- Email: [email protected]
Generation of a luciferase-expressing human embryonic stem cell line: NERCe002-A-2
Stem Cell Research 28 (2018) 172–176
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Single Cell Line
Generation of a luciferase-expressing human embryonic stem cell line: NERCe002-A-2 Yingying Peng a, Menghan Xie a, Xingxiang Duan a, Liang Hu a,b,c, Juan Yu b, Sicong Zeng a,b, Yang Wang a, Qi Ouyang a,b,c, Guangxiu Lu b,c,d, Ge Lin a,b,c,d, Yi Sun a,b,c,⁎ a
Institute of Reproductive and Stem Cell Engineering, School of Basic Medical Science, Central South University, Changsha, China National Engineering and Research Center of Human Stem Cells, Changsha, China Key Laboratory of Stem Cells and Reproductive Engineering, Ministry of Health, Changsha, China d Reproductive & Genetic Hospital of CITIC-Xiangya, Changsha, China b c
a r t i c l e
i n f o
Article history: Received 24 December 2016 Received in revised form 30 January 2018 Accepted 11 February 2018 Available online 15 February 2018
a b s t r a c t The human embryonic stem cell line NERCe002-A-2 was generated by transduction of NERCe002-A cells with an expression vector carrying the luciferase gene. The stem cells labelled with luciferase can be transplanted into animals and detected by the bioluminescence imaging technology. This provides optimal prospects of application to in vivo stem cell tracing. Luciferin served as a substrate to detect the activity of luciferase, and luciferase expression was measured by quantitative PCR. Characterization assays suggested that the NERCe002-A-2 cell line expresses typical markers of pluripotency and can form the 3 germ layers in vivo. © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Resource table.
(continued)
Unique stem cell line identifier
NERCe002-A-2
Alternative name(s) of stem cell line Institution
chHES-90-PLEX-Luciferase
Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive
National Engineering and Research Center of Human Stem Cells, Changsha, China Yi Sun, [email protected] ESC Human Age: N/A Sex: male Ethnicity: Chinese In vitro fertilization–derived embryo Clonal N/A Yes Transgene expression N/A N/A Lentivirus Luciferase Constitutive
⁎ Corresponding author at: Institute of Reproductive and Stem Cell Engineering, School of Basic Medical Science, Central South University, Changsha, China. E-mail address: [email protected] (Y. Sun).
Unique stem cell line identifier
NERCe002-A-2
system Date archived/stock 10 May 2016 date Cell line repository/bank N/A Ethical approval The study was approved by the ethical committee of the Reproductive and Genetic Hospital of CITIC-Xiangya (Approval number: 2001–01).
Resource utility The cell line NERCe002-A-2 was generated from the normal human embryonic stem cell (hESC) line NERCe002-A. This established cell line stably expresses a luciferase marker and can be transplanted into animals. Subsequently, the transplanted cells can be detected by the bioluminescence imaging (BLI) technology. Thus, it may be used for in vivo stem cell tracing. Resource details BLI is based on the sensitive detection of visible light produced during enzyme (luciferase)-mediated oxidation of a molecular substrate when the enzyme is expressed in vivo as a molecular reporter (Sadikot and Blackwell, 2005). Relative to the parent cells, the cell line expressing luciferase has the potential to be a more powerful tool for the elucidation of tumour metastasis mechanisms, such as the detection of
https://doi.org/10.1016/j.scr.2018.02.010 1873-5061/© 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
metastatic sites and of tumour cell growth (Sudo et al., 2016). In this study, we established a novel hESC line labelled with luciferase; these cells can be transplanted into animals and detected by the BLI technology. This implies optimal prospects of application to in vivo stem cell tracing.
173
The hESC line NERCe002-A-2 was generated from the NERCe002-A cell line (Lin et al., 2009) listed in the Human Pluripotent Stem Cell Registry (hPSCreg, https://hpscreg.eu/cell-line/NERCe002-A-2), by transduction with an expression vector carrying the luciferase gene. A stable hESC line was generated after selection with puromycin and
Fig. 1.
