- Email: [email protected]
Germline Stem Cells Drive Ovary Regeneration in Zebrafish
Report
Germline Stem Cells Drive Ovary Regeneration in Zebrafish Graphical Abstract
Authors Zigang Cao, Xiaoyu Mao, Lingfei Luo
Correspondence [email protected]
In Brief Germline stem cells maintain ovarian high fecundity throughout the life cycle in zebrafish. Cao et al. demonstrate that the GSC marker nanos2 is required for the maintenance of GSCs and provide evidence that ovary regeneration is a GSC-driven process in zebrafish.
Highlights d
d
d
d
nanos2 is required for the maintenance of GSCs Ablation of GSCs causes conversion of ovaries to sterile testes GSC-driven ovary regeneration is defective in the nanos2 mutant Wnt signaling regulates GSC-driven ovary regeneration
Cao et al., 2019, Cell Reports 26, 1709–1717 February 12, 2019 ª 2019 The Authors. https://doi.org/10.1016/j.celrep.2019.01.061
Cell Reports
Report Germline Stem Cells Drive Ovary Regeneration in Zebrafish Zigang Cao,1,2 Xiaoyu Mao,1 and Lingfei Luo1,3,* 1Key Laboratory of Freshwater Fish Reproduction and Development, Ministry of Education, Laboratory of Molecular Developmental Biology, School of Life Sciences, Southwest University, Beibei, 400715 Chongqing, China 2Jiangxi Key Laboratory of Organ Developmental Biology, College of Life Sciences, JingGangShan University, Ji’an, 343009 Jiangxi, China 3Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2019.01.061
SUMMARY
Germline stem cells (GSCs) sustain gametogenesis during the organismal life cycle. Although evidence suggests that GSCs are consistently present in the zebrafish ovary and support oogenesis, whether GSCs are involved in zebrafish ovary regeneration is poorly understood. Here, we found that nanos2, a conserved vertebrate GSC marker, is required for maintaining GSCs in zebrafish. We applied genetic ablation and tissue resection techniques to delineate the function of GSCs in zebrafish ovary regeneration. After GSC ablation, ovaries fail to regenerate and are converted to sterile testes. Amputated ovarian tissues completely regenerate as a result of the proliferation of residual GSCs, but nanos2 mutant ovaries fail to regenerate after amputation due to a lack of GSCs. The repression of Wnt signaling leads to reduced numbers of GSCs and delayed ovary regeneration. Our results provide insight into the key role of GSCs in driving ovary regeneration. INTRODUCTION Stem cells are a population of cells that are able to self-renew and produce differentiated progenies, which play important roles in embryonic development, tissue homeostasis, and regeneration. The germline stem cell is an unipotent stem cell type because it exclusively gives rise to two end-differentiated cell types, namely, sperm or oocyte (Yuan and Yamashita, 2010). In the mammalian ovary, oogenesis is completed after birth. It is widely accepted that the postnatal ovary is endowed by a fixed and non-renewing number of oocytes (Smith et al., 2014). A few reports suggest that mammals have stem-like germ cells and mitotic oogonia in their postnatal ovaries, which still remains controversial (Eggan et al., 2006; Johnson et al., 2004; Zou et al., 2009). Nevertheless, some lower vertebrates obtain high fecundity throughout their life, indicating the presence of GSCs in their mature ovaries. In the ovary of adult medaka fish, GSCs have been identified by lineage-tracing experiments, which are specifically labeled by nanos2 and surrounded by sox9b-expressing somatic cells (Nakamura et al., 2010). Some reports suggest that the presence of GSCs in zebrafish sustain
