Genetic manipulation of African swine fever virus: Construction of recombinant viruses expressing the β-galactosidase gene

VIROLOGY

188, 67-76

Genetic

(1992)

Manipulation

of African Swine Fever Virus: Construction Expressing the ,&Galactosidase Gene

JAVIER M. RODRIGUEZ, Centro

de Biologia

Molecular

FERNANDO

(C.S.I.C.-U.A. Received

ALMAZAN,

M), Facultad November

de Ciencias, 25,

ELADIO VItiUELA,’ Universidad

199 1; accepted

January

of Recombinant

AND

Aut6noma.

Viruses

JOSE F. RODRIGUEZ

Cantoblanco,

28049

Madrid,

Spain

13, 1992

Homologous recombination is shown to be specifically induced in Vero cells by infection with African swine fever (ASF) virus. The frequency of recombination induced by ASF virus infection between cotransfecting plasmids is comparable to that found after infection with the prototype poxvirus, vaccinia virus. The induction of recombination is accompanied by replication of the plasmid templates in the ASF virus-infected cells. An ASF virus insertion/expression plasmid vector containing the Escherichia co/i reporter gene fi-galactosidase (P-gal) fused to a viral promoter sequence was constructed. Recombination between homologous sequences present in both the plasmid vector and the virus genome led to the generation of recombinant viruses expressing the @-gal gene. Visual screening of P-gal’ plaques allowed the isolation and plaque purification of recombinant ASF viruses. The characterization of a P-gal+ virus isolate showed that the p-gal gene had been stably inserted into the thymidine kinase locus of the virus genome, thus demonstrating that controlled genetic manipulation of ASF virus can be achieved by homologous recombination in infected cells. 0 1992 Academic Press, Inc.

INTRODUCTION

fections (DeBoer, 1967) has hindered the progress toward the generation of an effective vaccine against this frequently lethal disease. The aim of the work described in this paper was to investigate the feasibility of genetically manipulating the genome of ASF virus. This is of importance because it would provide a new and powerful tool for studying a spectrum of biological aspects of the ASF virus life cycle. The large size of the viral genome and the fact that isolated virus DNA is noninfectious (ViAuela, 1987) make unfeasible the use of conventional in vitro systems to construct recombinant viruses. Thus, we decided to adapt the method routinely used for the genetic manipulation of other large DNA viruses (Post and Roizman, 1981; Panicali and Paoletti, 1982; Mackett et a/., 1982). This method exploits the homologous recombination that occurs within the infected cell during the process of viral replication to either insert or delete DNA sequences from the viral genome. Although some of the genetic variability observed in ASF virus had been attributed to homologous recombination between different regions of the viral genome (Blasco et a/., 1989; De la Vega et a/., 1990) specific information regarding this aspect of the ASF virus biology was not available. Therefore, before constructing vectors specifically designed for manipulating the viral genome through homologous recombination, it was necessary to establish whether this process occurs within the cytoplasm of ASF virus-infected cells.

African swine fever (ASF) virus is the causative agent of an economically important disease affecting domestic pigs and other members of the Suidae family. ASF virus also infects soft ticks from different species of the 0rnirhodoro.s genus, which can then act as vectors for the transmission of virus (for reviews, see ViRuela, 1985; Wilkinson, 1989). The ASF virus genome is formed by a single molecule of double-stranded DNA of approximately 170 kilobases (kb), with some structural features that closely resemble those found in poxviral genomes (reviewed by ViRuela, 1987). In the viral particle, the DNA molecule is associated with a number of proteins to form a nucleoid structure which is surrounded by a lipid envelope and an icosahedral capsid wrapped by an external envelope formed by lipoprotein (Carrascosa et a/., 1984). ASF virus replicates within the cytoplasm of the host cell, and the viral progeny is released by budding through the cell membrane. In the infected animal, the main targets of the virus are the cells of the mononuclear phagocytic system (Malmquist, 1963) and a small fraction of the polymorphonuclear leukocytes (Casal er al., 1984). The failure to detect neutralizing antibodies in serum samples from animals which either are persistently infected or have recovered from ASF virus in-

’ To whom

reprint

requests

should

be addressed. 67

0042-6822/92

$3.00

CopyrIght 0 1992 by Academic Press. Inc. All rIghis of reproduction I” any form reserved.

68

RODRiGUEZ

MATERIALS

AND METHODS

Cells and viruses Vero and CV-1 cells, obtained from the American Type Culture Collection, were routinely grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum. Vaccinia virus (VV) strain WR and ASF virus strain BA71V were propagated and titrated as described (Enjuanes eta/., 1976; Mackett eta/., 1985). Detection of ASF virus plaques expressing the @-galactosidase (P-gal) gene was performed 4 days after infection as described (Chakrabarti et al., 1985).