174
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
single colonies for a period of 4 weeks. The NERCe002-A-2 cells have pluripotent cell morphology (Fig. 1A). Furthermore, luciferase activity could be detected after induction of the cells to differentiate directly into definitive endoderm (DE) and neural precursor cells (NPC; Fig. 1B), as demonstrated by flow cytometry (Fig. S1A) and immunocytochemistry (Fig. S1B), respectively. The differentiation protocol was conducted as previously described (Xie et al., 2014). Luciferase expression was measured by quantitative PCR (qPCR; Fig. 1B). NERCe002-A-2 cells were found to express pluripotency-related genes, such as POU5F1, SOX2, NANOG, KLF4, TERF1, and THY1 (Fig. 1C). Karyotype analysis indicated that the NERCe002-A-2 cells, analysed at passage 28 + 7, have a normal karyotype of 46, XY (Fig. 1D). NERCe002-A-2 cells tested positive for pluripotency markers, such as OCT4, NANOG, TRA-1-60, and TRA-1-81, as well as alkaline phosphatase (Fig. 1E). We next determined the purity of the cell line by DNA fingerprinting, which showed short tandem repeat (STR) patterns (of the NERCe002-A-2 cells) identical to those of their parental NERCe002-A cells (Data available with the authors). Mycoplasma testing indicated the absence of mycoplasma contamination (Table S1). NERCe002-A-2 cells were capable of differentiating into all 3 germ layers in vivo, and bright luminescent light was emitted in the presence of luciferin by BLI in vivo (Fig. 1F and G, Table 1). Materials and methods Cell culture NERCe002-A cells were cultured in serum-free DFSR medium containing DMEM/F12 supplemented with 15% knockout serum replacement, 0.1 mM β-mercaptoethanol, 1% nonessential amino acids, 2 mM L-glutamine, and 4 ng/mL human recombinant basic fibroblast growth factor (bFGF) (all from Invitrogen, Carlsbad, CA, USA). The cells were grown at 5% CO2 and 95% saturated humidity and then routinely passaged on fresh mitomycin-treated mouse embryonic fibroblasts (MEFs) approximately every 7 days.
Transduction of NERCe002-A cells and establishment of the NERCe002-A-2 cell line A DNA fragment encoding the luciferase reporter gene was cloned into the pLEX_307 plasmid (Addgene, Cambridge, MA, USA; plasmid #
41392) to obtain the final expression vector, which was used to produce a lentivirus carrying the luciferase gene. Lentivirus particles were generated in 293T cells by the addition of pCMV-8.91 and pMD2 VSV-G. Three plasmids were co-transfected by means of liposomes (Lipofectamine™ 2000; Invitrogen, Carlsbad, CA, USA). After 48 h of incubation, the lentiviral particles were harvested, and the medium containing the lentivirus was passed through a 0.45-μm filter, collected, and stored at −80 °C. The viral supernatant was added to the cells along with 8 μg/mL polybrene. The medium was replaced with fresh medium containing 2 μg/mL puromycin after 24 h. A stable embryonic stem cell line expressing luciferase was selected with puromycin, and single colonies were picked for 4 weeks. DE and NPC differentiation assays Briefly, for DE differentiation, NERCe002-A-2 cells were passaged on Matrigel and cultured in an MEF-conditioned medium until a confluence of 50–70% was reached. The cells were cultured in RPMI 1640 supplemented with 100 ng/mL activin A and 25 ng/mL Wnt3a for 3 days. For NPC differentiation, the NERCe002-A-2 colonies were mechanically dissociated into small clumps and cultured as aggregates in suspension. The cells were cultured in DFSR medium without bFGF, supplemented with 1 μM dorsomorphin (Stemgent, Cambridge, MA, USA) and 5 μM SB431542 (Stemgent, Cambridge, MA, USA) for 4 days, and this medium was replaced with DMEM/F12 supplemented with 1 × N-2 (GIBCO BRL, Grand Island, NY, USA) and 10 ng/mL bFGF for subsequent cultivation for 6 days. Luciferase gene expression and activity Luciferase gene expression was quantitated by qPCR assays, which were conducted on a Roche Light Cycler system (Roche Diagnostics, Mannheim, Germany) with the SYBR Green I dye. The amplification conditions included an initial denaturation step at 95 °C for 5 min, followed by 50 cycles of 95 °C for 15 s, 56 °C for 15 s, and 72 °C for 15 s. At the end of each run, the threshold cycle (CT) values were analysed using the LightCycler software. The relative fold expression of the gene was calculated by the 2−ΔΔCt method with 28S RNA as the internal control. NERCe002-A-2 cells were seeded at a density of 105/well in a 96well plate to detect the luciferase activity by the addition of luciferin
Table 1 Characterization and validation of NERCe002-A-2 cells. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis: Immunocytochemistry Quantitative analysis: qPCR Karyotype (G-banding) and resolution STR analysis
Normal Expression of pluripotency markers: Oct4, Nanog, TRA-1-60, and TRA-1-81
Fig. 1 panel A Fig. 1 panel E
Expression of Luciferase: NERCe002-A-2 N NERCe002-A
Fig. 1 panel B
46 XY, Resolution 500 (10 Mb)
Fig. 1 panel D
Genotype
Microbiology and virology Differentiation potential
Mycoplasma
Submitted in 20 STR loci and Amelogenin were tested and matched The tested loci: D3S1358, D1S1656, D6S1043, D13S317, PentaE, D16S539, D18S51, D2S1338, CSF1PO, archive with journal PentaD, TH01, vWA, D21S11, D7S820, D5S818, TPOX, D8S1179, D12S391, D19S433, FGA and Amel Mycoplasma testing by luminescence: Negative Table S1
Teratoma formation Directed differentiation
Proof of formation of 3 germ layers Definitive endoderm and ectoderm differentiation
Donor screening (OPTIONAL)
HIV 1 + 2, Hepatitis B, Hepatitis C
Negative
Genotype additional info (OPTIONAL)
Blood group genotyping
O
HLA tissue typing
HLA typed class I and class II
Identity
Fig. 1 panel G Fig. S1 panel A and panel B Not shown but available upon request Not shown but available upon request Not shown but available upon request
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
(Promega, Madison, WI, USA) as a substrate at a final concentration of 0.15 mg/mL according to the manufacturer's instructions. After the addition of luciferin, the fluorescence activity was read on a luminometer (Berthold, Pforzheim, Germany).