oocyte production (Beer and Draper, 2013; Draper, 2017; Draper et al., 2007; Wong et al., 2011). But key factors involved in this process remain to be elucidated. Zebrafish has strong regenerative capabilities and becomes a powerful vertebrate model to study cellular and molecular mechanisms of organ regeneration (Gemberling et al., 2013). The commonly used techniques include the metronidazole (MTZ) and bacterial nitroreductase (NTR)-mediated ablation of specific cell types (Curado et al., 2007; He et al., 2014) and tissue resection or injury (Poss et al., 2002). Reproductive organs of low vertebrates, such as fish, have powerful regenerative capabilities. For example, oocytes in adult zebrafish after ablation by MTZ under the Tg(zpc:G4VP16/UAS: NfsB-mCherry) transgenic background achieve recoveries (White et al., 2011). Although the point that ovary regeneration is due to the proliferation of residual germ cells has been raised, the roles and functional mechanisms of GSCs in ovary regeneration are rarely described. Signaling pathways have been reported to regulate tissue regeneration (Kawakami et al., 2006; Wills et al., 2008; Zhao et al., 2014). However, the pathways involved in gonadal regeneration are poorly understood. Wnt signaling regulates ovary development and sex determination in vertebrates (Chassot et al., 2011; Naillat et al., 2010; Sreenivasan et al., 2014; Vainio et al., 1999). Therefore, whether Wnt signaling plays regulatory roles in GSC behaviors and ovary regeneration is worth investigating. In this study, we show that a nanos2 mutation led to the loss of GSCs and a female-to-male sex reversal, revealing the roles of nanos2 in the maintenance of zebrafish GSCs. Furthermore, we established two zebrafish ovary regeneration models, including genetic ablation and tissue amputation, by using the Tg(vasa:Dendra2-NTR-vasa 30 UTR)cq41 transgenic line. Our data show that ovary regeneration is mainly driven by GSCs, in which Wnt signaling plays regulatory roles. RESULTS nanos2 Is Required for the Maintenance of GSCs Similar to medaka (Nakamura et al., 2010), zebrafish nanos2 is exclusively expressed in cells with GSC characteristics in the gonads of both females and males (Beer and Draper, 2013; Draper, 2017). To investigate the functions of nanos2, we generated two zebrafish nanos2 mutant alleles by using CRISPR/Cas9 mutagenesis (Chang et al., 2013; Hruscha et al., 2013), in which two and seven base pairs (bps) within the nanos2 genetic loci were
Cell Reports 26, 1709–1717, February 12, 2019 ª 2019 The Authors. 1709 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
deleted, respectively. These deletions led to a frameshift of the open reading frame and the creation of premature stop codons in the Nanos2 Zinc finger-nanos RNA-binding domain (Figures 1A and 1B). The expression of nanos2 in the sexually bi-potential gonad was initiated from 21 days post-fertilization (dpf) (Beer and Draper, 2013); therefore, analyses of the mutant gonads were carried out after that. No difference was observed in the mutant gonads compared to the wild-type (WT) at 21 dpf, 25 dpf, and 28 dpf (Figures 1C–1E00 ), suggesting that the establishment of GSCs occurs independent of nanos2. However, at 32 dpf when sex has been determined, GSCs specifically labeled by nanos2 became absent in the nanos2 mutant (Figures 1F–1F00 ). At 35 dpf, the early stage germ cells, including mitotically dividing oogonia and cells that are actively entering meiosis cells (stage IA oocytes), were absent in the nanos2-mutant ovaries in contrast to wild-type (Figures 1G–1G00 ). The