Transfection

of cell cultures

Transfections of Vero cells were carried out using a liposome-mediated transfection protocol (Felgner et a/., 1987) with the synthetic cationic lipid DOTMA (/V[l -(2,3-dioleyloxy)propyl-/V,N,/V,-trimethylammonium chloride) and the neutral lipid PtdEtn (dioleoyl-L-aphosphatidylethanolamine), following instructions recommended by the supplier (GIBCO BRVLife technologies, Gaithersburg, MD). Preconfluent monolayers of Vero cells grown in 30-mm plastic Petri dishes were transfected with 10 pg of plasmid DNA per dish, and cotransfections were performed with 5 pg of each plasmid. Carrier DNA was not added to the transfection mixtures. Eighteen hours after transfection, the cell cultures were washed three times with 5 ml of medium and then mock-infected or infected with either ASF virus or VV.

Purification

and analysis of DNA

Low molecular weight DNA from transfected cells was isolated as described (Hirt, 1967). Purification of viral DNA was carried out using a method similar to that described for the purification of DNA from VV inclusion bodies (Esposito et a/., 1981). Plasmids were propagated in the Escherichia co/i strain TGl (supE hsdA5 thi A (lac-proAB) F’[traD36 proAB+ laclq /acZAM 151) (Gibson, 1984). Purification of plasmid DNA, endonuclease restriction analysis, agarose gel electrophoresis, DNA cloning, polymerase chain reactions (PCR), Southern blotting, and preparation of radioactive probes were performed using standard protocols (Sambrook et al., 1989).

Plasmid

construction

The construction of pAP4 and pAP5 was carried out as outlined in Fig. 1. Briefly, the plasmid pKLluc, a pUC19 derivative containing the Photyrtuspyralis luciferase open reading frame (ORF), was either partially digested with EcoRl or digested with C/al and Accl. The relevant restriction products were purified from

ET AL.

agarose gels by electroelution using an unidirectional electroelution apparatus (International Biotechnologies Inc, New Haven, CT). Religation of the purified fragments generated plasmids pAP4 and pAP5, respectively. The construction of the insertion/expression vector plNS72@-gal (Fig. 4) involved several steps. A 1.8-kb EcoRIIDral fragment obtained from the plasmid p5RK (Ley et a/., 1984) was inserted into EcoRIISmal cut pUC1 19. The resulting plasmid pPJ1 was digested with either EcoRV and EcoRl or with BarnHI and Pstl to generate two fragments of 1.2 and 0.4 kb, respectively. The 1.2-kb EcoRVIEcoRI fragment was cloned into SmallEcoRI cut pUCll9 to generate the plasmid pTKI. To generate the plasmid pTKr, the 0.4-kb BamHIIPstl fragment was treated with Klenow to blunt the end generated by BarnHI restriction, and then cloned into pUC1 19 which had been digested with HindIll and Pstl and treated with Klenow enzyme to fill in the HindIll end. A 1.2-kb PstllEcoRI fragment obtained from pTK1 was purified and inserted into PstllEcoRI-digested pTKr to generate the plasmid PINS. A 248 base pairs (bp) DNA fragment containing the promoter sequence and the first eight codons of the ASF virus gene p72 (Lopez-Otin er al., 1990) was generated by PCR using the oligonucleotide primers 5’-CGCGAGATCTGGGTCGCCGGAGAAAAGTCAAAAGG-3’ and 5’-GCGCGGA TCCAGACAAAAAGCTCCTCCTGATGCCA-3’. The PCR product was digested with Bglll and BarnHI and then inserted into BarnHI linearized pUC1 19 to generate the plasmid pp72. Following digestion with BarnHI, this plasmid was ligated with a 3.2-kb BarnHI fragment containing the P-gal ORF lacking the first eight codons obtained from the plasmid pSC1 1 (Chakrabarti et al., 1985) to generate the plasmid pp72-@gal. A 3.4-kb SmallPstl fragment containing the P-gal gene fused to the p72 promoter was purified from pp72-pgal. This fragment was then cloned into HinclIIPstl-digested PINS to generate the insertion/expression vector plNS72-pgal. This plasmid contains the promoter and the first eight codons of the p72 gene fused in frame with the P-gal ORF flanked by the sequences of the ASF virus thymidine kinase (TK) gene (Blasco et al., 1990) (Fig. 4).

RESULTS Homologous ASF virus

recombination

in cells infected

with

To study the possible induction of recombination in cells infected with ASF virus, a strategy using DNA substrates with polymorphic restriction sites (plasmids pAP4 and pAP5) was used. This approach is similar to that successfully used to study genetic recombination