175
an epifluorescence microscope (Nikon Eclipse TE2000-U, Tokyo, Japan). The antibodies are listed in Table 2.
In vivo differentiation RT-PCR Total RNA was extracted with the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) by standard procedures, and complementary DNA (cDNA) was synthesised using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany). The thermal cycling conditions were as follows: initial denaturation at 95 °C for 2 min, followed by 35 cycles of amplification (95 °C for 30 s, 54–64 °C for 30 s, and 72 °C for 30 s) and a final extension at 72 °C for 5 min. The PCR products were separated on a 1.5% agarose gel by electrophoresis and visualised on a UV transilluminator. Primer pairs are shown in Table 2. Karyotype analysis This analysis of NERCe002-A-2 cells was performed 7 passages after lentiviral transduction, which was conducted at passage 28 (P28+7). The cells were cultured on Matrigel (BD, San Jose, CA, USA) with mTeSR™1 medium (StemCell Technologies, Vancouver, BC, Canada) for 3–5 days, and then treated with a 0.1 μg/mL KaryoMAX® Colcemid™ solution (Life Technologies, Gaithersburg, MD, USA) for 3 h. After 3 washes with PBS, single cells were prepared with Accutase (Merck Millipore, Billerica, MA, USA) and used for standard G-banding karyotype analysis, the resolution of the karyotype was 10 Mb. Immunocytochemistry and alkaline phosphatase staining NERCe002-A-2 cells were fixed in 4% paraformaldehyde for 20 min and permeabilised with 0.2% Triton X-100. After 10 min, the samples were blocked with 10% donkey serum in PBS for 30 min at room temperature. After that, the cells were incubated with primary antibodies overnight at 4 °C. After the removal of the unbound antibody, the cells were washed thrice with PBS and exposed to secondary antibodies for 1 h in the dark. The nuclei were counterstained with 4′, 6-diamidino2-phenylindole (DAPI; 1:1000, Sigma-Aldrich, St. Louis, MO, USA). Besides, the BCIP/NBT Kit (Invitrogen, Carlsbad, CA, USA) was applied to detect the alkaline phosphatase activity. Images were acquired using
NERCe002-A-2 cells (106) were resuspended in Matrigel and injected intramuscularly into the hind limbs of 7-week-old mice with severe combined immunodeficiency. The mice were subjected to BLI 10 weeks post injection to detect their luciferase activity, then euthanized to harvest the teratomas. Haematoxylin and eosin (H&E) staining was carried out for histological analysis.
BLI For luciferase imaging, mice should be injected intraperitoneally with luciferin (150 μg/g mouse) 10 min before imaging is to begin. Mice were placed in the isoflurane induction chamber 5 min before imaging, then transferred to the IVIS imaging chamber after they were fully anesthetized. BLI was obtained using the IVIS® Lumina II (PerkinElmer, Waltham, MA, USA) and analysed using IVIS Living Image® software packages. The signal intensity was quantified as photons flux in units of photons/s/cm2/sr in the region of interest.
Flow cytometric analysis NERCe002-A-2 cells were enzymatically dissociated into single cells by the addition of trypsin and fixed in 4% paraformaldehyde for 30 min at room temperature. The cells were permeabilised in 0.1% Triton X-100 for 30 min and blocked with 5% donkey serum for 1 h. Next, the cells were incubated overnight with a goat anti-SOX17 antibody (1:40, R&D Systems, Minneapolis, MN, USA) at 4 °C. The following morning, the cells were washed thrice and incubated with an Alexa Fluor® 647–conjugated donkey anti-goat IgG antibody (1:1000, Invitrogen, Carlsbad, CA, USA) in the dark for 1 h. Finally, the cells were washed thrice and resuspended in fluorescence-activated cell sorting (FACS) buffer (0.1% BSA diluted in PBS with the addition of 0.1% of NaN3) for flow cytometry data acquisition, which was carried out on an Accuri C6 flow cytometer (BD Biosciences, San Jose, CA, USA), and the relevant software was used for analysis.