nanos2 mutant testes have no germ cells at 35 dpf (Figures S1A and S1B). From 60 dpf to 75 dpf, the female nanos2 mutants became sex-reverted to males without detectable germ cells, based on the phenotypic conversion of mutant gonads, cloacae, and fin pigmentations (Figures S1C–S1K00 ). Eventually, the nanos2 mutants exclusively developed into sterile males (Figures 1H–1J00 ) due to a lack of GSCs. These results indicate that zebrafish nanos2 is required for the maintenance of GSCs, similar to the requirement of nanos2 for maintaining GSCs in the testis in mice (Sada et al., 2009). To further confirm the requirement of nanos2 in the maintenance of the ovary, we generated the Tg(hsp70l:nanos2-nanos2 30 UTR)cq42, abbreviated as Tg(hsp70l:nanos2)cq42, transgenic line to replenish Nanos2 in the nanos2 mutant. Heat shock was performed once per day from 21 dpf on, and the ovaries were analyzed at 40 dpf. The results show that the mutant ovaries do have early germ cells after the replenishment of Nanos2, similar to wild-type (Figures 1L–1N), suggesting that the replenishment of nanos2 rescues ovary maintenance. Genetic Ablation of GSCs Causes Failure of Ovary Regeneration To study the roles of GSCs in zebrafish ovary regeneration, we generated the Tg(vasa: Dendra2-NTR-vasa 30 UTR)cq41 transgenic line, abbreviated as Tg(vasa:DenNTR)cq41, with the fluorescent protein Dendra2 fused to NTR and driven by the germline-specific promoter vasa. Tg(vasa:egfp) was reported to exclusively express in oocytes but not pre-meiotic cells (Leu and Draper, 2010). In our transgenic line, the Dendra2 fully overlapped with Vasa in germ cells of the Tg(vasa:DenNTR)cq41 females (Figure 2A), indicating that Dendra2 is able to label all of the germ cells. The adult Tg(vasa:DenNTR)cq41 females at three months of age (Figures 2B and 2B0 ) were incubated with 8 mM Mtz for one week to ablate germ cells. The ovary size largely decreased at 5 days post-treatment (dpt) (Figures 2C and 2C0 ). Furthermore, except for stage I and II oocytes, all the other germ cells were ablated compared to the control (Figures 2B00 and 2C00 ). At 30 dpt, although the ovarian volume increased (Figure 2D), Dendra2 epifluorescence (Figure 2D0 ) and the early stage germ cells were non-detectable (Figure 2D00 ). At 60 dpt, only stage V mature cells still resided in the ovaries (Figures 2E–2E00 ). Although females at
1710 Cell Reports 26, 1709–1717, February 12, 2019
this stage could still produce eggs, the majority of eggs were unfertilizable (Table S1). Finally, at 90 dpt, the Tg(vasa:DenNTR)cq41 females treated with Mtz reverted to sterile males (Figures 2F– 2F00 and S2A–S2H). To further confirm whether GSCs are completely ablated by Mtz, Vasa antibody staining was carried out, showing an absence of early stage germ cells in the ovaries at 5 dpt (Figures S2I and S2J). Moreover, the ovaries at 5 dpt did not express nanos2 (Figures S2K and S2L) and the meiotic entry marker sycp3 (Lammers et al., 1994) (Figures S2M and S2N), indicating complete ablation of GSCs and meiotic entry cells. After a withdrawal of Mtz, no early stage germ cells appeared and the females were unable to continuously produce oocytes due to a lack of GSCs. The number of oocytes in the ovaries was limited, similar to the mammalian postnatal ovaries. Because germ cells are essential for maintaining ovaries in zebrafish (Dranow et al., €sslein-Volhard, 2008; Tzung et al., 2013; Siegfried and Nu 2015), the females treated with Mtz spawned all of the mature eggs and ultimately reverted to the sterile males (Figures S2A– S2H). Consistent