GENETIC

MANIPULATION

in other systems (Doherty et al., 1983; Shapiro et al., 1983; Evans et al., 1988). The plasmids pAP4 and pAP5 (Fig. 1A) were cotransfected into Vero cells, which were subsequently infected with either ASF virus or VV, a poxvirus known to induce high levels of homologous recombination in the cytoplasm of infected cells (Ball, 1987; Evans eta/., 1988). At different times postinfection, cell samples were harvested and the low molecular weight DNA was isolated. After digestion with BarnHI, the DNA was resolved by electrophoresis, transferred to nitrocellulose membranes, and then hybridized with a 32P-labeled probe corresponding to a 0.77-kb EcoRIIClal fragment obtained from the plasmid pKLluc (Fig. 1A). As shown in Fig. 1 B, recombination between the plasmid substrates can be determined by the generation of four DNAfragments of 6, 5, 2.8, and 1.8 kb after digestion with BarnHI. Hybridization with a 32P-labeled luciferase specific probe would reveal the presence of three bands, corresponding to the 6-, 5-, and 1.8-kb BamHl fragments, which can be considered as diagnostic products of recombination. Although this approach does not allow an accurate evaluation of the recombination frequency, an estimate of the relative level of recombination induced by ASF virus and VV in Vero cells can be estimated. The results obtained, Fig. 2, show that whereas recombination was not detected in samples from either mock-infected (Fig. 2, lanes l-4) or virus-infected cultures after 2 or 8 hr postinfection (Fig. 2, lanes 5, 6, 9, and lo), the expected recombination products were present in DNA samples from both the ASF and vaccinia virus-infected cells at 24 and 48 hr postinfection (Fig. 2, lanes 7, 8, 1 1, and 12). These results show that the infection of Vero cells with ASF virus leads to the induction of homologous recombination between the cotransfected plasmid DNAs, and that this recombination occurs with a frequency similar to or greater than that observed in VV-infected cells. This is important, as the frequency of intermolecular recombination is a critical factor governing the likely success of this approach to constructing recombinant viruses. In cells infected with a number of different poxviruses, replication of transfecting plasmids occurs. This process, which is carried out by the virus enzymatic machinery, does not require the presence of viral origins of replication within the plasmid DNA and results in the formation of high molecular weight head-to-tail concatemers (DeLange and McFadden, 1986). When undigested plasmid DNA samples obtained from cells infected with ASF virus were analyzed by gel electrophoresis followed by Southern blotting, a series of high molecular weight DNA bands closely resembling the

OF ASF

VIRUS

69

pattern obtained after infection with VV was observed (data not shown). This was an indication that plasmid replication was induced by infection with ASF virus. To obtain further information, the sensitivity of the plasmid DNA recovered from infected cells to restriction with Dpnl was assessed. The endonuclease activity of Dpnl is dependent upon methylation of the recognition site (GAmTC). Consequently, DNA obtained from dad E. co/i is sensitive to Dpnl restriction, whereas mammalian DNA is resistant to digestion with this enzyme (Peden et al., 1980). Therefore, Dpnl digestion of plasmid DNA isolated from ASF virus-infected cells would reveal the environment within which the DNA was synthesized and consequently show whether the transfecting plasmids were replicated within these cells. Plasmids pAP4 and pAP5 were cotransfected into Vero cells which were then infected with ASF virus as described earlier. DNA samples obtained from transfected cells at 48 hr postinfection were digested with either BarnHI, BamHl and Dpnl or with BamHl and Sau3A. Sau3A is an isoschizomer of Dpnl that digests both dam+ E. coliand mammalian DNA. The restriction fragments obtained were analyzed by gel electrophoresis followed by Southern blotting and hybridization with a 32P-labeled 1.8-kb probe corresponding to the insert of the plasmid pKLluc (Fig. 1A). As shown in Fig. 3A, the three restriction patterns obtained were clearly different The plasmid DNAs were completely digested with Sau3A (lane 3) whereas a significant fraction of the DNA remained undigested following incubation with Dpnl (lane 2). In particular, the 6-, 5-, and 1.8-kb BamHl fragments, produced by recombination between the plasmids pAP4 and pAP5, were resistant to Dpnl digestion. Consequently, it was concluded that plasmid replication does occur in ASF virus-infected cells and, in view of the resistance of the recombination products to Dpnl digestion, that recombination preferentially occurs between these newly replicated templates. To further characterize the recombination induced by ASF virus infection, the involvement of the virus DNA polymerase was investigated. Cell cultures, cotransfected with pAP4 and pAP5 and then infected with ASF virus, were maintained in the presence or absence of phosphonoacetic acid (PAA; 500 pg/ml), a specific inhibitor of the virus DNA polymerase (Moreno et a/., 1978). DNA isolated from cells harvested at 24 and 48 hr postinfection was analyzed as described above. Recombination products accumulated normally in the untreated cell cultures (Fig. 3B, lanes 1 and 3) but could not be detected in the PAA-treated cells (lanes 2 and 4) thus demonstrating that the inhibition of the DNA polymerase activity dramatically reduces the frequency of intermolecular recombination.

70

RODRIGUEZ ET AL.

A EB

E

CB

A

pKLluc 4.5 kb

EcoRl Ligase

CkizI/AccI Ligase

/ E

\ CB

A

EB

pAP4 3.8 kb

[UN

E

PAPS 4.0 kb

B i) Single crossover between vector sequences

BumHI

ii) Single crossover between insert sequences

restriction

BarnHI Fragment

Bi-.