Table 2 Details of reagents. Antibodies used for immunocytochemistry or flow cytometry
Pluripotency marker Pluripotency marker Pluripotency marker Pluripotency marker Differentiation marker Secondary antibody Secondary antibody Secondary antibody
Antibody
Dilution
Company Cat. # and RRID
Mouse anti-OCT4 Rabbit anti-NANOG Mouse anti-TRA-1-60 Mouse anti-TRA-1-81 Goat anti-SOX17 Alexa Fluor® 647 donkey anti-goat IgG antibody Alexa Fluor® 488 donkey anti-mouse IgG antibody Alexa Fluor® 488 donkey anti-rabbit IgG antibody
1:400 1:100 1:50 1:50 1:40 1:1000 1:1000 1:1000
Santa Cruz Biotechnology, cat. # SC-5279, RRID: AB_628051 Abcam, cat. # ab21624, RRID: AB_446437 Millipore, cat. # MAB4360, RRID: AB_2119183 Millipore, cat. # MAB4381, RRID: AB_177638 R&D, cat. # AF1924, RRID: AB_355060 Invitrogen, cat. # A-21447, RRID: AB_2535864 Life Technologies, cat. # A-21202, RRID: AB_141607 Life Technologies, cat. # A-21206, RRID: AB_2535792
Primers
Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Housekeeping gene (RT-PCR) Housekeeping gene (qPCR) Targeted gene (qPCR)
Target
Forward/reverse primer (5′-3′)
NANOG POU5F1 SOX2 TERF1 THY1 KLF4 β-ACTIN 28S RNA Luciferase
TGAACCTCAGCTACAAACAG/TGGTGGTAGGAAGAGTAAAG AGCGAACCAGTATCGAGAAC/TTACAGAACCACACTCGGAC AGCTACAGCATGATGCAGGA/GGTCATGGAGTTGTACTGCA GCAACAGCGCAGAGGCTATTATT/AGGGCTGATTCCAAGGGTGTAA AGAATACCAGCAGTTCACCCATCC/CCTCACACTTGACCAGTTTGTCTCTG GCCGCTCCATTACCAAGAGC/GGTGTGCCTTGAGATGGGAA TCCCTGGAGAAGAGCTACGA/AGCACTGTGTTGGCGTACAG GAACTTTGAAGGCCGAAGTG/ATCTGAACCCGACTCCCTTT ACTGGGACGAAGACGAACAC/GGCGACGTAATCCACGATCT
176
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
DNA fingerprinting analysis NERCe002-A-2 cells were transferred to Matrigel-plated dishes and passaged by mechanical disruption for DNA fingerprinting analysis. Total genomic DNA was isolated from undifferentiated hESCs using the QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany). Then, 20 STR loci and Amelogenin were amplified on a PowerPlex® 21 system (Promega, Madison, USA) and detected with a 3130XL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Mycoplasma testing The culture supernatant of the adherent cells prior to passaging was collected for mycoplasma quantification using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, Basel, Switzerland). The test has been designed to yield ratios of less than 1 for uninfected samples but noticeably greater ratios than 1 for samples infected with mycoplasma. Conflict of interest The authors declare no conflict of interest. Acknowledgments This work was supported by grants from the National Basic Research Program of China (973 program 2012CB944901), the National Natural Science Foundation of China (81101510), the Natural Science
Foundation of Hunan Province (14JJ2004 and 2013FJ4015), the Fund from the Hunan Provincial Science and Technology Department (2014SK3066), the Teacher Research Fund of Central South University (2015JSJJ021), and Fundamental Research Funds for the Central Universities of Central South University (2016zzts483 and 2017zzts030). We thank the Genetic laboratory and IVF team of the Reproductive & Genetic Hospital of CITIC-Xiangya for their assistance. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.scr.2018.02.010. Reference Lin, G., Xie, Y., Ouyang, Q., Qian, X., Xie, P., Zhou, X., ... Lu, G., 2009. HLA-matching potential of an established human embryonic stem cell bank in China. Cell Stem Cell 5 (5): 461–465. https://doi.org/10.1016/j.stem.2009.10.009. Sadikot, R.T., Blackwell, T.S., 2005. Bioluminescence imaging. Proc. Am. Thorac. Soc. 2 (6): 537–540 511-532. https://doi.org/10.1513/pats.200507-067DS. Sudo, H., Tsuji, A.B., Sugyo, A., Takuwa, H., Masamoto, K., Tomita, Y., ... Saga, T., 2016. Establishment and evaluation of a new highly metastatic tumor cell line 5a-D-LucZsGreen expressing both luciferase and green fluorescent protein. Int. J. Oncol. 48 (2), 525–532. Xie, P., Sun, Y., Ouyang, Q., Hu, L., Tan, Y., Zhou, X., ... Lin, G., 2014. Physiological oxygen prevents frequent silencing of the DLK1-DIO3 cluster during human embryonic stem cells culture. Stem Cells 32 (2):391–401. https://doi.org/10.1002/stem.1558.