with previously reported data that pre-meiotic germ cells isolated from an adult ovary and transplanted into sterile zebrafish led to the restoration of germ cell production and fertility (Wong et al., 2011), our results indicate that ovary regeneration fails to occur without GSCs. GSCs Proliferate and Drive Ovary Regeneration To explore the roles of GSCs in ovary regeneration, ovarian tissue amputation was performed as another regeneration model. Approximately 95% of left ovarian tissues were removed at 50 dpf (Figures 3A, 3B, and 3F). The amputated ovary barely regenerated at 5 days post-amputation (dpa) (Figures 3C and 3F). However, at 15 dpa, the remaining ovarian tissues exhibited an approximately ten-fold amplification (Figures 3D and 3F). At 30 dpa, the ovary regenerated to a size comparable to that before amputation (Figures 3E and 3F). At around 50 dpa, the amputated females were able to produce fertilizable eggs, suggesting a full recovery of their reproductive functions. In contrast, regeneration failed to occur when the left ovary was completely removed (Figures 3A0 –3F0 ), indicating that the remaining ovarian tissues are essential for the ovary regeneration. In addition, when the majority of left ovarian tissues were removed in 4-month-old adults, regeneration completed at 20 dpa (Figure S3A). These results indicate the strong regenerative capability of the zebrafish ovary. To determine whether the regeneration was mediated by GSCs in the remaining ovarian tissues, we assessed the number and proliferation of GSCs by fluorescence in situ hybridization (FISH) of nanos2 and 5-ethynyl-20 -deoxyuridine (EdU)-labeling assays. In contrast to controls at different stages, including 50 dpf, 65 dpf, and 80 dpf, the number of proliferative GSCs in the post-amputated ovaries at 15 dpa (equivalent to 65 dpf) significantly increased (Figures 3G–3L). qRT-PCRs showed an upregulation of nanos2 expression at 15 dpa/65 dpf compared to the controls (Figure 3M), suggesting that the injury signals activate the proliferation of GSCs. Similar results were obtained during adult ovary regeneration (Figures S3B–S3D). These data show that the proliferation of residual GSCs is activated by ovary injuries.
Figure 1. nanos2 Is Required for Maintaining GSCs (A) Schematic diagram of nanos2 genomic structure and mutation genotypes. (B) Schematic representation of the protein functional domains of nanos2 from wild-type (WT) and two kinds of mutants (Zf-nanos, Zinc finger-nanos). (C–G) Body length of wild-type (WT) and nanos2 homozygous at 21 (C), 25 (D), 28 (E), 32 (F), and 35 (G) dpf. (C0 –G0 0 ) Triple fluorescent labeling with FISH-nanos2, anti-Vasa antibodies, and 40 ,6-diamidino-2-phenylindole (DAPI) staining in the ovaries of wild-type and nanos2 homozygous at 21, 25, 28, 32, and 35 dpf. Note loss of GSCs (arrowheads) in the mutant starting at 32 dpf. (H–J) Adult wild-type female (H), the nanos2 mutant (I), and wild-type males (J). (H0 –J0 ) Lateral views of gonads. (H0 0 –J0 0 ) H&E staining of gonad sections shows that all of the nanos2 mutants develop into the sterile males. (K–M) At 40 dpf after heat-shock, double staining by anti-Vasa antibodies, and DAPI in the nanos2 mutants with (L) or without (K) Tg(hsp701:nanos2) transgenic background, and in the wild-type (M) shows that overexpression of nanos2 could rescue the phenotypes of nanos2 mutant. Arrows indicate early germ cells. Oo, oogonia; IAz, zygotene-stage-IA; IB, stage IB oocyte. Scale bars: 500 mm (C–G), 50 mm (C0 –G0 0 ), 1 mm (H0 –J0 ), 200 mm (H0 0 –J0 0 ), 50 mm (K–M). See also Figure S1.