&-Q--j

size

restriction Fragment

An;

5.0 Kb B

2.8 Kb

I “h-tlr”

6.0 Kb 1.8 Kb

size

GENETIC

MANIPULATION

The results of this series of experiments clearly show that both recombination and replication of transfected plasmids are induced by ASF virus infection of the host cell, that the recombination seems to occur between DNA templates replicated within the virus-infected cells, and that the recombination is dependent upon the presence of an active virus DNA polymerase. Design vector

of a (3-galactosidase

expression/insertion

The high frequency of recombination detected in ASF virus-infected cells was a good indication that a recombinant ASF virus could be generated by homologous recombination. To test this hypothesis an insertion vector, plNS72-pgal (Fig. 4), was constructed which contains the E. co/i/$gal gene under the control of an ASF virus promoter flanked by sequences of the ASF virus TK gene. The lack of a TK- Vero cell line along with the incapability of the BA 71 V strain of ASF virus, used as a model system in our laboratory, to form plaques in other TKcell lines prevents the use of methods based on the selection of recombinants viruses with a TK- phenotype. The expression of the P-gal was chosen as a method to identifying ASF virus recombinants because it is a simple and reliable method that is routinely used for the detection of VV recombinants. Because ASF virus genes are transcribed by the virus RNA polymerase (Kuznar et al., 1980), which is thought to recognize specific viral sequences, the P-gal gene was placed under the control of an ASF virus promoter. The promoter of a strongly expressed late viral gene, the p72 gene, was used. A 248-bp DNA fragment consisting of the sequence immediately upstream of the p72 gene and the first eight codons of the ORF was fused in frame to the @-gal coding sequence lacking the first eight codons (Fig. 4). Transient expression analysis carried out after transfection of the plasmid plNS72Pgal into ASF virus-infected cells indicated that the pgal chimeric gene was expressed at late times postinfection (to be published elsewhere). In plasmid plNS72-pgal the P-gal gene is flanked by sequences of the ASF virus TK gene. Consequently, if recombinant viruses are generated by homologous recombination, the P-gal gene should be inserted within the TK locus of the viral genome. This locus was cho-

OF ASF

VIRUS

71

sen as the insertion site since inactivation of the TK gene does not alter the replication efficiency of ASF virus in PK15 TK- cells (R. Yafiez, personal communication). It was therefore assumed to be unlikely that insertional inactivation of TK would be deleterious to the infectivity of the virus. Generation of a recombinant the P-galactosidase gene

ASF virus expressing

Subconfluent monolayers of Vero cells were transfected with the P-gal insertion/expression vector plNS72$gal. After 18 hr the transfected cells were infected with ASF virus at multiplicities of infection (m.o.i.) ranging from 0.01 to 10 and maintained until the virus-induced cytopathic effect (CPE) was considered complete. At this point the cell supernatants were harvested, the cell debris was removed by low speed centrifugation, and two series of dilutions from each sample were used to infect fresh monolayers. The first series was stained with neutral red to determine the total virus titer, while the second was incubated with 5-bromo-4-chloro-3-indolyl-@-o-galactopyranoside (Xgal), a chromogenic substrate of P-gal, to detect P-gal expression. Regardless of the initial m.o.i. used, ASF virus plaques expressing P-gal were detected in all samples (Table 1). Several ASF virus plaques expressing P-gal were picked and purified by sequential rounds of plaquepurification. After three rounds, one virus clone, v72pgal, was selected for further characterization. Plaques produced by v72P-gal developed an intense blue color after incubation in the presence of X-gal (Fig. 5). Both the growth rate and the plaque size phenotype of v72P-gal in Vero cells were similar to those of the wildtype virus (data not shown). DNA isolated from both wild-type and v72P-gal virus-infected cells was digested with either BamHl or EcoRl and analyzed by Southern blotting to establish whether the genomic structure of the P-gal’ isolate was as predicted (Fig. 6). For this, identically prepared nitrocellulose filters were hybridized with two different 32P-labeled probes: a 2.1kb ClallEcoRI fragment from within the P-gal gene and a 0.6-kb HindIIIIXhol fragment containing the TK gene obtained from the ASF virus EcoRl K fragment (Fig. 6). The results of these hybridizations are shown in Fig. 7. As expected, the P-gal probe did not hybridize to DNA

FIG. 1. (A) Strategy for the construction and structure of the plasmids pAP4 and pAP5 used for the analysis of intermolecular recombination in infected cells. The details of the constructrons are described under Materials and Methods. Plasmrd pAP4 was generated from pKLluc by deletion of a 0.6.kb EcoRl (E) fragment (m). Plasmid pAP5 was generated by deletrng a 0.4.kb C/al (C)lAccl (A) fragment (Cl) from pKLluc. Both plasmrds, pAP4 and pAP5, are based on pUCl9 and contarn inserts of 1.2 and 1.4 kb, respectrvely. (B) Schematic representation of single recombination events between pAP4 and pAP5. (I) A crossover event between vector sequences (-) results In the formation of a hybrid DNA molecule that upon restnction wrth BamHl will render two fragments of 5 and 2.8 kb, respectrvely. (II) A crossover event between homologous ) WIII generate a hybrid molecule that upon restriction wrth BamHl WIII release two fragments of 6 and 1 .8 kb, respectively.

