- Email: [email protected]
Genomic organisation and tissue specific expression of ABLIM2 gene in human, mouse and rat
Biochimica et Biophysica Acta 1730 (2005) 1 – 9 http://www.elsevier.com/locate/bba
Genomic organisation and tissue specific expression of ABLIM2 gene in human, mouse and rat Eugene Klimova,*, Olga Rud’kob, Elian Rakhmanalieva, Galina Sulimovaa a
The laboratory of comparative animal genetics, Vavilov Institute of General Genetics, Russian Academy of Sciences, RAS, 3, Gubkin Street, Moscow, 119991 GSP-1, Russia b Department of Physiology of Higher Nervous Activity, Faculty of Biology, Lomonosov Moscow State University, Moscow, 119899, Russia Received 17 December 2004; received in revised form 3 May 2005; accepted 6 May 2005 Available online 24 May 2005
Abstract The exon – intron structures of the human, rat and mouse ABLIM2 gene were determined in silico. The experimental verification resulted in the revealing of two mRNA isoforms of the ABLIM2 gene. The isoforms a and b contained 20 exons and 18 exons, respectively. The highest expression of both isoforms was observed in rat brain and eye and in mouse embryos. The 5V-UTR region of the ABLIM2 gene was 127 bp in rat and mouse, but in human, it was 65 bp. The site of polyadenylation was shown to be present at a distance of 682 bp from the stop-codon in human and rat and 684 bp in mouse. The in silico analysis of the gene 5V-region was performed. The high density of brain and CNS specific transcription factors’ binding sites in the promoter region was shown for all three organisms. The comparison of the amino acid sequences of the human ABLIM2 and ABLIM1 proteins showed that the number and arrangement of domains (four LIM-domains in the Nend region and the C-end VHP-domain) were similar. The structure of the ABLIM2 proteins was similar in all three organisms. On the basis of our data, it was assumed that the ABLIM2 protein was necessary for the normal functioning of neurons. D 2005 Elsevier B.V. All rights reserved. Keywords: ABLIM2 gene; Exon – intron structure; Tissue specific expression; In silico promoter analysis
1. Introduction In our previous work, we mapped the HPVI6 site of integration in the first intron of the hypothetical human KIAA1808 gene [1]. The cDNA sequence of KIAA1808 was identified in the Kazusa cDNA Project [2]. This mRNA is similar to mRNA of the ABLIM1 gene, but in the human genome, it has another localisation: ABLIM1-10q25 [3] and KIAA1808-4p16.1. The ABLIM1 protein has four LIMdomains and one VHP-domain [4] (OMIM database: 602330). The LIM-domains were found in more than 60 proteins. It is a double-zinc finger motif rich in cysteine, which interact specifically with other LIM domains and with many different protein domains [5]. The binding of
* Corresponding author. Tel.: +7 95 135 50 52; fax: +7 95 132 89 62. E-mail address: [email protected] (E. Klimov). 0167-4781/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2005.05.001
ABLIM1 with F-actin through the VHP domain was also shown [4,6,7]. The ABLIM1 protein appears to play the main part in the transmission of signal from actin to DNA. It participates in the cytoskeleton formation and cell differentiation [4]. The human ABLIM1 protein is a mediator in the process of growing the neurons related to eye retina. Three protein isoforms take equal part in this process, except for the most active medium-sized ABLIM1-L isoform [8]. Whereas the ABLIM1 gene and its products have been well studied, the ABLIM2 (KIAA1808) gene has been given little attention. The available publications only dealt with cloning of cDNA of human [2,9] (GeneBank accession no. NM_032432) and mouse [10 – 12] (GeneBank accession no. NM_177678) genes and with analyses performed in silico. The data on the KIAA1808 expression are represented on the site of the Kazusa DNA Research Institute (http://www.kazusa.or.jp/huge/gfpage/KIAA1808/).
2
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
The highest expression was observed in brain. This paper presents the comprehensive data on the exon – intron structure and expression of the ABLIM2 gene in human, rat and mouse.
2. Materials and methods 2.1. Experimental tools Human total RNA and samples (normal/tumour tissues) were obtained from the Cancer Research Centre (Moscow) and the State Research Centre ‘‘GosNIIgenetika’’. Ratus norvegicus and Mus musculus total RNA was prepared from female and male rats (Wistar) and mouse embryos using Trizol RNA Prep 100 kit (IsoGen, Russia). Primers were designed so that RNA and DNA amplification products had different sizes, and could be differentiated in the gel. The nucleotide sequences of the primers used in these studies are presented in Table 1. Glyceraldehyde phosphate dehydrogenase gene (Gapdh) was used as an internal control gene. RT-PCR was performed with GenePaki RT-PCR Core kit (IsoGen, Russia), using a PTC-100i thermocycler (MJ Research Inc., USA). Annealing temperature was 49 -C for all primers. For amplification of cDNA ends, BD SMARTi RACE kit (Clontech, USA) was used. The analysis of RT-PCR products using 2% agarose gel was performed according to standard protocols [13]. RT-PCR products were extracted from 2% low melting point agarose with V-Gene Gel Extraction kit (China). Sequencing was performed on ABI-310 (Applied Biosystem, USA) with original kit. 2.2. Bioinformatic tools A search for homologies and design of the primary exon– intron structure was carried out using the BLASTN Program
Table 1 Primers to exons of human, mouse and rat ABLIM2 genes and exon numbers Name
Primers 5V– 3V
Exon number
Human F1 Human F2 Human F4 Human F6 Human R1 Human R2 Mouse/Rat F1 Mouse/Rat F3 Mouse/Rat F4 Mouse/Rat F5 Mouse/Rat F6 Mouse/Rat R1 Mouse/Rat R2 Mouse/Rat R3 dT
ACTCCGACCTCACGGTC CAGCTTTCACTCACAATACA GTGAGCTGTGAGGCTTGT ACCTGCGGGCCCGAGGGTCTG GCTTTCTTCTTAAGGTCATT GAGCCGGTCCAGCGTCGGT CTGGCGTAAAAGATAACATC CAGCCAGGACTGAAGACAAGA TGTGTGCAAGGGAGAGGTGCT AGCGGGTACTGTGTGCGCCGA GGGATGAGCATCGAGGAGTT AGGCTTTCTTCTTGAGGTC AGGTCACACGGTCCCCAGGA GCACTGCTTGTAGGACCGATCA TTTTGTACAAGCTT(30)
11 15/18 20 1 20 3 13 8 2 1 20 20 4 11 polyA
(http://www.ncbi.nlm.nih.gov/BLAST/). The exon – intron structure of the ABLIM2 gene was verified visually. Promoter regions were identified using the PromoterInspector (http://genomatix.gsf.de/) and Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) Programs. The MatInspector service with brain, nervous system, central nervous system and eye filter (http://genomatix. gsf.de/) was used for search of binding sites of transcription factors. Amino acid sequence encoded by the novel gene was translated in silico using the DNAYProtein service (http://cn.expasy.org/tools/dna.html).