Cell Reports 26, 1709–1717, February 12, 2019 1711
Figure 2. Ovary Regeneration Is Defective after Genetic Ablation of GSCs and Sex Reversal Finally Occurs (A) Comparison of Vasa protein and vasa:DenNTR expression in ovary shows the Dendra2 fully overlaps with Vasa, suggesting that vasa:DenNTR is able to label all of the germ cells. (B–B0 0 ) The Tg(vasa:DenNTR)cq41 females of about 3 months old have big ovaries in bright field (BF) (B), strong green fluorescent (B0 ), and different stage germ cells (B0 0 ). (C–C0 0 ) At 5 dpt, the ovarian size largely decreases (C and C0 ) and except stage I and II oocytes, the germ cells are ablated by Mtz (C0 0 ). (D–D0 0 ) The ovaries become large and have mature oocytes at 30 dpt (D) but little green fluorescent is observed (D0 ), and the early stage germ cells were not detected (D0 0 ). (E–E0 0 ) By 60 dpt, the fish ovaries only have stage V cells. (F–F0 0 ) Testis (arrowheads) that lack germ cells appears at 90 dpt, showing that the females treated with Mtz reverted to sterile males. Oo, oogonia; IAz, zygotene-stage-IA; IA, stage IA oocytes; IB, stage IB oocyte; II, stage II oocyte; III, stage III oocyte; IV, stage IV oocyte; V, stage V oocyte. Scale bars: 50 mm (A), 1 mm (B–F0 ), 200 mm (B0 0 –F0 0 ). See also Figure S2.
To investigate the functional significance of GSCs in ovary regeneration, nanos2 mutants with defects in GSC maintenance were analyzed. Because a complete loss of GSCs initially appears at 32 dpf in the nanos2 mutant (Figure 1F00 ), amputation of the ovary was performed at this stage. In contrast to gradual regeneration of wild-type ovaries within a week (Figures 4A– 4E), defects in ovary regeneration were observed in the nanos2 mutant at 4 dpa and 7 dpa (Figures 4A0 –4D0 and 4E). However, defective ovary regeneration in the nanos2 mutant was rescued by the replenishment of Nanos2 through continuous heat shock from 21 dpf under the Tg(hsp70l:nanos2) background (Figures 4A00 –4D00 and 4E). Furthermore, at 4 dpa, the nanos2-expressing GSCs were absent in the nanos2 mutant (Figures 4F and 4G),
1712 Cell Reports 26, 1709–1717, February 12, 2019
which was confirmed by FISH of ziwi that is normally expressed in both GSCs and other germ cells, such as vasa (Figures 4H and 4I). Because the nanos2 mutant lacks both GSCs and other germ cells after 35 dpf (Figures 1G00 , 4G, and 4I), we further investigated whether the ovary regeneration is mainly driven by GSCs or the proliferation of existing germ cells. Continuous heat shock was applied from 21 dpf on but stopped at 2 dpa/34 dpf. At 4 dpa, two days after termination of heat shock, all the germ cells remained in the regenerating ovary except the nanos2+ GSCs (Figure 4J). Consequently, termination of heat shock led to the discontinuation of ovary regeneration from 4 dpa to 7 dpa (Figures 4A000 , 4D000 , and 4E). These results demonstrate that GSCs are required for ovary regeneration.
Figure 3. Residual GSCs Are Highly Proliferative during Ovary Regeneration (A–E) Most of the left ovary was removed and could be completely recovered in a month. Zebrafish ovary at 50 dpf/before amputation (A), 0 (B), 5 (C), 15 (D), and 30 (E) dpa. Arrowheads indicate the remaining or regenerating ovarian tissues (n = 5). (A0 –E0 ) Complete amputation of the left ovary causes failure of regeneration (n = 5). (F and F0 ) Quantification of ovary surface area at 0, 5, 15, and 30 dpa. Values represent the size of the largest left ovary surface area (n = 5, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). (G–J) Triple fluorescent labeling of ovaries with FISH-nanos2, anti-Vasa antibodies, and EdU at different stages including 50 (G), 65 (I), and 80 (J) dpf without amputation, as well as 15 dpf/65 dpf after amputation (H). Note the increased number and proliferation of nanos2-positive cells (arrowheads) at 15 dpa. (K) Quantification of nanos2-positive cells per left ovary before amputation and at 15 dpa, 65 dpf, and 80 dpf (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). (L) Quantification of nanos2+ EdU+ double-positive cells per left ovary before amputation and at 15 dpa, 65 dpf, and 80 dpf. (n = 7, mean ± SEM, **p < 0.01, *p < 0.05, two-tailed t test, error bars indicate SEM). (M) nanos2 expression level measured by qRT-PCR (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). Scale bars: 1 mm (A–E0 ), 50 mm (G–J). See also Figure S3.