72

RODRiGUEZ

Mock kb

1234

ASFV 5

6

7

vv 8

9

10 11 12

FIG. 2. Recombination between transfecting plasmid DNAs in Vero cells. Low molecular weight DNA was isolated from cell monolayers cotransfected with pAP4 and pAP5 and either mock-infected (lanes l-4) or infected with ASF virus (lanes 5-8) or VV (lanes 9-l 2). Then analysis by BarnHI restriction followed by Southern blot hybridization using a 3ZP-labeled probe corresponding to the 0.77.kb EcoRIIClal fragment obtained from pKLluc, which is present in the inserts of both pAP4 and pAP5 (see Fig. l), was carried out. Samples were collected at 2 (lanes 1, 5, and 9) 8 (lanes 2,6, and 1 O), 24 (lanes 3,7, and 11). and 48 (lanes 4, 8, and 12) hr postinfection, respectively. The positions of DNA molecular werght markers (kb) and the predicted recombination products (+) are indicated.

from the wild-type virus, but hybridized to bands of 4.5 and 3.1 kb from the v72P-gal DNA digested with either EcoRl (Fig. 7, lane 2) or BamHl (Fig. 7, lane 4), respectively. The TK probe hybridized with single bands of 4.8 and > 10 kb in the wild-type virus DNA digested with either fcoRI (lane 5) or BamHl (lane 7) respectively, whereas the same probe revealed two bands of 4.5 and 3.5 kb in the v72@-gal DNA digested with fcoRl (Fig. 7, lane 6), and two bands of >lO and 4.2 kb when the same DNA was digested with BarnHI (Fig. 7, lane 8). These results are consistent with the predicted genomic structure of the recombinant v72/3-gal virus (Fig. 5) and confirm that this virus was generated by homologous recombination between wild-type ASF virus and the plasmid plNS72-@gal DNA sequences.

DISCUSSION The results described in this paper constitute the first direct evidence that high levels of homologous recombination are elicited in cells infected with ASF virus. After cotransfection of Vero cells with two plasmids containing polymorphic restriction sites, specific hybrid DNA molecules formed by homologous intermolecular recombination were detected. This recombina-

ET AL

tion was specifically induced by the ASF virus infection and occurred at a level comparable to that detected in cells infected with VV. Recombination products were not detected in uninfected Vero cells. Although this result was surprising, similar results have been obtained with other eukaryotic cell lines (Evans et a/., 1988). Further experiments to investigate the apparent lack of recombination in the uninfected Vero cells were not conducted. However, it is possible that it resulted from the transfection method used. Liposome-mediated transfection, although efficient for delivering DNA to the cell cytoplasm, may not enable high levels of DNA to reach the nuclei of the transfected Vero cells. Inefficient nuclear delivery has previously been reported for liposome-mediated DNA transfection procedures in other cell systems (Felgner and Ringold, 1989). Plasmid DNAs transfected into the cytoplasm of poxvirus-infected cells are autonomously replicated by the virus enzymatic machinery (DeLange and McFadden, 1986; Merchlinsky and Moss, 1986). The resistance of a fraction of the plasmid DNA recovered from

B

A

kb

12

3

kb

123

4

x

i.

6S4-

f ai

FIG. 3. (A) Replication of transfecting plasmid DNAs in cells infected with ASF virus. DNA from pAP4/pAP5 cotransfected cells infected with ASFvirus was digested with BarnHI (lane l), BamHl and Dpnl (lane 2) and BarnHI and Sau3A. subjected to agarose gel electrophoresis and then blotted onto nitrocellulose paper. The filter was hybridized with a 3*P-labeled DNA fragment of 1.8.kb BarnHI fragment obtained from the plasmid pKLluc. (B) Effect of the inhibition of the ASF virus DNA polymerase activity on the frequency of recombination. DNA samples from pAP4/pAP5 cotransfected cells infected with ASF virus either untreated (lanes 1 and 3) or treated with PAA (lanes 2 and 4) obtained at 24 (lanes 1 and 2) and 48 (lanes 3 and 4) hr postinfection were analyzed as described in Fig. 2. The position of DNA molecular weight markers (kb) and that of the predicted recombination products (-) is indicated.

GENETIC

MANIPULATION

OF ASF

BamHl

P’2 nnnnnnnn

FIG. 4. Structure of the The P-gal ORF (-) lacking ). The genome. Amp’. ORI, and respectively