3. Results and discussion 3.1. Human gene structure The design of the exon –intron structure was carried out based on the data from the database of mRNA of the hypothetical human KIAA1808 gene (GeneBank accession no. AB058711) [2]. This mRNA is arranged in region 4p16 of the human genome (contig GeneBank accession no. NT_006307), where previously the HPVI6 integration site (GeneBank accession no. AJ431609) similar to the KIAA1808 intron 12 was mapped by RH-mapping [1]. The primary exon –intron structure of the human ABLIM2 gene was constructed by an alignment of KIAA1808 mRNA and genomic contig using the BLASTN program. Then, the data on the alignment and exons flanking sequences were corrected visually resulted in revealing an exon consisting of eight nucleotides. All exons were flanked by canonical sites of splicing (. . .ag-exon-gt. . .). The authors, who obtained cDNA of the ABLIM2 gene [2], have performed the alignment of cDNA with nucleotide sequence of the human genome for recognising the exon – intron structure (16 exons revealed). The gene structure discovered is represented on the site at the Kazusa DNA Research Institute (http://www.kazusa.or.jp/huge/gfpage/ KIAA1808/). The results of the studies that were carried out at the Kazusa DNA Research Institute were not verified experimentally. However, the comprehensive analysis performed by the authors of this paper has resulted in the identification of four exons more (1, 16, 17, 18). Thus, we showed that the human ABLIM2 gene contained 20 exons (Fig. 1 and Table 2). The exon –intron structure of the ABLIM2 gene was verified experimentally by RT-PCR with primers to different exons of the gene with the subsequent sequencing of the products. The weaker expression of the ABLIM2 gene was found in human blood and some tissues: breast, kidney, cervix and ovaries (the data are not presented). The experimental verification of the ABLIM2 gene exon– intron structure resulted in revealing of two mRNA isoforms of the ABLIM2 gene. The isoform a contains 20 exons and the isoform b has 18 exons (exons 16 and 17 are absent). Both isoforms were registered in the EMBL
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
3
Fig. 1. Scheme of exon – intron structure of the human (HS), mouse (MM) and rat (RN) ABLIM2 gene and two isoforms of human ABLIM2 protein (grey box—the amino acids coded by exons 16 and 17).
database: isoform a (GeneBank accession no. AJ748601) and isoform b (GeneBank accession no. AJ748600). In order to find new isoforms, the ABLIM2 expression was analysed in samples of human tumour tissues (breast, kidney, cervix and ovaries). There were no new isoforms were found in the samples analysed (the data are not presented). The promoter region and its sites of binding transcription factors (TF) have been identified and analysed using a series Table 2 The number and length of exons (bold) and introns of the ABLIM2 gene in human, rat and mouse No
5V-UTR 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 3V-UTR
Human
Rat
Mouse
Domains
Exon
Intron
Exon
Intron
Exon
Intron
65 10 144 184 116 127 94 88 59 78 147 121 102 54 53 139 62 55 8 81 114 682
– 52,042 9210 8814 7366 2954 16,573 6720 8946 8868 6372 9352 530 10,515 852 15,131 7972 1284 202 16,160 –
127 10 144 184 116 127 94 88 59 78 150 121 102 54 53 139 62 55 8 81 114 682
– 38,531 3872 4702 1565 2825 12,142 3872 5443 3648 4130 6948 632 9117 627 8766 6840 1389 192 9513 –
127 10 144 184 116 127 94 88 59 78 150 121 102 54 53 139 62 55 8 81 114 684
– 40,392 3763 4495 2028 2816 11,805 4011 4870 3817 4183 7402 610 7558 645 8614 6403 1408 192 8393 –
LIM 1 LIM 2 LIM 3 LIM 4
VHP
Exons 16 and 17 are absent in isoform b (italic). In the last column, protein domains are present.
of programs (see Materials and methods). The promoter region that was revealed with the help of the PromoterInspection Program is 204 bp in human, 260 in rat and 212 bp in mouse. The transcription start has been recorded using the Promoter Prediction Program. The promoter region, which was revealed according to this program, was within the region predicted by the PromoterInspector Program. The main transcription factors, whose sites of binding were found in the promoter of the human ABLIM2 gene, are presented in Table 3 and Fig. 2. Two transcription factors should be mentioned separately. The Wilms tumour 1 (WT1) [14] may be both an activator and repressor of transcription (OMIM database: 607102). In the case with the ABLIM2 gene, WT1 is most likely a repressor, since it is not expressed in neurons. Probably, it plays the same part as the Neural-restrictivesilencer-factor (NRSF) repressing the activity of neuronal genes in cells of other types [15] (OMIM database: 600571). A search for human nucleotide sequences similar to the ABLIM2 promoter region was also undertaken. No homologous region of the human genome was found indicating the unique activation of this gene transcription. The comparison of the amino acid ABLIM2 and ABLIM1 sequences showed their similarity in the number and arrangement of domains. The identity of these sequences is estimated at 57%. The data represented allow one to assert that ABLIM2 and ABLIM1 perform a similar function in cell. The ABLIM2 protein contains four LIM-domains in the N-end region and C-end VHP-domain (Figs. 1 and 3) attesting to its participation in processes of development and functioning of cells. The LIM-domains appear to have the DNA-binding function [16]. The VHP-domain participates in the interaction with actin [6,7]. Classification of LIM-domain proteins is difficult because they carry out various functions
4
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
Table 3 The description of promoter region and adjacent sequence of ABLIM2 Matrix
Family
Further Information
Tissue
HS
RN
MM
APA4.01 ATF6.02
AP4R CREB
Brain, CNS, NS Brain, CNS, NS
1 1
1
1
E47.01 EGR1.01 EGR1.02 EGR2.01 EGR3.01 ELF2.01 FREAC2.01 GABP.01 HELT.01 HES1.01
MYOD EGRF EGRF EGRF EGRF ETSF FKHD ETSF HESF HESF
NS Brain, Brain, Brain, Brain, NS Eye NS NS NS
1 2 3 1 2
1 2 1
1 3 1
1
1
1
1
1
1
LMO2COM.01
MYOD
2
2
MEIS1.01 MYOD.02 MYT1.02
MEIS MYOD MIT1
1 1
1 1 1
NBRE.01
RORA
1
1
NGFIC.01 NRSF.01 OLF1.01 PAX6.02
EGRF NRSF NOLF PAX6
1 1 1 1
1 1 1 1
RORA2.01 TH1E47.01
RORA AP4R
WT1.01
EGRF
Activator protein 4 Activating transcription factor 6, member of b-zip family, induced by ER stress MyoD/E47 and MyoD/E12 dimers Egr-1/Krox-24/NGFI-A immediate-early gene product EGR1, early growth response 1 Egr-2/Krox-20 early growth response gene product Early growth response gene 3 product Ets-family member ELF-2 (NERF1a) Fork head related activator-2 (FOXF2) GABP: GA binding protein Hey-like bHLH-transcriptional repressor Drosophila hairy and enhancer of split homologue 1 (HES-1) Complex of Lmo2 bound to Tal-1, E2A proteins, and GATA-1, half-site 1 Binding site for monomeric Meis1 homeodomain protein Myoblast determining factor MyT1 zinc finger transcription factor involved in primary neurogenesis Monomers of the nur subfamily of nuclear receptors (nur77, nurr1, nor-1) Nerve growth factor-induced protein C Neuron-restrictive silencer factor Olfactory neuron-specific factor PAX6 paired domain and homeodomain are required for binding to this site RAR-related orphan receptor alpha2 Thing1/E47 heterodimer, TH1 bHLH member specific expression in a variety of embryonic tissues Wilms tumour suppressor
CNS, CNS, CNS, CNS,
NS NS NS NS
NS
1 1 1 1 2
Brain, CNS, NS NS NS
1
Brain, CNS, NS
1
Brain, CNS, NS NS NS Brain, CNS, NS, eye
3
Brain, CNS, NS Brain, CNS, NS
1
1
Brain, CNS, NS
5
The names of matrixes, matrix families, description of TF and tissues associated with TFs and ABLIM2 expression are shown. A number of each matrix within the limits of analysed sequences for three organisms (HS—human, RN—rat, MM—mouse) are shown in the right columns (NS—nervous system, CNS— central nervous system).