Cell Reports 26, 1709–1717, February 12, 2019 1713
Figure 4. The Ovary of nanos2 Mutant Fails to Regenerate
(A–D0 ) The ovaries of the wild-type juvenile under the Tg(vasa:DenNTR)cq41 transgenic background were imaged at before amputation/32 dpf (A), 0 (B), 4 (C), and 7 (D) dpa. The ovaries of nanos2 mutant were imaged at the same stages (A0 –D0 ), showing little regeneration in contrast to the wild-type (A–D). (A0 –D0 ) The nanos2 mutants juvenile with Tg(vasa:DenNTRcq41; hsp70l:nanos2cq42) genetic background were heated shock from 21 dpf on and the ovaries were amputated at 32 dpf. (A0 0 –D0 0 ) Heat-shock (hs) is from 21 dpf to 7 dpa/39 dpf. (A0 0 0 –D0 0 0 ) Heat-shock is from 21 dpf to 2 dpa/34 dpf. (E) Quantification of ovary surface area of wild-type and nanos2 mutant at 0, 4, and 7 dpa. (n = 5, mean ± SEM, ***p < 0.001, **p < 0.01, NS represents no significance, two-tailed t test, error bars indicate SEM). (F and G) Triple fluorescent labeling with FISH-nanos2, anti-Vasa antibodies, and DAPI staining in the ovaries of wild-type (F) and the nanos2 mutant (G) 4 dpa. (H and I) Double labeling of FISH-ziwi and DAPI staining in the ovaries of wild-type (H) and nanos2 mutant (I) at 4 dpa. (J) Triple fluorescent labeling with nanos2 RNA probe, Vasa antibodies, and DAPI staining in the nanos2 homozygous ovaries at 4 dpa, which were heat-shocked from 21 dpf to 2 dpa. Scale bars: 500 mm (A–D0 0 0 ), 50 mm (F–J).
Inhibition of Wnt Signaling Compromises Ovary Regeneration Wnt signaling plays important roles in the regulation of sex determination and ovary development in zebrafish (Sreenivasan et al., 2014). To explore the involvement of Wnt signaling in regeneration, we first examined the expression of lymphocyte enhancer
1714 Cell Reports 26, 1709–1717, February 12, 2019
binding factor 1 (lef1), a Wnt target gene (Kawakami et al., 2006). In contrast to 0 dpt, lef1 expression at 2 dpa was upregulated (Figures 5A and 5B), suggesting activation of Wnt signaling after injury and its potential involvement in ovary regeneration. To further investigate the functional significance of Wnt signaling in ovary regeneration, a Tg(hsp70l:dkk1b-GFP) transgenic
Figure 5. Wnt Signaling Is Activated and Regulates Ovary Regeneration (A) RNA fluorescent in situ hybridization of lef1 shows upregulation of lef1 expression at 2 dpa compared to 0 dpa. (B) lef1 expression level measured by qRT-PCR (***p < 0.001, two-tailed t test, error bars indicate SEM). (C) The ovary regeneration in dkk1b-overexpressing fish is blocked at 5 dpa compared to heat-shocked wild-type (hsWT). The red lines represented the distance between two remaining ovarian tissues after amputation. (D) Quantification of the red line lengths of hsWT and hsDkk1b at 0 dpa and 5 dpa for 7 samples in the same group (n = 7). (E) Quantification of regenerative ratio of hsWT and hsDkk1b at 5 dpa (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). (F) Triple fluorescent labeling with nanos2 RNA probe, Vasa antibodies, and DAPI staining both in the hsWT and hsDkk1b fishes at 5 dpa. Arrowheads point to GSCs. (G) Quantification of the number of GSCs in the ovarian remnant per left ovary at 5 dpa (n = 7, mean ± SEM, **p < 0.01, two-tailed t test, error bars indicate SEM). (H) nanos2 expression level measured by qRTPCR (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). Scale bars: 100 mm (A), 1 mm (C), 50 mm (F). See also Figures S4 and S5.