I

CATCAGGAGGAGCTTTTTGTfTG,pAT,

~72 PROM

TABLE

lnltial m.0.i. (PFWcell) 10 1 0.1 0.01 0 lb

MULTIPLICITYOF OFRECOMBINANT Total virus (PFU/ml) 3.2 3.6 4 2.1

B-gal gth codon n

--- >

insertion/expressron vector plNS72/3-gal. The construction of this plasmid is described under Materials the first eight codons is fused in frame with the sequence corresponding to the promoter and first eight of chimeric P-gal gene is flanked by TK (w) and neighboring sequences ( ) from the EcoRl K fragment Ml 3 IG indicate the location of the p-lactamase gene, the pUC ongin of replication, and the Ml 3 origin

cells infected with ASF virus to digestion with the restriction enzyme Dpnl (Fig. 3A) confirmed that plasmid replication was indeed taking place in the ASF virus-infected cells. In contrast, plasmid DNA recovered from uninfected cells was sensitive to digestion with the same enzyme (data not shown), indicating that plasmid replication was specifically induced by the virus infection. The resistance of the specific recombination prod-

EFFECTOFTHE

73

VIRUS

titer

x lo6 X lo6 x107 x 10' nd” 8.4 X lo6

1 INFECTION ONTHE GENERATION ASF VIRUSES P-gal virus titer (PFU/ml) 2.4 2.7 1.3 8.8

x x x x nd” nd”

lo3 lo3 lo4 lo3

Ratio @gal/total)

and Methods. codons of the the ASF virus of replication,

ucts to digestion with Qonl and the inhibition of the recombination caused by PAA show that, as it is the case in poxvirus-infected cells (Evans et al., 1988; Merchlinsky, 1989; Colinas et a/., 1990; Parks and Evans, 1991) recombination and replication of transfecting plasmids in cells infected by ASF virus are closely related processes. Although a more detailed analysis of recombination and plasmid replication in cells infected with ASF virus is required to gain a better understanding of these processes, the results described here strongly suggest that the effect of ASF virus infection is similar to that of poxviral infections. This is not surprising, in view of the

lo2

10

1

0.074 0.074 0.03 0.04

Note. Preconfluent Vero cell monolayers were transfected the insertion/expression vector plNS72-@gal and then infected ASF virus at different m.o.i. The titer of both total and P-gal+ produced in the different cultures was determined. a Average of three independent determinations. ’ Untransfected cell cultures. ’ Not detected,
with with virus

FIG. 5. Recombinant v72-@gal virus plaques stained with X-gal. Vero cell monolayers grown in 60.mm plastic Petri dishes were infected with the indicated number of PFU of the recombinant virus. Four days after Infection the P-gal’ plaques were visualized by staining with X-gal for 4 hr.

RODRiGUEZ ET AL

74

I

FKE’MCN II

TKI p72

B II

I I

B-gal

G

I

C’

I

OTN’

I II I

D

SPHRQQ’E

III

III1

I

I

D

I

TKr

1Kb

FIG. 6. Predicted genomic structure of the recombinant v72-pgal virus. Recombination between homologous sequences present in both the viral genome and the plasmid insertion/expression vector plNS72-pgal would lead to the insertion of the P-gal gene @I) fused to the virus ) into the TK locus (m) that is located within the EcoRl K fragment of the viral genome. The lettering in the upper part of the figure represents the location of the EcoRl restriction sites within the genome of the BA71V strain of ASF virus (Almendral et a/., 1984).

number of other properties common to both virus groups. Both ASF virus and poxviruses replicate in the cytoplasm of the host cell, their genomes are formed 1 kb

2

3

4

5

6

7

8

= ‘s” 6 5 4

-

3

-

2

-

1

-

FIG. 7. Genomic analysis of wild-type ASF and recombinant v72Pgal viruses, DNA purified from cells infected with either wild-type (lanes 1, 3, 5, and 7) or v72-@gal viruses (lanes 2, 4, 6, and 8) was digested with either EcoRl (lanes 1, 2, 5, and 6) orL?amHl (lanes 3, 4. 7, and 8) subjected to agarose gel electrophoresis and then blotted onto nitrocellulose paper. The filters were hybridized with either a 32P-labeled DNA fragment corresponding to the p-gal gene (lanes l-4) or a DNA fragment from the EcoRl K fragment of ASF virus genome (lanes 5-8).

by a single molecule of double-stranded DNA with similar structural features, i.e., the ends of the DNA molecule are covalently linked forming hairpin loop structures, they contain inverted terminal repetitions, ineluding telomeric sequences located at both ends of the DNA molecule (reviewed by ViAuela, 1987). Thus, it seems conceivable that both virus groups might have evolved similar replication and recombination strategies. The level of intermolecular recombination detected in cells infected with ASF virus was indicative that manipulation of the viral genome could be achieved by homologous recombination. To test this hypothesis, we constructed a plasmid vector, plNS72-@gal, designed for the insertion of foreign DNA sequences into the TK locus of the viral genome. Ideally, the resulting recombinant viruses would express the ,&gal, thus allowing for their visual detection in cell cultures. The virus progeny produced in Vero cell cultures transfected with plNS72/3-gal after infection with different m.o.i. of ASF virus contained a small fraction of infective particles expressing P-gal. Regardless of the m.o.i. used for the infection, the percentage of ,&gal expressing viruses was found to be approximately 0.05% of the total virus oroaenv, _ a value similar to that routinely detected when generating recombinant viruses from VV. This percentage was sufficiently high to allow the recovery of well-isolated virus ,&gal’ plaques. To obtain pure virus clones expressing the reporter