in cells, providing protein –protein interactions or DNAbinding [5,16]. Thus, ABLIM1 and ABLIM2 genes and their protein products are not part of gene or protein families. 3.2. Comparison of the gene structure in human, mouse and rat The search of nucleotide sequences similar to mRNA of the human ABLIM2 gene has resulted in the determination of similar mRNA in rat (hypothetical gene LOC360958) and mouse (hypothetical gene C230091L11). The exon –intron structure of the Ablim2 gene in rat and mouse was constructed and experimentally verified according to the scheme similar to that of human. Flanking sequences were found to be characteristic of exons in mouse and rat. In the mouse genome, Ablim2 is located in region 5B2 (genomic contig GeneBank accession no. NT_039302); in the rat
genome, in region 14q21 (genomic contig GeneBank accession no. NW_047429). An alternative splicing was shown to be characteristic of rat and mouse—two isoforms (a and b) as in human. The gene sequences were registered in the EMBL database: isoform a (GeneBank accession no. AJ748602) and isoform b (GeneBank accession no. AJ748603) for mouse; isoform a (GeneBank accession no. AJ703892) and isoform b (GeneBank accession no. AJ703893) for rat. The rat gene was registered in the Rat Genome Database under the general name Ablim2 (RGD_ID:1298516). Both isoforms of the rat gene were registered in the same database as isoform a-Symbol: Ablim2_v1 (RGD_ID:1298518) and isoform bSymbol: Ablim2_v2 (RGD_ID:1298519). The results of comparing the exon –intron structure of the ABLIM2 gene in human, rat and mouse are represented in Table 2 and Fig. 1. The exon –intron structure of the
Fig. 2. Alignment of the human, rat and mouse promoter sequences (bold) and adjacent sequences. Transcription factor (TF) binding sites are marked by black for human and gray for rodents, names of TF are shown above the sequences. Start codons (ATG) are underlined. The start of transcription is marked in italics (position 1). It is seen that the highest density of TF binding sites are located at the region predicted by the PromoterInspector program. The location of TF binding sites beside rodents coincides to a considerable extent. The location of TF binding sites beside human is different, though the sequences of promoters have the homology. However, the totality of identical factors coincides.
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
5
6
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
Fig. 3. Comparison of the human, rat and mouse ABLIM2 amino acid sequences (homology 97.9%). Gray areas at the N-terminal are four LIM domains. White box at the C-terminal is VHP domain. The region being absent in isoform a is marked in italics. The underlining designates that amino acid changes depending on isoform (isoform a-R, isoform b-Q). The meaning of signs at the top of the alignment is following: F _—the average weight of column pair exchanges is less than weight matrix mean value; F._—is less than mean value plus one SD; F+_—is less than mean value plus two SD; F*_—is more than mean value plus two SD.
ABLIM2 gene was found to be similar to a greater extent in human, rat and mouse. As seen from Table 2, in these three organisms, the number and length of exons are identical. The single exception is exon 10, which is similar in rat and mouse, but different in human. In the 10th human exon, a deletion of one triplet has occurred. This process appears not to affect the functional protein activity. The 5V-UTR region of
the ABLIM2 gene was similar in rat and mouse, but in human, it was 2 times shorter. The site of polyadenylation was shown to be present at a distance of 682 bp from the stop-codon in human and rat, and 684 bp in mouse. These data were verified experimentally by 3V-RACE with the polyT primer and forward primer to the 20th exon. The analysis of the promoter regions in rat, mouse and human was performed using the same programs. The
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
transcription start was verified by the 5V-RACE with the R2 reverse primer. The promoter regions in rat and mouse have 95% homology. The comparison of the promoter regions in human, rat and mouse has revealed a similar arrangement of TF binding sites (Fig. 2 and Table 3). In human, there are free binding sites for the NRSF. One of these sites is arranged before the start-codon. This TF restricts expression of neuron-specific genes in other cell types. A binding site for this factor may be in any gene region [15,17] (OMIM database: 600571). In rat and mouse, one binding site for NRSF is also before the start-codon. Apart from NRSF, there are five binding sites for WT1 TF in human. Taking into account the presence of binding sites for two repressors
7
of neuronal genes, one can suggest that the expression of the ABLIM2 gene is restricted by neurons. 3.3. Hypothetical protein function and tissue-specific expression Amino acid sequences of the ABLIM2 gene product were compared in human, mouse, and rat. Some differences were found in the primary structure of proteins. The homology between mouse and rat was 98; between human and mouse, 83; and between human and rat, 82%. However, the domain structure of proteins was almost identical. This fact along with the similar tissue-specific expression may attest to conservative functions of the particular protein (Fig. 3).
Fig. 4. Expression pattern of the rat Ablim2 gene determined by the semi-quantity RT-PCR analysis. A—primers to exons 13 and 20; one can see the presence of fragment of 552 bp long (isoform a) and that of 435 bp (isoform b), M100 is the marker of molecular weight (from 100 to 1000 bp). B—primers to exons 2 and 11 and primers to Gapdh cDNA as control. C—diagram characterising the transcription activity of the rat Ablim2 gene. The mean activity of the Gapdh gene in all the tissues analysed is control (see part A).