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Single Cell Line
Generation of a luciferase-expressing human embryonic stem cell line: NERCe002-A-2 Yingying Peng a, Menghan Xie a, Xingxiang Duan a, Liang Hu a,b,c, Juan Yu b, Sicong Zeng a,b, Yang Wang a, Qi Ouyang a,b,c, Guangxiu Lu b,c,d, Ge Lin a,b,c,d, Yi Sun a,b,c,⁎ a
Institute of Reproductive and Stem Cell Engineering, School of Basic Medical Science, Central South University, Changsha, China National Engineering and Research Center of Human Stem Cells, Changsha, China Key Laboratory of Stem Cells and Reproductive Engineering, Ministry of Health, Changsha, China d Reproductive & Genetic Hospital of CITIC-Xiangya, Changsha, China b c
a r t i c l e
i n f o
Article history: Received 24 December 2016 Received in revised form 30 January 2018 Accepted 11 February 2018 Available online 15 February 2018
a b s t r a c t The human embryonic stem cell line NERCe002-A-2 was generated by transduction of NERCe002-A cells with an expression vector carrying the luciferase gene. The stem cells labelled with luciferase can be transplanted into animals and detected by the bioluminescence imaging technology. This provides optimal prospects of application to in vivo stem cell tracing. Luciferin served as a substrate to detect the activity of luciferase, and luciferase expression was measured by quantitative PCR. Characterization assays suggested that the NERCe002-A-2 cell line expresses typical markers of pluripotency and can form the 3 germ layers in vivo. © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Resource table.
(continued)
Unique stem cell line identifier
NERCe002-A-2
Alternative name(s) of stem cell line Institution
chHES-90-PLEX-Luciferase
Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic modification Type of modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive
National Engineering and Research Center of Human Stem Cells, Changsha, China Yi Sun, [email protected] ESC Human Age: N/A Sex: male Ethnicity: Chinese In vitro fertilization–derived embryo Clonal N/A Yes Transgene expression N/A N/A Lentivirus Luciferase Constitutive
⁎ Corresponding author at: Institute of Reproductive and Stem Cell Engineering, School of Basic Medical Science, Central South University, Changsha, China. E-mail address: [email protected] (Y. Sun).
Unique stem cell line identifier
NERCe002-A-2
system Date archived/stock 10 May 2016 date Cell line repository/bank N/A Ethical approval The study was approved by the ethical committee of the Reproductive and Genetic Hospital of CITIC-Xiangya (Approval number: 2001–01).
Resource utility The cell line NERCe002-A-2 was generated from the normal human embryonic stem cell (hESC) line NERCe002-A. This established cell line stably expresses a luciferase marker and can be transplanted into animals. Subsequently, the transplanted cells can be detected by the bioluminescence imaging (BLI) technology. Thus, it may be used for in vivo stem cell tracing. Resource details BLI is based on the sensitive detection of visible light produced during enzyme (luciferase)-mediated oxidation of a molecular substrate when the enzyme is expressed in vivo as a molecular reporter (Sadikot and Blackwell, 2005). Relative to the parent cells, the cell line expressing luciferase has the potential to be a more powerful tool for the elucidation of tumour metastasis mechanisms, such as the detection of
https://doi.org/10.1016/j.scr.2018.02.010 1873-5061/© 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
metastatic sites and of tumour cell growth (Sudo et al., 2016). In this study, we established a novel hESC line labelled with luciferase; these cells can be transplanted into animals and detected by the BLI technology. This implies optimal prospects of application to in vivo stem cell tracing.
173
The hESC line NERCe002-A-2 was generated from the NERCe002-A cell line (Lin et al., 2009) listed in the Human Pluripotent Stem Cell Registry (hPSCreg, https://hpscreg.eu/cell-line/NERCe002-A-2), by transduction with an expression vector carrying the luciferase gene. A stable hESC line was generated after selection with puromycin and
Fig. 1.