GENETIC

MANIPULATION

gene, a number of primary virus isolates were plaquepurified. The expression of the P-gal gene, tested after each passage, was consistently maintained in all clones studied (data not shown), suggesting that the P-gal gene was stably integrated within the TK locus of the genome of these isolates. This was confirmed by Southern blot hybridizations carried out on restriction digests of DNA isolated from cells infected with either wild-type or v72P-gal virus, a ,&gal+ isolate obtained after three consecutive rounds of plaque purification. The Southern blot analysis demonstrated that the recombinant virus had the predicted genomic structure, ruling out the possibility that the insertion of the P-gal gene had been generated as a result of a single crossover event. The results discussed above are the first report of controlled genetic manipulation of ASF virus and show that this can be achieved by homologous DNA recombination between sequences present in specifically designed plasmid vectors and the virus genome during the replicative cycle of the virus. All the experiments reported here have been performed using the Ba71V strain of ASF virus adapted to grow in Vero cells. The feasibility of generating recombinant ASF viruses from virulent strains growing in primary pig macrophage cultures is currently being studied. The application of genetic manipulation provides a new approach for studying different aspects of the virus life cycle. This will have a major impact on the understanding of a number of relevant aspects of ASF virus biology, including the mechanisms involved in virus gene expression and the role of specific genes during the virus replication cycle. Furthermore, this opens the possibility of specifically deleting genes involved in virulence, as well as that of introducing foreign genes with immunoregulatoty properties into the virus genome. These manipulations could be exploited for the generation of a recombinant vaccine against ASF virus.

ACKNOWLEDGMENTS We thank Antonio Varas for his skillful technical assistance and Katherine Law for the plasmid pKLluc and critical reading of this manuscript. This work was supported by grants from Comisi6n Interministerial de Ciencia y Tecnologia, Junta de Extremadura, European Economic Community, and by an institutional grant from Fundacibn Ram6n Areces. J.R. was a fellow from Fondo de lnvestigaciones Sanitarias. F.A. was a fellow from Ministerio de Educaci6n y Ciencia.

REFERENCES ALMENDRAL, J. M., BLASCO, R., LEY, V.. BELOSO, A., TALAVERA, A., and VI~QUELA, E. (1984). Restriction site map of African swine fever virus DNA. Virology 133, 258-270. AGOERO, M., BLASCO, R., WILKINSON, P.. and VIQUELA, E. (1990). Analy-

OF ASF

VIRUS

75

sis of naturally occurring deletion variants of African swine fever virus: Multigene family 1 10 is not essential for infectivity or virulence In pigs. \/iro/ogy 176, 195-204. BALL, L. A. (1987). High frequency homologous recombination In vaccinia virus DNA. J. Viral. 61, 1788-l 795. BLASCO, R., DE LAVEGA, I., ALM&N, F., AGOERO, M., and VI~~LJELA, E. (1989). Genetic variation of African swine fever virus: Variable regions near the end of the viral DNA. Virology 173, 251-257. BLASCO, R., LOPEZ-OT~N, C., Mutioz, M., BOCKAMP, E-O., SIMONMATEO, C., and VI~UELA, E. (1990). Sequence and evolutionary relationships of African swine fever virus thymidine kinase. Virology 178, 301-304. CARRASCOSA, J. L., CARAZO, J. M., CARRASCOSA, A. L., GARCIA, N., SANTISTEBAN, A., and WWELA, E. (1984). General morphology and capsid fine structure of African swine fevervirus particles. Virology 132, 160-172. CASAL, I., ENJUANES, L., and VI~~UELA, E. (1984). Synthesis of African swine fever (ASF) virus-specific antibodies in vitro in a porcine leukocyte system. /. Wol. 52, 37-46. CHAKFIABARTI. S., BRECHLING, K., and MOSS, B. (1985). Vaccinia virus expression vector: coexpression of P-galactosidase provides visual screening of recombinant virus plaques. n/lo/. Cell B/o/. 5, 3403-3409. COLINAS, R. J., CONDIT, R. C., and PAOLETTI, E. (1990). Extrachromosomal recombination in vaccinia-infected cells requires a functional DNA polymerase partlcipatlng at a level other than DNA replication. Virus Res. 18, 49-70. DEBOER, C. 1. (1967). Studies to determine neutralizing antibody in sera from animals recovered from African swine fever and laboratory animals inoculated with African swine fever virus with adjuvants. Arch. Gesamte Virusforch. 20, 164-l 79. DELANGE, A. L., and MCFADDEN, G. (1986). Sequence-nonspecific replication of transfected plasmid DNA in poxvirus-infected cells. Proc. AM. Acad. Sci. USA 83, 614-618. DE LA VEGA, I., VIF;IUELA, E., and BLASCO, R. (1990). Genetlc variation and multigene families in African swine fever virus. Virology 179, 234-246. DOHERPI. M. J., MORRISON, P. T., and KOLODNER, R. (1983). Genetic recombination of bacterlal plasmid DNA: Physical and genetic analysis of the products of plasmld recombination in E. co/i. f. Mol. Viol. 197, 359-360. ENJUANES, L., CARRASCOSA. A. L., MORENO, M. A., and VI~UELA, E. (1976). Titration of African swine fever virus (ASF) virus. J. Gen. Viral. 32, 47 l-477. ESPOSITO, J. J., CONDIT. R. C., and OBIJESKI, I. (1981). The preparation of orthopoxvirus DNA. J. Viral. Methods 2, 175-l 79. EVANS, D. H., STUART, D., and MCFADDEN, G. (1988). High levels of recombination among cotransfected plasmid DNAs in poxvirus-infected mammalian cells. /. Viral. 62, 367-375. FELGNER, P. L., GADEK, T. R., HOLM, M., ROMAN, R., CHAN, H. W., WENZ, M., NORTHROP, J. P., RINGOLD, G. M., and DANIELSEN, M. (1987). Lipofection: a highly efficient, lipid-medlated DNA-transfectlon procedure. Proc. Nat/. Acad. SC;. USA 84, 7413-7417. FELGNER, P. L., and RINGOLD, G. M. (1989). Cationic Ilposome-mediated transfectlon. Nature 337, 387-388. GIBSON, T. J. (1984). Studies on the Epstein-Barr virus genome. Ph.D. thesis, Cambridge University, England. HIRT, B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures. /. MO/. Biol. 26, 365-369. KUZNAR. J., SALAS, M. L., and VI~~UELA, E. (1980). DNA-dependent RNA polymerase in African swine fever virus. Virology 101, 169175. LEY, V., ALMENDRAL, J. M., CARBONERO, P., VIRUELA, E., and TALAVERA,

