes in the lipid composition of membranes.

985

They are also probably involved in regulating permeability to toxic ions and the fluidity of the membranes. The induction of LTP genes may help to reduce water loss by increasing cuticle thickness [24].The LTP genes were abundant in our EST collection (Table 4), suggesting an important role in the physiology of L. bicolor. An LTP gene (EH795199) was upregulated in roots and down-regulated in leaves of L. bicolor (Fig. 2M), showing the different effects on lipid metabolism in roots and leaves, induced by NaHCO3 stress. The defense genes accounted for more than 12% of total database-matched ESTs (Fig. 1), and some defense genes were differentially regulated by NaHCO3 stress (Fig. 2), suggesting important roles in the stress tolerance. Pathogenesis-related proteins, induced by pathogen attack and also found to be related to biotic, abiotic stresses and ABA, were stress tolerance genes [19,27]. Our study also suggested that the expression of pathogenesis-related protein (PRP) gene was regulated in response to salt-alkali stress. The PRP gene (EH794292) was strongly up-regulated in roots and leaves of L. bicolor after exposure to NaHCO3 for 48 h (Fig. 2O). It appears there may be some cross-over between responses to abiotic and biotic stresses. Cold acclimation proteins (CAP) are anti-freeze proteins, and some of them are also involved in water stress responses [22]. In this study, we also identified a CAP gene (EH794547) involved in saline-alkali stress, as indicated by high up-regulation in roots and leaves of L. bicolor under NaHCO3 stress for 48 h (Fig. 2N). The increased expression of this CAP gene may enhance stress tolerance in L. bicolor. Chitinases are hydrolases involved in plant defense against a variety of pathogens, and are also involved in abiotic stress responses or tolerance, such as to cold [36], salinity, and heavy metals [6]. We found two chitinase genes (EH793640, EH793496) that were responsive to saline-alkali stress, and both were down-regulated in leaves of L. bicolor (Fig. 2Q,R), suggesting that the chitinase activity might be decreased in L. bicolor leaves as a result of NaHCO3 treatment for 48 h. In conclusion, we constructed a cDNA library from L. bicolor and obtained 2358 high-quality ESTs. The present findings provide fundamental data that can be applied to enrich our knowledge about plant stress tolerance on a molecular level, and also provide new insight into saline-alkali tolerance in plants. Acknowledgments This work has been supported by National Natural Science Foundation of China (30571509) and the Key Research Projects of Heilongjiang Province (GB06B303-1). References [1] A.V. Babakov, V.V. Chelysheva, O.I. Klychnikov, S.E. Zorinyanz, M.S. Trofimova, A.H. De Boer, Involvement of 14-3-3 proteins in the osmotic regulation of Hþ-ATPase in plant plasma membranes, Planta 211 (2000) 446e448. [2] M. Bots, F. Vergeldt, M. Wolters-Arts, K. Weterings, H. van As, C. Mariani, Aquaporins of the PIP2 class are required for efficient anther dehiscence in Tobacco, Plant Physiol. 137 (2005) 1049e1056.