8
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
The tissue-specific expression was determined using a RNA panel isolated from different organs and tissues of rat (100 ng of total RNA from each organ for reaction). For screening of the RNA panel, primers to the 2nd and 11th exons were used (Mouse/Rat F4 + Mouse/Rat R3) and primers to the 13th and 20th exons (Mouse/Rat F1 + Mouse/Rat R1). The highest expression was found in tissues of brain and in eye. In the rest tissues, trace amounts of mRNA of the Ablim2 gene were detected (Fig. 4). The results obtained for rat coincide with those represented in the site of the Kazusa DNA Research Institute for human (RT-PCR ELISA) (http://www.kazusa.or.jp/huge/ gfpage/KIAA1808/). In all tissues of rat, there were found both forms of the Ablim2 gene. Thus, the conclusions about the neuron-specificity of the gene expression that were made on the basis of analysing the promoter region have been completely confirmed. Expression of mouse Ablim2 was analysed only in mouse embryos (25 somites). Both mRNA forms were identified. The lengths of all amplificated products of mouse and rat cDNA were identical (data are not represented). The data on the tissue-specificity of the Ablim2 expression obtained for rat may be extrapolated to mouse, since gene sequences in these organisms are similar to a great extent (homologies of mRNA and promoter regions were 93% and 95%, respectively). On the basis of our data, it was assumed that the ABLIM2 protein is necessary for the normal functioning of neurons. Thus, for the UNC-115 protein of C. elegans with the domain structure similar to that of ABLIM, its participation in the process of neuron guidance was shown [18 – 22]. The results obtained suggest that ABLIM2 takes part in the same processes in human, rat and mouse. There are no known neuronal phenotypes that are linked to investigate regions in human, mouse and rat genomes.
Acknowledgement This work was supported by the grant of President of the Russian Federation (‘‘Support of Scientific Schools’’), no. NSh-827.2002.4.
References [1] E. Klimov, S. Vinokourova, E. Moisjak, E. Rakhmanaliev, V. Kobseva, L. Laimins, F. Kisseljov, G. Sulimova, Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences, BMC Cancer 2 (2002) 24. [2] T. Nagase, M. Nakayama, D. Nakajima, R. Kikuno, O. Ohara, Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro, DNA Res. 8 (2001) 85 – 95.
[3] A.C. Kim, L.L. Peters, J.H. Knoll, C. VanHuffel, S.L. Ciciotte, P.W. Kleyn, A.H. Chishti, Limatin (LIMAB1), an actin-binding LIM protein, maps to mouse chromosome 19 and human chromosome 10q25, a region frequently deleted in human cancers, Genomics 46 (1997) 291 – 293. [4] D.J. Roof, A. Hayes, M. Adamian, A.H. Chishti, T. Li, Molecular characterization of abLIM, a novel actin-binding and double zinc finger protein, J. Cell Biol. 138 (1997) 575 – 588. [5] I.B. Dawid, J.J. Breen, R. Toyama, LIM domains: multiple roles as adapters and functional modifiers in protein interactions, Trends Genet. 14 (1998) 156 – 162. [6] A.P. Rana, P. Ruff, G.J. Maalouf, D.W. Speicher, A.H. Chishti, Cloning of human erythroid dematin reveals another member of the villin family, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 6651 – 6655. [7] D.S. Doering, P. Matsudaira, Cysteine scanning mutagenesis at 40 of 76 positions in villin headpiece maps the F-actin binding site and structural features of the domain, Biochemistry 35 (1996) 12677 – 12685. [8] C. Lu, X. Huang, H.F. Ma, J.J. Gooley, J. Aparacio, D.J. Roof, C. Chen, D.F. Chen, T. Li, Normal retinal development and retinofugal projections in mice lacking the retina-specific variant of actin-binding LIM domain protein, Neuroscience 120 (2003) 121 – 131. [9] T. Ota, Y. Suzuki, T. Nishikawa, T. Otsuki, T. Sugiyama, R. Irie, A. Wakamatsu, K. Hayashi, H. Sato, K. Nagai, et al., Complete sequencing and characterization of 21,243 full-length human cDNAs, Nat. Genet. 36 (2004) 40 – 45. [10] K. Shibata, M. Itoh, K. Aizawa, S. Nagaoka, N. Sasaki, P. Carninci, H. Konno, J. Akiyama, K. Nishi, T. Kitsunai, et al., RIKEN integrated sequence analysis (RISA) system-384-format sequencing pipeline with 384 multicapillary sequencer, Genome Res. 10 (2000) 1757 – 1771. [11] P. Carninci, Y. Shibata, N. Hayatsu, Y. Sugahara, K. Shibata, M. Itoh, H. Konno, Y. Okazaki, M. Muramatsu, Y. Hayashizaki, Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes, Genome Res. 10 (2000) 1617 – 1630. [12] J. Kawai, A. Shinagawa, K. Shibata, M. Yoshino, M. Itoh, Y. Ishii, T. Arakawa, A. Hara, Y. Fukunishi, H. Konno, et al., Functional annotation of a full-length mouse cDNA collection, Nature 409 (2001) 685 – 690. [13] J. Sambrook, E. Fitsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, 1989. [14] H. Nakagama, G. Heinrich, J. Pelletier, D.E. Housman, Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product, Mol. Cell. Biol. 15 (1995) 1489 – 1498. [15] C. Zuccato, M. Tartari, A. Crotti, D. Goffredo, M. Valenza, L. Conti, T. Cataudella, B.R. Leavitt, M.R. Hayden, T. Timmusk, et al., Huntingtin interacts with REST/NRSF to modulate the transcription of NRSE-controlled neuronal genes, Nat. Genet. 35 (2003) 76 – 83. [16] G.C. Perez-Alvarado, C. Miles, J.W. Michelsen, H.A. Louis, D.R. Winge, M.C. Beckerle, M.F. Summers, Structure of the carboxyterminal LIM domain from the cysteine rich protein CRP, Nat. Struct. Biol. 1 (1994) 388 – 398. [17] C.J. Schoenherr, A.J. Paquette, D.J. Anderson, Identification of potential target genes for the neuron-restrictive silencer factor, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 9881 – 9886. [18] E.A. Lundquist, R.K. Herman, J.E. Shaw, C.I. Bargmann, UNC115, a conserved protein with predicted LIM and actin-binding domains, mediates axon guidance in C. elegans, Neuron 21 (1998) 385 – 392. [19] E.C. Struckhoff, E.A. Lundquist, The actin-binding protein UNC-115 is an effector of Rac signaling during axon pathfinding in C. elegans, Development 130 (2003) 693 – 704. [20] L. Erkman, P.A. Yates, T. McLaughlin, R.J. McEvilly, T. Whisenhunt, S.M. O’Connell, A.I. Krones, M.A. Kirby, D.H. Rapaport, J.R.
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9 Bermingham, et al., A POU domain transcription factor-dependent program regulates axon pathfinding in the vertebrate visual system, Neuron 28 (2000) 779 – 792. [21] D. Leonoudakis, L.R. Conti, S. Anderson, C.M. Radeke, L.M. McGuire, M.E. Adams, S.C. Froehner, J.R. Yates III, C.A. Vandenberg, Protein trafficking and anchoring complexes revealed by proteomic
9
analysis of inward rectifier potassium channel (Kir2.x)-associated proteins, J. Biol. Chem. 279 (2004) 22331 – 22346. [22] Z. Gitai, T.W. Yu, E.A. Lundquist, M. Tessier-Lavigne, C.I. Bargmann, The netrin receptor UNC-40/DCC stimulates axon attraction and outgrowth through enabled and, in parallel, Rac and UNC115/AbLIM, Neuron 37 (2003) 53 – 65.