line with inducible Dickkopf, a secreted inhibitor of Wnt signaling, was applied. The Tg(vasa:DenNTRcq41; hsp70l:dkk1b-GFP) double-transgenic juvenile fishes were heat-shocked for 2 h per day after ovary amputation. At 5 dpa, ectopic expression of Dkk1b-GFP led to delayed ovary regeneration (Figures 5C– 5E) as well as significantly reduced numbers of GSCs and reduced expression of nanos2 (Figures 5F–5H). To validate these results, a chemical inhibitor of Wnt signaling, XAV939, was applied. XAV939 caused delayed ovary regeneration (Figures S4A–S4C) and reduced GSC numbers and nanos2 expression (Figures S4D–S4F). These results suggest that inhibition of Wnt signaling suppresses GSC proliferation and ovary regeneration. To further explore whether fibroblast growth factor (FGF) and bone morphogenetic protein (Bmp) signaling pathways are involved in ovary regeneration, genetic inhibitions using the Tg(hsp70l:dnfgfr1-EGFP) and Tg(hsp70l:dnbmpr1-GFP) transgenic backgrounds or chemical inhibitors BGJ-398 and DMH1 were used to inhibit FGF and Bmp signaling, respectively. Neither ectopically expressed dnFgfr1-EGFP/dnBmpr1-GFP (Figures S5A–S5C) nor BGJ-398/DMH1 (Figures S5D–S5F) affect ovary regeneration, suggesting that FGF and Bmp signaling are not involved in ovary regeneration.
DISCUSSION In this study, we explored the roles of GSCs in zebrafish ovary regeneration. Our data reveal that zebrafish ovary regeneration is mainly driven by GSCs. First, nanos2 mutant analyses suggest that zebrafish oocyte production is a GSC-driven process. Moreover, a complete genetic ablation of GSCs in the adult ovary leads to sex reversal and infertility, whereas the amputated ovarian tissues completely regenerate in a GSC-dependent manner. Wnt signaling is activated by the amputation and regulates GSC proliferation and nanos2 expression during regeneration. However, current results are limited without the lineage-tracing experiments to further confirm GSC-driven ovary regeneration. Previous studies have shown that nanos2 expression is exclusively restricted to GSCs in both medaka and mice (Nakamura et al., 2010; Sada et al., 2009). Although the mutation analyses showing the roles of nanos2 in maintaining GSCs have so far only been reported in mice testis (Sada et al., 2009), this function is potentially conserved in vertebrates. The ovarian phenotypes of the zebrafish nanos2 mutant in this study was similar to a previously described nanos3 mutant (Beer and Draper, 2013; Draper et al., 2007), suggesting partially redundant roles of
Cell Reports 26, 1709–1717, February 12, 2019 1715
nanos2 and nanos3 in maintaining female GSCs. However, nanos3 is exclusively expressed in females (Draper et al., 2007), whereas nanos2 is detectable in the GSCs of both ovary and testis (Beer and Draper, 2013) and, thus, is able to maintain GSCs in both females and males. Three NTR-Mtz models have been generated to ablate germ cells. Two of them were established using the zp promoter (Hu et al., 2010; White et al., 2011), and the remaining one was based on the ziwi promoter (Dranow et al., 2013). Because zp is exclusively expressed in oocytes (Liu et al., 2006; Onichtchouk et al., 2003), these models cannot ablate GSCs. ziwi, similar to vasa, is detectable in all germ cells (Houwing et al., 2007; Leu and Draper, 2010). But the mild Mtz treatment conditions did not completely ablate GSCs. So, the Tg(ziwi:CFP-NTR) females treated with Mtz ultimately reverted to the fertile males (Dranow et al., 2013). The ovarian phenotypes of our model at 5 dpt after withdrawal of Mtz are similar to those of the nanos2 mutant at 35 dpf, in