986

Y. Wang et al. / Plant Physiology and Biochemistry 46 (2008) 977e986

[3] A. Bouchereau, C. Duhaze´a, J. Martin-Tanguya, J.P. Gue´ganb, F. Larher, Improved analytical methods for determination of nitrogenous stress metabolites occurring in Limonium species, J. Chromatogr. A 836 (1999) 209e221. [4] S.H. Chen, S.L. Guo, Z.L. Wang, J.Q. Zhao, Y.X. Zhao, H. Zhang, Expressed sequence tags from the halophyte Limonium sinense, DNA Seq. 18 (2007) 61e67. [5] S.H. Cho, Q.T. Hoang, Y.Y. Kim, H.Y. Shin, S.H. Ok, J.M. Bae, J.S. Shin, Proteome analysis of gametophores identified a metallothionein involved in various abiotic stress responses in Physcomitrella patens, Plant Cell Rep. 25 (2006) 475e488. [6] M. de las Mercedes Dana, J.A. Pintor-Toro, B. Cubero, Transgenic tobacco plants overexpressing chitinases of fungal origin show enhanced resistance to biotic and abiotic stress agents, Plant Physiol. 142 (2006) 722e730. [7] C. Fu, W. Miao, Cloning and characterization of a new multi-stress inducible metallothionein gene in Tetrahymena pyriformis, Protist 157 (2006) 193e203. [8] D. Gagneul, A. A€ınouche, C. Duhaze´, R. Lugan, F.R. Larher, A. Bouchereau, A reassessment of the function of the so-called compatible solutes in the halophytic Plumbaginaceae Limonium latifolium, Plant Physiol. 144 (2007) 1598e1611. [9] A.D. Hanson, B. Rathinasabapathi, B. Chamberlin, D.A. Gage, Comparative physiological evidence that b-alanine betaine and choline-o-sulfate act as compatible osmolytes in halophytic Limonium species, Plant Physiol. 97 (1991) 1199e1205. [10] M. Houde, M. Belcaid, F. Ouellet, J. Danyluk, A.F. Monroy, A. Dryanova, P. Gulick, A. Bergeron, A. Laroche, M.G. Links, L. MacCarthy, W.L. Crosby, F. Sarhan, Wheat EST resources for functional genomics of abiotic stress, BMC Genomics 13 (2006) 7:149. [11] X. Huang, A. Madan, CAP3: A DNA sequence assembly program, Genome Res. 9 (1999) 868e877. [12] G. Iturriaga, M.A.F. Cushman, J.C. Cushman, An EST catalogue from the resurrection plant Selaginella lepidophylla reveals abiotic stressadaptive genes, Plant Sci. 170 (2006) 1173e1184. [13] C.S. Jang, D.S. Kim, S.Y. Bu, J.B. Kim, S.S. Lee, J.Y. Kim, J.W. Johnson, Y.W. Seo, Isolation and characterization of lipid transfer protein (LTP) genes from a wheat-rye translocation line, Plant Cell Rep. 20 (2002) 961e966. [14] S. Jin, Y. Cheng, Q. Guan, D. Liu, T. Takano, S. Liu, A metallothioneinlike protein of rice (rgMT) functions in E. coli and its gene expression is induced by abiotic stresses, Biotechnol. Lett. 28 (2006) 1749e1753. [15] H. Jin, P. Plaha, J.Y. Park, C.P. Hong, I.S. Lee, Z.H. Yang, G.B. Jiang, S.S. Kwak, S.K. Liu, J.S. Lee, Y.A. Kim, Y.P. Lim, Comparative EST profiles of leaf and root of Leymus chinensis, a xerophilous grass adapted to high pH sodic soil, Plant Sci. 170 (2006) 1081e1086. [16] S. Kore-eda, M.A. Cushman, I. Akselrod, D. Bufford, M. Fredrickson, E. Clark, J.C. Cushman, Transcript profiling of salinity stress responses by large-scale expressed sequence tag analysis in Mesembryanthemum crystallinum, Gene 341 (2004) 83e92. [17] G. Ledoigt, B. Griffaut, E. Debiton, C. Vian, A. Mustel, G. Evray, J.C. Maurizis, J.C. Madelmont, Analysis of secreted protease inhibitors after water stress in potato tubers, Int. J. Biol. Macromol. 38 (2006) 268e271. [18] M.L. Lian, H.N. Murthy, K.Y. Paek, Culture method and photosynthetic photon flux affect photosynthesis, growth and survival of Limonium ‘Misty Blue’ in vitro, Scientia Hort. 95 (2002) 239e249. [19] X.J. Liu, B.B. Huang, J. Lin, J. Fei, Z.H. Chen, Y.Z. Pang, X.F. Sun, K. Tang, A novel pathogenesis-related protein (SsPR10) from Solanum surattense with ribonucleolytic and antimicrobial activity is stress- and pathogen-inducible, J. Plant Physiol. 163 (2006) 546e556.