Genomic organisation and tissue specific expression of ABLIM2 gene in human, mouse and rat Eugene Klimova,*, Olga Rud’kob, Elian Rakhmanalieva, Galina Sulimovaa a
The laboratory of comparative animal genetics, Vavilov Institute of General Genetics, Russian Academy of Sciences, RAS, 3, Gubkin Street, Moscow, 119991 GSP-1, Russia b Department of Physiology of Higher Nervous Activity, Faculty of Biology, Lomonosov Moscow State University, Moscow, 119899, Russia Received 17 December 2004; received in revised form 3 May 2005; accepted 6 May 2005 Available online 24 May 2005
Abstract The exon – intron structures of the human, rat and mouse ABLIM2 gene were determined in silico. The experimental verification resulted in the revealing of two mRNA isoforms of the ABLIM2 gene. The isoforms a and b contained 20 exons and 18 exons, respectively. The highest expression of both isoforms was observed in rat brain and eye and in mouse embryos. The 5V-UTR region of the ABLIM2 gene was 127 bp in rat and mouse, but in human, it was 65 bp. The site of polyadenylation was shown to be present at a distance of 682 bp from the stop-codon in human and rat and 684 bp in mouse. The in silico analysis of the gene 5V-region was performed. The high density of brain and CNS specific transcription factors’ binding sites in the promoter region was shown for all three organisms. The comparison of the amino acid sequences of the human ABLIM2 and ABLIM1 proteins showed that the number and arrangement of domains (four LIM-domains in the Nend region and the C-end VHP-domain) were similar. The structure of the ABLIM2 proteins was similar in all three organisms. On the basis of our data, it was assumed that the ABLIM2 protein was necessary for the normal functioning of neurons. D 2005 Elsevier B.V. All rights reserved. Keywords: ABLIM2 gene; Exon – intron structure; Tissue specific expression; In silico promoter analysis
1. Introduction In our previous work, we mapped the HPVI6 site of integration in the first intron of the hypothetical human KIAA1808 gene [1]. The cDNA sequence of KIAA1808 was identified in the Kazusa cDNA Project [2]. This mRNA is similar to mRNA of the ABLIM1 gene, but in the human genome, it has another localisation: ABLIM1-10q25 [3] and KIAA1808-4p16.1. The ABLIM1 protein has four LIMdomains and one VHP-domain [4] (OMIM database: 602330). The LIM-domains were found in more than 60 proteins. It is a double-zinc finger motif rich in cysteine, which interact specifically with other LIM domains and with many different protein domains [5]. The binding of
* Corresponding author. Tel.: +7 95 135 50 52; fax: +7 95 132 89 62. E-mail address: [email protected] (E. Klimov). 0167-4781/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2005.05.001
ABLIM1 with F-actin through the VHP domain was also shown [4,6,7]. The ABLIM1 protein appears to play the main part in the transmission of signal from actin to DNA. It participates in the cytoskeleton formation and cell differentiation [4]. The human ABLIM1 protein is a mediator in the process of growing the neurons related to eye retina. Three protein isoforms take equal part in this process, except for the most active medium-sized ABLIM1-L isoform [8]. Whereas the ABLIM1 gene and its products have been well studied, the ABLIM2 (KIAA1808) gene has been given little attention. The available publications only dealt with cloning of cDNA of human [2,9] (GeneBank accession no. NM_032432) and mouse [10 – 12] (GeneBank accession no. NM_177678) genes and with analyses performed in silico. The data on the KIAA1808 expression are represented on the site of the Kazusa DNA Research Institute (http://www.kazusa.or.jp/huge/gfpage/KIAA1808/).
2
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
The highest expression was observed in brain. This paper presents the comprehensive data on the exon – intron structure and expression of the ABLIM2 gene in human, rat and mouse.
2. Materials and methods 2.1. Experimental tools Human total RNA and samples (normal/tumour tissues) were obtained from the Cancer Research Centre (Moscow) and the State Research Centre ‘‘GosNIIgenetika’’. Ratus norvegicus and Mus musculus total RNA was prepared from female and male rats (Wistar) and mouse embryos using Trizol RNA Prep 100 kit (IsoGen, Russia). Primers were designed so that RNA and DNA amplification products had different sizes, and could be differentiated in the gel. The nucleotide sequences of the primers used in these studies are presented in Table 1. Glyceraldehyde phosphate dehydrogenase gene (Gapdh) was used as an internal control gene. RT-PCR was performed with GenePaki RT-PCR Core kit (IsoGen, Russia), using a PTC-100i thermocycler (MJ Research Inc., USA). Annealing temperature was 49 -C for all primers. For amplification of cDNA ends, BD SMARTi RACE kit (Clontech, USA) was used. The analysis of RT-PCR products using 2% agarose gel was performed according to standard protocols [13]. RT-PCR products were extracted from 2% low melting point agarose with V-Gene Gel Extraction kit (China). Sequencing was performed on ABI-310 (Applied Biosystem, USA) with original kit. 2.2. Bioinformatic tools A search for homologies and design of the primary exon– intron structure was carried out using the BLASTN Program
Table 1 Primers to exons of human, mouse and rat ABLIM2 genes and exon numbers Name
Primers 5V– 3V
Exon number
Human F1 Human F2 Human F4 Human F6 Human R1 Human R2 Mouse/Rat F1 Mouse/Rat F3 Mouse/Rat F4 Mouse/Rat F5 Mouse/Rat F6 Mouse/Rat R1 Mouse/Rat R2 Mouse/Rat R3 dT
ACTCCGACCTCACGGTC CAGCTTTCACTCACAATACA GTGAGCTGTGAGGCTTGT ACCTGCGGGCCCGAGGGTCTG GCTTTCTTCTTAAGGTCATT GAGCCGGTCCAGCGTCGGT CTGGCGTAAAAGATAACATC CAGCCAGGACTGAAGACAAGA TGTGTGCAAGGGAGAGGTGCT AGCGGGTACTGTGTGCGCCGA GGGATGAGCATCGAGGAGTT AGGCTTTCTTCTTGAGGTC AGGTCACACGGTCCCCAGGA GCACTGCTTGTAGGACCGATCA TTTTGTACAAGCTT(30)
11 15/18 20 1 20 3 13 8 2 1 20 20 4 11 polyA
(http://www.ncbi.nlm.nih.gov/BLAST/). The exon – intron structure of the ABLIM2 gene was verified visually. Promoter regions were identified using the PromoterInspector (http://genomatix.gsf.de/) and Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) Programs. The MatInspector service with brain, nervous system, central nervous system and eye filter (http://genomatix. gsf.de/) was used for search of binding sites of transcription factors. Amino acid sequence encoded by the novel gene was translated in silico using the DNAYProtein service (http://cn.expasy.org/tools/dna.html).