174
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
single colonies for a period of 4 weeks. The NERCe002-A-2 cells have pluripotent cell morphology (Fig. 1A). Furthermore, luciferase activity could be detected after induction of the cells to differentiate directly into definitive endoderm (DE) and neural precursor cells (NPC; Fig. 1B), as demonstrated by flow cytometry (Fig. S1A) and immunocytochemistry (Fig. S1B), respectively. The differentiation protocol was conducted as previously described (Xie et al., 2014). Luciferase expression was measured by quantitative PCR (qPCR; Fig. 1B). NERCe002-A-2 cells were found to express pluripotency-related genes, such as POU5F1, SOX2, NANOG, KLF4, TERF1, and THY1 (Fig. 1C). Karyotype analysis indicated that the NERCe002-A-2 cells, analysed at passage 28 + 7, have a normal karyotype of 46, XY (Fig. 1D). NERCe002-A-2 cells tested positive for pluripotency markers, such as OCT4, NANOG, TRA-1-60, and TRA-1-81, as well as alkaline phosphatase (Fig. 1E). We next determined the purity of the cell line by DNA fingerprinting, which showed short tandem repeat (STR) patterns (of the NERCe002-A-2 cells) identical to those of their parental NERCe002-A cells (Data available with the authors). Mycoplasma testing indicated the absence of mycoplasma contamination (Table S1). NERCe002-A-2 cells were capable of differentiating into all 3 germ layers in vivo, and bright luminescent light was emitted in the presence of luciferin by BLI in vivo (Fig. 1F and G, Table 1). Materials and methods Cell culture NERCe002-A cells were cultured in serum-free DFSR medium containing DMEM/F12 supplemented with 15% knockout serum replacement, 0.1 mM β-mercaptoethanol, 1% nonessential amino acids, 2 mM L-glutamine, and 4 ng/mL human recombinant basic fibroblast growth factor (bFGF) (all from Invitrogen, Carlsbad, CA, USA). The cells were grown at 5% CO2 and 95% saturated humidity and then routinely passaged on fresh mitomycin-treated mouse embryonic fibroblasts (MEFs) approximately every 7 days.
Transduction of NERCe002-A cells and establishment of the NERCe002-A-2 cell line A DNA fragment encoding the luciferase reporter gene was cloned into the pLEX_307 plasmid (Addgene, Cambridge, MA, USA; plasmid #
41392) to obtain the final expression vector, which was used to produce a lentivirus carrying the luciferase gene. Lentivirus particles were generated in 293T cells by the addition of pCMV-8.91 and pMD2 VSV-G. Three plasmids were co-transfected by means of liposomes (Lipofectamine™ 2000; Invitrogen, Carlsbad, CA, USA). After 48 h of incubation, the lentiviral particles were harvested, and the medium containing the lentivirus was passed through a 0.45-μm filter, collected, and stored at −80 °C. The viral supernatant was added to the cells along with 8 μg/mL polybrene. The medium was replaced with fresh medium containing 2 μg/mL puromycin after 24 h. A stable embryonic stem cell line expressing luciferase was selected with puromycin, and single colonies were picked for 4 weeks. DE and NPC differentiation assays Briefly, for DE differentiation, NERCe002-A-2 cells were passaged on Matrigel and cultured in an MEF-conditioned medium until a confluence of 50–70% was reached. The cells were cultured in RPMI 1640 supplemented with 100 ng/mL activin A and 25 ng/mL Wnt3a for 3 days. For NPC differentiation, the NERCe002-A-2 colonies were mechanically dissociated into small clumps and cultured as aggregates in suspension. The cells were cultured in DFSR medium without bFGF, supplemented with 1 μM dorsomorphin (Stemgent, Cambridge, MA, USA) and 5 μM SB431542 (Stemgent, Cambridge, MA, USA) for 4 days, and this medium was replaced with DMEM/F12 supplemented with 1 × N-2 (GIBCO BRL, Grand Island, NY, USA) and 10 ng/mL bFGF for subsequent cultivation for 6 days. Luciferase gene expression and activity Luciferase gene expression was quantitated by qPCR assays, which were conducted on a Roche Light Cycler system (Roche Diagnostics, Mannheim, Germany) with the SYBR Green I dye. The amplification conditions included an initial denaturation step at 95 °C for 5 min, followed by 50 cycles of 95 °C for 15 s, 56 °C for 15 s, and 72 °C for 15 s. At the end of each run, the threshold cycle (CT) values were analysed using the LightCycler software. The relative fold expression of the gene was calculated by the 2−ΔΔCt method with 28S RNA as the internal control. NERCe002-A-2 cells were seeded at a density of 105/well in a 96well plate to detect the luciferase activity by the addition of luciferin
Table 1 Characterization and validation of NERCe002-A-2 cells. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis: Immunocytochemistry Quantitative analysis: qPCR Karyotype (G-banding) and resolution STR analysis
Normal Expression of pluripotency markers: Oct4, Nanog, TRA-1-60, and TRA-1-81
Fig. 1 panel A Fig. 1 panel E
Expression of Luciferase: NERCe002-A-2 N NERCe002-A
Fig. 1 panel B
46 XY, Resolution 500 (10 Mb)
Fig. 1 panel D
Genotype
Microbiology and virology Differentiation potential
Mycoplasma
Submitted in 20 STR loci and Amelogenin were tested and matched The tested loci: D3S1358, D1S1656, D6S1043, D13S317, PentaE, D16S539, D18S51, D2S1338, CSF1PO, archive with journal PentaD, TH01, vWA, D21S11, D7S820, D5S818, TPOX, D8S1179, D12S391, D19S433, FGA and Amel Mycoplasma testing by luminescence: Negative Table S1
Teratoma formation Directed differentiation
Proof of formation of 3 germ layers Definitive endoderm and ectoderm differentiation
Donor screening (OPTIONAL)
HIV 1 + 2, Hepatitis B, Hepatitis C
Negative
Genotype additional info (OPTIONAL)
Blood group genotyping
O
HLA tissue typing
HLA typed class I and class II
Identity
Fig. 1 panel G Fig. S1 panel A and panel B Not shown but available upon request Not shown but available upon request Not shown but available upon request
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
(Promega, Madison, WI, USA) as a substrate at a final concentration of 0.15 mg/mL according to the manufacturer's instructions. After the addition of luciferin, the fluorescence activity was read on a luminometer (Berthold, Pforzheim, Germany).