76

RODRiGUEZ

A. (1984). Molecular cloning of African swine fever virus DNA. Virology 133, 249-257. LOPEZ-OT~N, C., FREIJE, J. M. P., PARRA, F., M~NDEZ, E., and VI&UELA, E. (1990). Mapping and sequence of the gene coding for the major capsid protein of African swine fever virus. Virology 175, 477484. MACKETT, M., SMITH, G. L., and Moss, B. (1985). General method for the production and selection of infectious vaccinia virus recombinants expressing foreign genes. J. Viral. 49, 857-864. MACKET~, M., SMITH, G. L., and Moss, B. (1982). Vaccinia virus: a selectable eukaryotic cloning and expression vector. Proc. Nat/. Acad. Sci. USA 79,7415-7419. MALMQUIST, W. A. (1963). Serologic and immunologic studies with African swine fever virus. Am. J. Vet. Res. 24, 450-459. MERCHLINSKY, M., and Moss, B. (1986). Resolution of linear minichromosomes with hairpin ends form circular plasmids containing vaccinia virus concatemer junctions. Cell 45, 879-884. MERCHLINSKY, M. (1989). Intramolecular homologous recombination in cells infected with temperature-sensitive mutants of vaccinia virus. 1. Viral. 63, 2030-2035. MORENO, M. A., CARRASCOSA, A. L., ORTIN, J., and VI~%JELA, E. (1978). Inhibition of African swine fever (ASF) virus replication by phosphonoacetic acid. J. Gen. Viral. 93, 253-258. PANICALI, D., and PAOLETTI, E. (1982). Construction of poxviruses as cloning vectors: insertion of the thymidine kinase gene from

ET AL herpes simplex virus into the DNA of infectious vaccinia virus. Proc. Nat/. Acad. Sci. USA 79, 4927-4931. PARKS, R. J., and EVANS, D. H. (1991). Enhanced recombination associated with the presence of insertion and deletion mutations in poxvirus-infected cells. Virology 184, 299-309. PEDEN, K. W. C., PIPAS, J. M., PEARSON-WHITE, S., and NATHANS, D. (1980). Isolation of mutants of an animal virus in bacteria. Science 209, 1392-l 396. POST, L. E., and ROIZMAN, B. (1981). A generalized technique for deletion of specific genes in large genomes: (Y gene 22 of herpes simplex virus 1 is not essential for growth. Cell 25, 227-232. SAMBROOK, J.. FRITSCH, E. F., and MANIATIS, T. (1989). “Molecular Cloning: A Laboratory Manual,” 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. SHAPIRO, G., STACHELEK. J. L., LETSOU, A., SOODAK, L. K., and LISKAY. R. M. (1983). Novel use of synthetic oligonucleotide insertion mutants for the study of homologous recombination in mammalian cells. Proc. Nat/. Acad. Sci. USA 80, 4827-483 1. VI&ELA, E. (1985). African swine fever virus. Cur. Top. Microbial. Immunol. 116, 151-170. VIIQUELA, E. (1987). Molecular biology of African swine fever virus. In “African Swine Fever” (Y. Becker, Ed.), pp 31-49. Nijoff. Boston. WILKINSON, P. J. (1989). African swine fever. In “Virus Infections of Porcines” (M. B. Pensaert, Ed.), pp 17-35. Elsevier Science, Amsterdam.