3. Results and discussion 3.1. Human gene structure The design of the exon –intron structure was carried out based on the data from the database of mRNA of the hypothetical human KIAA1808 gene (GeneBank accession no. AB058711) [2]. This mRNA is arranged in region 4p16 of the human genome (contig GeneBank accession no. NT_006307), where previously the HPVI6 integration site (GeneBank accession no. AJ431609) similar to the KIAA1808 intron 12 was mapped by RH-mapping [1]. The primary exon –intron structure of the human ABLIM2 gene was constructed by an alignment of KIAA1808 mRNA and genomic contig using the BLASTN program. Then, the data on the alignment and exons flanking sequences were corrected visually resulted in revealing an exon consisting of eight nucleotides. All exons were flanked by canonical sites of splicing (. . .ag-exon-gt. . .). The authors, who obtained cDNA of the ABLIM2 gene [2], have performed the alignment of cDNA with nucleotide sequence of the human genome for recognising the exon – intron structure (16 exons revealed). The gene structure discovered is represented on the site at the Kazusa DNA Research Institute (http://www.kazusa.or.jp/huge/gfpage/ KIAA1808/). The results of the studies that were carried out at the Kazusa DNA Research Institute were not verified experimentally. However, the comprehensive analysis performed by the authors of this paper has resulted in the identification of four exons more (1, 16, 17, 18). Thus, we showed that the human ABLIM2 gene contained 20 exons (Fig. 1 and Table 2). The exon –intron structure of the ABLIM2 gene was verified experimentally by RT-PCR with primers to different exons of the gene with the subsequent sequencing of the products. The weaker expression of the ABLIM2 gene was found in human blood and some tissues: breast, kidney, cervix and ovaries (the data are not presented). The experimental verification of the ABLIM2 gene exon– intron structure resulted in revealing of two mRNA isoforms of the ABLIM2 gene. The isoform a contains 20 exons and the isoform b has 18 exons (exons 16 and 17 are absent). Both isoforms were registered in the EMBL
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
3
Fig. 1. Scheme of exon – intron structure of the human (HS), mouse (MM) and rat (RN) ABLIM2 gene and two isoforms of human ABLIM2 protein (grey box—the amino acids coded by exons 16 and 17).
database: isoform a (GeneBank accession no. AJ748601) and isoform b (GeneBank accession no. AJ748600). In order to find new isoforms, the ABLIM2 expression was analysed in samples of human tumour tissues (breast, kidney, cervix and ovaries). There were no new isoforms were found in the samples analysed (the data are not presented). The promoter region and its sites of binding transcription factors (TF) have been identified and analysed using a series Table 2 The number and length of exons (bold) and introns of the ABLIM2 gene in human, rat and mouse No
5V-UTR 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 3V-UTR
Human
Rat
Mouse
Domains
Exon
Intron
Exon
Intron
Exon
Intron
65 10 144 184 116 127 94 88 59 78 147 121 102 54 53 139 62 55 8 81 114 682
– 52,042 9210 8814 7366 2954 16,573 6720 8946 8868 6372 9352 530 10,515 852 15,131 7972 1284 202 16,160 –
127 10 144 184 116 127 94 88 59 78 150 121 102 54 53 139 62 55 8 81 114 682
– 38,531 3872 4702 1565 2825 12,142 3872 5443 3648 4130 6948 632 9117 627 8766 6840 1389 192 9513 –
127 10 144 184 116 127 94 88 59 78 150 121 102 54 53 139 62 55 8 81 114 684
– 40,392 3763 4495 2028 2816 11,805 4011 4870 3817 4183 7402 610 7558 645 8614 6403 1408 192 8393 –
LIM 1 LIM 2 LIM 3 LIM 4
VHP
Exons 16 and 17 are absent in isoform b (italic). In the last column, protein domains are present.
of programs (see Materials and methods). The promoter region that was revealed with the help of the PromoterInspection Program is 204 bp in human, 260 in rat and 212 bp in mouse. The transcription start has been recorded using the Promoter Prediction Program. The promoter region, which was revealed according to this program, was within the region predicted by the PromoterInspector Program. The main transcription factors, whose sites of binding were found in the promoter of the human ABLIM2 gene, are presented in Table 3 and Fig. 2. Two transcription factors should be mentioned separately. The Wilms tumour 1 (WT1) [14] may be both an activator and repressor of transcription (OMIM database: 607102). In the case with the ABLIM2 gene, WT1 is most likely a repressor, since it is not expressed in neurons. Probably, it plays the same part as the Neural-restrictivesilencer-factor (NRSF) repressing the activity of neuronal genes in cells of other types [15] (OMIM database: 600571). A search for human nucleotide sequences similar to the ABLIM2 promoter region was also undertaken. No homologous region of the human genome was found indicating the unique activation of this gene transcription. The comparison of the amino acid ABLIM2 and ABLIM1 sequences showed their similarity in the number and arrangement of domains. The identity of these sequences is estimated at 57%. The data represented allow one to assert that ABLIM2 and ABLIM1 perform a similar function in cell. The ABLIM2 protein contains four LIM-domains in the N-end region and C-end VHP-domain (Figs. 1 and 3) attesting to its participation in processes of development and functioning of cells. The LIM-domains appear to have the DNA-binding function [16]. The VHP-domain participates in the interaction with actin [6,7]. Classification of LIM-domain proteins is difficult because they carry out various functions
4
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
Table 3 The description of promoter region and adjacent sequence of ABLIM2 Matrix
Family
Further Information
Tissue
HS
RN
MM
APA4.01 ATF6.02
AP4R CREB
Brain, CNS, NS Brain, CNS, NS
1 1
1
1
E47.01 EGR1.01 EGR1.02 EGR2.01 EGR3.01 ELF2.01 FREAC2.01 GABP.01 HELT.01 HES1.01
MYOD EGRF EGRF EGRF EGRF ETSF FKHD ETSF HESF HESF
NS Brain, Brain, Brain, Brain, NS Eye NS NS NS
1 2 3 1 2
1 2 1
1 3 1
1
1
1
1
1
1
LMO2COM.01
MYOD
2
2
MEIS1.01 MYOD.02 MYT1.02
MEIS MYOD MIT1
1 1
1 1 1
NBRE.01
RORA
1
1
NGFIC.01 NRSF.01 OLF1.01 PAX6.02
EGRF NRSF NOLF PAX6
1 1 1 1
1 1 1 1
RORA2.01 TH1E47.01
RORA AP4R
WT1.01
EGRF
Activator protein 4 Activating transcription factor 6, member of b-zip family, induced by ER stress MyoD/E47 and MyoD/E12 dimers Egr-1/Krox-24/NGFI-A immediate-early gene product EGR1, early growth response 1 Egr-2/Krox-20 early growth response gene product Early growth response gene 3 product Ets-family member ELF-2 (NERF1a) Fork head related activator-2 (FOXF2) GABP: GA binding protein Hey-like bHLH-transcriptional repressor Drosophila hairy and enhancer of split homologue 1 (HES-1) Complex of Lmo2 bound to Tal-1, E2A proteins, and GATA-1, half-site 1 Binding site for monomeric Meis1 homeodomain protein Myoblast determining factor MyT1 zinc finger transcription factor involved in primary neurogenesis Monomers of the nur subfamily of nuclear receptors (nur77, nurr1, nor-1) Nerve growth factor-induced protein C Neuron-restrictive silencer factor Olfactory neuron-specific factor PAX6 paired domain and homeodomain are required for binding to this site RAR-related orphan receptor alpha2 Thing1/E47 heterodimer, TH1 bHLH member specific expression in a variety of embryonic tissues Wilms tumour suppressor
CNS, CNS, CNS, CNS,
NS NS NS NS
NS
1 1 1 1 2
Brain, CNS, NS NS NS
1
Brain, CNS, NS
1
Brain, CNS, NS NS NS Brain, CNS, NS, eye
3
Brain, CNS, NS Brain, CNS, NS
1
1
Brain, CNS, NS
5
The names of matrixes, matrix families, description of TF and tissues associated with TFs and ABLIM2 expression are shown. A number of each matrix within the limits of analysed sequences for three organisms (HS—human, RN—rat, MM—mouse) are shown in the right columns (NS—nervous system, CNS— central nervous system).