175
an epifluorescence microscope (Nikon Eclipse TE2000-U, Tokyo, Japan). The antibodies are listed in Table 2.
In vivo differentiation RT-PCR Total RNA was extracted with the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) by standard procedures, and complementary DNA (cDNA) was synthesised using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany). The thermal cycling conditions were as follows: initial denaturation at 95 °C for 2 min, followed by 35 cycles of amplification (95 °C for 30 s, 54–64 °C for 30 s, and 72 °C for 30 s) and a final extension at 72 °C for 5 min. The PCR products were separated on a 1.5% agarose gel by electrophoresis and visualised on a UV transilluminator. Primer pairs are shown in Table 2. Karyotype analysis This analysis of NERCe002-A-2 cells was performed 7 passages after lentiviral transduction, which was conducted at passage 28 (P28+7). The cells were cultured on Matrigel (BD, San Jose, CA, USA) with mTeSR™1 medium (StemCell Technologies, Vancouver, BC, Canada) for 3–5 days, and then treated with a 0.1 μg/mL KaryoMAX® Colcemid™ solution (Life Technologies, Gaithersburg, MD, USA) for 3 h. After 3 washes with PBS, single cells were prepared with Accutase (Merck Millipore, Billerica, MA, USA) and used for standard G-banding karyotype analysis, the resolution of the karyotype was 10 Mb. Immunocytochemistry and alkaline phosphatase staining NERCe002-A-2 cells were fixed in 4% paraformaldehyde for 20 min and permeabilised with 0.2% Triton X-100. After 10 min, the samples were blocked with 10% donkey serum in PBS for 30 min at room temperature. After that, the cells were incubated with primary antibodies overnight at 4 °C. After the removal of the unbound antibody, the cells were washed thrice with PBS and exposed to secondary antibodies for 1 h in the dark. The nuclei were counterstained with 4′, 6-diamidino2-phenylindole (DAPI; 1:1000, Sigma-Aldrich, St. Louis, MO, USA). Besides, the BCIP/NBT Kit (Invitrogen, Carlsbad, CA, USA) was applied to detect the alkaline phosphatase activity. Images were acquired using
NERCe002-A-2 cells (106) were resuspended in Matrigel and injected intramuscularly into the hind limbs of 7-week-old mice with severe combined immunodeficiency. The mice were subjected to BLI 10 weeks post injection to detect their luciferase activity, then euthanized to harvest the teratomas. Haematoxylin and eosin (H&E) staining was carried out for histological analysis.
BLI For luciferase imaging, mice should be injected intraperitoneally with luciferin (150 μg/g mouse) 10 min before imaging is to begin. Mice were placed in the isoflurane induction chamber 5 min before imaging, then transferred to the IVIS imaging chamber after they were fully anesthetized. BLI was obtained using the IVIS® Lumina II (PerkinElmer, Waltham, MA, USA) and analysed using IVIS Living Image® software packages. The signal intensity was quantified as photons flux in units of photons/s/cm2/sr in the region of interest.
Flow cytometric analysis NERCe002-A-2 cells were enzymatically dissociated into single cells by the addition of trypsin and fixed in 4% paraformaldehyde for 30 min at room temperature. The cells were permeabilised in 0.1% Triton X-100 for 30 min and blocked with 5% donkey serum for 1 h. Next, the cells were incubated overnight with a goat anti-SOX17 antibody (1:40, R&D Systems, Minneapolis, MN, USA) at 4 °C. The following morning, the cells were washed thrice and incubated with an Alexa Fluor® 647–conjugated donkey anti-goat IgG antibody (1:1000, Invitrogen, Carlsbad, CA, USA) in the dark for 1 h. Finally, the cells were washed thrice and resuspended in fluorescence-activated cell sorting (FACS) buffer (0.1% BSA diluted in PBS with the addition of 0.1% of NaN3) for flow cytometry data acquisition, which was carried out on an Accuri C6 flow cytometer (BD Biosciences, San Jose, CA, USA), and the relevant software was used for analysis.