[20] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) Method, Methods 25 (2001) 402e408. [21] P.A. Mehta, K. Sivaprakash, M. Parani, G. Venkataraman, A.K. Parida, Generation and analysis of expressed sequence tags from the salt-tolerant mangrove species Avicennia marina (Forsk) Vierh, Theor. Appl. Genet. 110 (2005) 416e424. [22] L.G. Neven, D.W. Haskell, A. Hofig, Q.B. Li, C.L. Guy, Characterization of a spinach gene responsive to low temperature and water stress, Plant Mol. Biol. 21 (1993) 291e305. [23] S.B. Raman, B. Rathinasabapathi, Beta-alanine N-methyltransferase of Limonium latifolium. cDNA cloning and functional expression of a novel N-methyltransferase implicated in the synthesis of the osmoprotectant beta-alanine betaine, Plant Physiol. 132 (2003) 1642e1651. [24] S. Ramanjulu, D. Bartels, Drought- and desiccation-induced modulation of gene expression in plants, Plant Cell Environ. 25 (2002) 141e151. [25] B. Rathinasabapathi, W.M. Fouad, C.A. Sigua, Beta-alanine betaine synthesis in the Plumbaginaceae. purification and characterization of a trifunctional, S-adenosyl-L-methionine-dependent N-methyltransferase from Limonium latifolium leaves, Plant Physiol. 126 (2001) 1241e1249. [26] M.R. Roberts, 14-3-3 proteins find new partners in plant cell signaling, Trends Plant Sci. 8 (2003) 218e223. [27] S. Sarowar, Y.J. Kim, E.N. Kim, K.D. Kim, B.K. Hwang, R. Islam, J.S. Shin, Overexpression of a pepper basic pathogenesis-related protein 1 gene in tobacco plants enhances resistance to heavy metal and pathogen stresses, Plant Cell Rep. 24 (2005) 216e224. [28] S. Sjo¨vall-Larsen, E. Alexandersson, I. Johansson, M. Karlsson, U. Johanson, P. Kjellbom, Purification and characterization of two protein kinases acting on the aquaporin SoPIP2;1, Biochim. Biophys. Acta. 1758 (2006) 1157e1164. [29] T.C. Squier, Redox modulation of cellular metabolism through targeted degradation of signaling proteins by the proteasome, Antioxid. Redox. Signal 8 (2006) 217e228. [30] Y.C. Wang, Y.G. Chu, G.F. Liu, M.H. Wang, J. Jiang, Y.J. Hou, G.Z. Qu, C.P. Yang, Identification of expressed sequence tags in an alkali grass (Puccinellia tenuiflora) cDNA library, J. Plant Physiol. 164 (2007) 78e89. [31] Z.L. Wang, P.H. Li, M. Fredricksen, Z.Z. Gong, C.S. Kim, C.Q. Zhang, H.J. Bohnert, J.K. Zhu, R.A. Bressan, P.M. Hasegawa, Y.X. Zhao, H. Zhang, Expressed sequence tags from Thellungiella halophila, a new model to study plant salt- tolerance, Plant Sci. 166 (2004) 609e616. [32] Y.C. Wang, C.P. Yang, G.F. Liu, J. Jiang, J.H. Wu, Generation and analysis of expressed sequence tags from a cDNA library of Tamarix androssowii, Plant Sci. 170 (2006) 28e36. [33] C.E. Wong, Y. Li, B.R. Whitty, C. Dy´az-Camino, S.R. Akhter, J.E. Brandle, G.B. Golding, E.A. Weretilnyk, B.A. Moffatt, M. Griffith, Expressed sequence tags from the Yukon ecotype of Thellungiella reveal that gene expression in response to cold, drought and salinity shows little overlap, Plant Mol. Biol. 58 (2005) 561e574. [34] G. Wu, A.J. Robertson, X. Liu, P. Zheng, R.W. Wilen, N.T. Nesbitt, L.V. Gusta, A lipid transfer protein gene BG-14 is differentially regulated by abiotic stress, ABA, anisomycin, and sphingosine in bromegrass (Bromus inermis), J. Plant Physiol. 161 (2004) 449e458. [35] L.M. Xiong, J.K. Zhu, Abiotic stress signal transduction in plants: Molecular and genetic perspectives, Physiol. Plant 112 (2001) 152e166. [36] S. Yeh, B.A. Moffatt, M. Griffith, F. Xiong, D.S.C. Yang, S.B. Wiseman, F. Sarhan, J. Danyluk, Y.Q. Xue, C.L. Hew, A. Doherty-Kirby, G. Lajoie, Chitinase genes responsive to cold encode antifreeze proteins in winter cereals, Plant Physiol. 124 (2000) 1251e1264.