in cells, providing protein –protein interactions or DNAbinding [5,16]. Thus, ABLIM1 and ABLIM2 genes and their protein products are not part of gene or protein families. 3.2. Comparison of the gene structure in human, mouse and rat The search of nucleotide sequences similar to mRNA of the human ABLIM2 gene has resulted in the determination of similar mRNA in rat (hypothetical gene LOC360958) and mouse (hypothetical gene C230091L11). The exon –intron structure of the Ablim2 gene in rat and mouse was constructed and experimentally verified according to the scheme similar to that of human. Flanking sequences were found to be characteristic of exons in mouse and rat. In the mouse genome, Ablim2 is located in region 5B2 (genomic contig GeneBank accession no. NT_039302); in the rat
genome, in region 14q21 (genomic contig GeneBank accession no. NW_047429). An alternative splicing was shown to be characteristic of rat and mouse—two isoforms (a and b) as in human. The gene sequences were registered in the EMBL database: isoform a (GeneBank accession no. AJ748602) and isoform b (GeneBank accession no. AJ748603) for mouse; isoform a (GeneBank accession no. AJ703892) and isoform b (GeneBank accession no. AJ703893) for rat. The rat gene was registered in the Rat Genome Database under the general name Ablim2 (RGD_ID:1298516). Both isoforms of the rat gene were registered in the same database as isoform a-Symbol: Ablim2_v1 (RGD_ID:1298518) and isoform bSymbol: Ablim2_v2 (RGD_ID:1298519). The results of comparing the exon –intron structure of the ABLIM2 gene in human, rat and mouse are represented in Table 2 and Fig. 1. The exon –intron structure of the
Fig. 2. Alignment of the human, rat and mouse promoter sequences (bold) and adjacent sequences. Transcription factor (TF) binding sites are marked by black for human and gray for rodents, names of TF are shown above the sequences. Start codons (ATG) are underlined. The start of transcription is marked in italics (position 1). It is seen that the highest density of TF binding sites are located at the region predicted by the PromoterInspector program. The location of TF binding sites beside rodents coincides to a considerable extent. The location of TF binding sites beside human is different, though the sequences of promoters have the homology. However, the totality of identical factors coincides.
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
5
6
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
Fig. 3. Comparison of the human, rat and mouse ABLIM2 amino acid sequences (homology 97.9%). Gray areas at the N-terminal are four LIM domains. White box at the C-terminal is VHP domain. The region being absent in isoform a is marked in italics. The underlining designates that amino acid changes depending on isoform (isoform a-R, isoform b-Q). The meaning of signs at the top of the alignment is following: F _—the average weight of column pair exchanges is less than weight matrix mean value; F._—is less than mean value plus one SD; F+_—is less than mean value plus two SD; F*_—is more than mean value plus two SD.
ABLIM2 gene was found to be similar to a greater extent in human, rat and mouse. As seen from Table 2, in these three organisms, the number and length of exons are identical. The single exception is exon 10, which is similar in rat and mouse, but different in human. In the 10th human exon, a deletion of one triplet has occurred. This process appears not to affect the functional protein activity. The 5V-UTR region of
the ABLIM2 gene was similar in rat and mouse, but in human, it was 2 times shorter. The site of polyadenylation was shown to be present at a distance of 682 bp from the stop-codon in human and rat, and 684 bp in mouse. These data were verified experimentally by 3V-RACE with the polyT primer and forward primer to the 20th exon. The analysis of the promoter regions in rat, mouse and human was performed using the same programs. The
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
transcription start was verified by the 5V-RACE with the R2 reverse primer. The promoter regions in rat and mouse have 95% homology. The comparison of the promoter regions in human, rat and mouse has revealed a similar arrangement of TF binding sites (Fig. 2 and Table 3). In human, there are free binding sites for the NRSF. One of these sites is arranged before the start-codon. This TF restricts expression of neuron-specific genes in other cell types. A binding site for this factor may be in any gene region [15,17] (OMIM database: 600571). In rat and mouse, one binding site for NRSF is also before the start-codon. Apart from NRSF, there are five binding sites for WT1 TF in human. Taking into account the presence of binding sites for two repressors
7
of neuronal genes, one can suggest that the expression of the ABLIM2 gene is restricted by neurons. 3.3. Hypothetical protein function and tissue-specific expression Amino acid sequences of the ABLIM2 gene product were compared in human, mouse, and rat. Some differences were found in the primary structure of proteins. The homology between mouse and rat was 98; between human and mouse, 83; and between human and rat, 82%. However, the domain structure of proteins was almost identical. This fact along with the similar tissue-specific expression may attest to conservative functions of the particular protein (Fig. 3).
Fig. 4. Expression pattern of the rat Ablim2 gene determined by the semi-quantity RT-PCR analysis. A—primers to exons 13 and 20; one can see the presence of fragment of 552 bp long (isoform a) and that of 435 bp (isoform b), M100 is the marker of molecular weight (from 100 to 1000 bp). B—primers to exons 2 and 11 and primers to Gapdh cDNA as control. C—diagram characterising the transcription activity of the rat Ablim2 gene. The mean activity of the Gapdh gene in all the tissues analysed is control (see part A).