Table 2 Details of reagents. Antibodies used for immunocytochemistry or flow cytometry
Pluripotency marker Pluripotency marker Pluripotency marker Pluripotency marker Differentiation marker Secondary antibody Secondary antibody Secondary antibody
Antibody
Dilution
Company Cat. # and RRID
Mouse anti-OCT4 Rabbit anti-NANOG Mouse anti-TRA-1-60 Mouse anti-TRA-1-81 Goat anti-SOX17 Alexa Fluor® 647 donkey anti-goat IgG antibody Alexa Fluor® 488 donkey anti-mouse IgG antibody Alexa Fluor® 488 donkey anti-rabbit IgG antibody
1:400 1:100 1:50 1:50 1:40 1:1000 1:1000 1:1000
Santa Cruz Biotechnology, cat. # SC-5279, RRID: AB_628051 Abcam, cat. # ab21624, RRID: AB_446437 Millipore, cat. # MAB4360, RRID: AB_2119183 Millipore, cat. # MAB4381, RRID: AB_177638 R&D, cat. # AF1924, RRID: AB_355060 Invitrogen, cat. # A-21447, RRID: AB_2535864 Life Technologies, cat. # A-21202, RRID: AB_141607 Life Technologies, cat. # A-21206, RRID: AB_2535792
Primers
Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Pluripotency marker (RT-PCR) Housekeeping gene (RT-PCR) Housekeeping gene (qPCR) Targeted gene (qPCR)
Target
Forward/reverse primer (5′-3′)
NANOG POU5F1 SOX2 TERF1 THY1 KLF4 β-ACTIN 28S RNA Luciferase
TGAACCTCAGCTACAAACAG/TGGTGGTAGGAAGAGTAAAG AGCGAACCAGTATCGAGAAC/TTACAGAACCACACTCGGAC AGCTACAGCATGATGCAGGA/GGTCATGGAGTTGTACTGCA GCAACAGCGCAGAGGCTATTATT/AGGGCTGATTCCAAGGGTGTAA AGAATACCAGCAGTTCACCCATCC/CCTCACACTTGACCAGTTTGTCTCTG GCCGCTCCATTACCAAGAGC/GGTGTGCCTTGAGATGGGAA TCCCTGGAGAAGAGCTACGA/AGCACTGTGTTGGCGTACAG GAACTTTGAAGGCCGAAGTG/ATCTGAACCCGACTCCCTTT ACTGGGACGAAGACGAACAC/GGCGACGTAATCCACGATCT
176
Y. Peng et al. / Stem Cell Research 28 (2018) 172–176
DNA fingerprinting analysis NERCe002-A-2 cells were transferred to Matrigel-plated dishes and passaged by mechanical disruption for DNA fingerprinting analysis. Total genomic DNA was isolated from undifferentiated hESCs using the QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany). Then, 20 STR loci and Amelogenin were amplified on a PowerPlex® 21 system (Promega, Madison, USA) and detected with a 3130XL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Mycoplasma testing The culture supernatant of the adherent cells prior to passaging was collected for mycoplasma quantification using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, Basel, Switzerland). The test has been designed to yield ratios of less than 1 for uninfected samples but noticeably greater ratios than 1 for samples infected with mycoplasma. Conflict of interest The authors declare no conflict of interest. Acknowledgments This work was supported by grants from the National Basic Research Program of China (973 program 2012CB944901), the National Natural Science Foundation of China (81101510), the Natural Science
Foundation of Hunan Province (14JJ2004 and 2013FJ4015), the Fund from the Hunan Provincial Science and Technology Department (2014SK3066), the Teacher Research Fund of Central South University (2015JSJJ021), and Fundamental Research Funds for the Central Universities of Central South University (2016zzts483 and 2017zzts030). We thank the Genetic laboratory and IVF team of the Reproductive & Genetic Hospital of CITIC-Xiangya for their assistance. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.scr.2018.02.010. Reference Lin, G., Xie, Y., Ouyang, Q., Qian, X., Xie, P., Zhou, X., ... Lu, G., 2009. HLA-matching potential of an established human embryonic stem cell bank in China. Cell Stem Cell 5 (5): 461–465. https://doi.org/10.1016/j.stem.2009.10.009. Sadikot, R.T., Blackwell, T.S., 2005. Bioluminescence imaging. Proc. Am. Thorac. Soc. 2 (6): 537–540 511-532. https://doi.org/10.1513/pats.200507-067DS. Sudo, H., Tsuji, A.B., Sugyo, A., Takuwa, H., Masamoto, K., Tomita, Y., ... Saga, T., 2016. Establishment and evaluation of a new highly metastatic tumor cell line 5a-D-LucZsGreen expressing both luciferase and green fluorescent protein. Int. J. Oncol. 48 (2), 525–532. Xie, P., Sun, Y., Ouyang, Q., Hu, L., Tan, Y., Zhou, X., ... Lin, G., 2014. Physiological oxygen prevents frequent silencing of the DLK1-DIO3 cluster during human embryonic stem cells culture. Stem Cells 32 (2):391–401. https://doi.org/10.1002/stem.1558.