8
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9
The tissue-specific expression was determined using a RNA panel isolated from different organs and tissues of rat (100 ng of total RNA from each organ for reaction). For screening of the RNA panel, primers to the 2nd and 11th exons were used (Mouse/Rat F4 + Mouse/Rat R3) and primers to the 13th and 20th exons (Mouse/Rat F1 + Mouse/Rat R1). The highest expression was found in tissues of brain and in eye. In the rest tissues, trace amounts of mRNA of the Ablim2 gene were detected (Fig. 4). The results obtained for rat coincide with those represented in the site of the Kazusa DNA Research Institute for human (RT-PCR ELISA) (http://www.kazusa.or.jp/huge/ gfpage/KIAA1808/). In all tissues of rat, there were found both forms of the Ablim2 gene. Thus, the conclusions about the neuron-specificity of the gene expression that were made on the basis of analysing the promoter region have been completely confirmed. Expression of mouse Ablim2 was analysed only in mouse embryos (25 somites). Both mRNA forms were identified. The lengths of all amplificated products of mouse and rat cDNA were identical (data are not represented). The data on the tissue-specificity of the Ablim2 expression obtained for rat may be extrapolated to mouse, since gene sequences in these organisms are similar to a great extent (homologies of mRNA and promoter regions were 93% and 95%, respectively). On the basis of our data, it was assumed that the ABLIM2 protein is necessary for the normal functioning of neurons. Thus, for the UNC-115 protein of C. elegans with the domain structure similar to that of ABLIM, its participation in the process of neuron guidance was shown [18 – 22]. The results obtained suggest that ABLIM2 takes part in the same processes in human, rat and mouse. There are no known neuronal phenotypes that are linked to investigate regions in human, mouse and rat genomes.
Acknowledgement This work was supported by the grant of President of the Russian Federation (‘‘Support of Scientific Schools’’), no. NSh-827.2002.4.
References [1] E. Klimov, S. Vinokourova, E. Moisjak, E. Rakhmanaliev, V. Kobseva, L. Laimins, F. Kisseljov, G. Sulimova, Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences, BMC Cancer 2 (2002) 24. [2] T. Nagase, M. Nakayama, D. Nakajima, R. Kikuno, O. Ohara, Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro, DNA Res. 8 (2001) 85 – 95.
[3] A.C. Kim, L.L. Peters, J.H. Knoll, C. VanHuffel, S.L. Ciciotte, P.W. Kleyn, A.H. Chishti, Limatin (LIMAB1), an actin-binding LIM protein, maps to mouse chromosome 19 and human chromosome 10q25, a region frequently deleted in human cancers, Genomics 46 (1997) 291 – 293. [4] D.J. Roof, A. Hayes, M. Adamian, A.H. Chishti, T. Li, Molecular characterization of abLIM, a novel actin-binding and double zinc finger protein, J. Cell Biol. 138 (1997) 575 – 588. [5] I.B. Dawid, J.J. Breen, R. Toyama, LIM domains: multiple roles as adapters and functional modifiers in protein interactions, Trends Genet. 14 (1998) 156 – 162. [6] A.P. Rana, P. Ruff, G.J. Maalouf, D.W. Speicher, A.H. Chishti, Cloning of human erythroid dematin reveals another member of the villin family, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 6651 – 6655. [7] D.S. Doering, P. Matsudaira, Cysteine scanning mutagenesis at 40 of 76 positions in villin headpiece maps the F-actin binding site and structural features of the domain, Biochemistry 35 (1996) 12677 – 12685. [8] C. Lu, X. Huang, H.F. Ma, J.J. Gooley, J. Aparacio, D.J. Roof, C. Chen, D.F. Chen, T. Li, Normal retinal development and retinofugal projections in mice lacking the retina-specific variant of actin-binding LIM domain protein, Neuroscience 120 (2003) 121 – 131. [9] T. Ota, Y. Suzuki, T. Nishikawa, T. Otsuki, T. Sugiyama, R. Irie, A. Wakamatsu, K. Hayashi, H. Sato, K. Nagai, et al., Complete sequencing and characterization of 21,243 full-length human cDNAs, Nat. Genet. 36 (2004) 40 – 45. [10] K. Shibata, M. Itoh, K. Aizawa, S. Nagaoka, N. Sasaki, P. Carninci, H. Konno, J. Akiyama, K. Nishi, T. Kitsunai, et al., RIKEN integrated sequence analysis (RISA) system-384-format sequencing pipeline with 384 multicapillary sequencer, Genome Res. 10 (2000) 1757 – 1771. [11] P. Carninci, Y. Shibata, N. Hayatsu, Y. Sugahara, K. Shibata, M. Itoh, H. Konno, Y. Okazaki, M. Muramatsu, Y. Hayashizaki, Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes, Genome Res. 10 (2000) 1617 – 1630. [12] J. Kawai, A. Shinagawa, K. Shibata, M. Yoshino, M. Itoh, Y. Ishii, T. Arakawa, A. Hara, Y. Fukunishi, H. Konno, et al., Functional annotation of a full-length mouse cDNA collection, Nature 409 (2001) 685 – 690. [13] J. Sambrook, E. Fitsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, 1989. [14] H. Nakagama, G. Heinrich, J. Pelletier, D.E. Housman, Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product, Mol. Cell. Biol. 15 (1995) 1489 – 1498. [15] C. Zuccato, M. Tartari, A. Crotti, D. Goffredo, M. Valenza, L. Conti, T. Cataudella, B.R. Leavitt, M.R. Hayden, T. Timmusk, et al., Huntingtin interacts with REST/NRSF to modulate the transcription of NRSE-controlled neuronal genes, Nat. Genet. 35 (2003) 76 – 83. [16] G.C. Perez-Alvarado, C. Miles, J.W. Michelsen, H.A. Louis, D.R. Winge, M.C. Beckerle, M.F. Summers, Structure of the carboxyterminal LIM domain from the cysteine rich protein CRP, Nat. Struct. Biol. 1 (1994) 388 – 398. [17] C.J. Schoenherr, A.J. Paquette, D.J. Anderson, Identification of potential target genes for the neuron-restrictive silencer factor, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 9881 – 9886. [18] E.A. Lundquist, R.K. Herman, J.E. Shaw, C.I. Bargmann, UNC115, a conserved protein with predicted LIM and actin-binding domains, mediates axon guidance in C. elegans, Neuron 21 (1998) 385 – 392. [19] E.C. Struckhoff, E.A. Lundquist, The actin-binding protein UNC-115 is an effector of Rac signaling during axon pathfinding in C. elegans, Development 130 (2003) 693 – 704. [20] L. Erkman, P.A. Yates, T. McLaughlin, R.J. McEvilly, T. Whisenhunt, S.M. O’Connell, A.I. Krones, M.A. Kirby, D.H. Rapaport, J.R.
E. Klimov et al. / Biochimica et Biophysica Acta 1730 (2005) 1 – 9 Bermingham, et al., A POU domain transcription factor-dependent program regulates axon pathfinding in the vertebrate visual system, Neuron 28 (2000) 779 – 792. [21] D. Leonoudakis, L.R. Conti, S. Anderson, C.M. Radeke, L.M. McGuire, M.E. Adams, S.C. Froehner, J.R. Yates III, C.A. Vandenberg, Protein trafficking and anchoring complexes revealed by proteomic
9
analysis of inward rectifier potassium channel (Kir2.x)-associated proteins, J. Biol. Chem. 279 (2004) 22331 – 22346. [22] Z. Gitai, T.W. Yu, E.A. Lundquist, M. Tessier-Lavigne, C.I. Bargmann, The netrin receptor UNC-40/DCC stimulates axon attraction and outgrowth through enabled and, in parallel, Rac and UNC115/AbLIM, Neuron 37 (2003) 53 – 65.