which GSCs are missing. A minimal number of oocytes is required to maintain stable female phenotypes in zebrafish €sslein-Volhard, 2008; (Dranow et al., 2013; Siegfried and Nu Tzung et al., 2015), similar to postnatal mammalian ovary that is endowed by a finite egg number. Sex reversal in the females treated with Mtz suggests that GSCs are essential for the maintenance of prolific reproductive capacity and sexual phenotypes of the female zebrafish. Ovary amputation experiments exhibit the regenerative capacity of the zebrafish ovary, which can be used for further studies of cellular and molecular mechanisms of ovary regeneration. The ovaries at the two months of age generally contain only a small amount of GSCs, which are mainly localized in the ovarian GSC niche (Beer and Draper, 2013; Xie, 2008). When most of the ovarian tissues at one side are removed, the injury microenvironments stimulate proliferation of the remaining ovarian GSCs. Replenishment of Nanos2 from 21 dpf to 2 dpa/ 34 dpf in the nanos2 mutant restores all types of germ cells at 4 dpa except the nanos2+ GSCs, which leads to discontinuation of ovary regeneration after 4 dpa. These results highlight the essential role of GSCs in ovary regeneration but do not exclude the possibility that the existing germ cells support regeneration by transforming into nanos2+ GSCs. Further lineage tracing or transplantation experiments are required to address this issue. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d d
KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Animals METHOD DETAILS B CRISPR/Cas9 B Metronidazole treatment B Zebrafish ovary resection B In situ hybridizations, Antibody staining and EdU labeling assays B Histology
1716 Cell Reports 26, 1709–1717, February 12, 2019
B
Plasmid construction and qRT-PCR Heat Shock B Chemical treatments QUANTIFICATION AND STATISTICAL ANALYSIS B
d
SUPPLEMENTAL INFORMATION Supplemental Information includes five figures and five tables and can be found with this article online at https://doi.org/10.1016/j.celrep.2019.01.061. ACKNOWLEDGMENTS We thank H. Knaut for anti-Vasa antibody and J. Chen, J. He, and L. Le for discussions and technical assistances. This work was supported by the National Key Basic Research Program of China (2015CB942800), National Natural Science Foundation of China (31730060, 31330051, 81860282, and 91539201), the 111 Program (B14037), Fundamental Research Funds for the Central Universities (XDJK2017A007), Natural Science Foundation Project of Jiangxi Province (20171BAB204018), and Science and Technology Foundation of the Education Department of Jiangxi Province (GJJ160735). AUTHOR CONTRIBUTIONS L.L. and Z.C. designed the experimental strategy, analyzed data, and wrote the manuscript; X.M. performed H&E staining and nanos2 mutant phenotype analyses; and Z.C. performed all the other experiments. DECLARATION OF INTERESTS The authors declare no competing interests. Received: May 6, 2018 Revised: December 20, 2018 Accepted: January 16, 2019 Published February 12, 2019 REFERENCES Beer, R.L., and Draper, B.W. (2013). nanos3 maintains germline stem cells and expression of the conserved germline stem cell gene nanos2 in the zebrafish ovary. Dev. Biol. 374, 308–318. Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., and Xi, J.J. (2013). Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23, 465–472. Chassot, A.A., Gregoire, E.P., Lavery, R., Taketo, M.M., de Rooij, D.G., Adams, I.R., and Chaboissier, M.C. (2011). RSPO1/b-catenin signaling pathway regulates oogonia differentiation and entry into meiosis in the mouse fetal ovary. PLoS One 6, e25641. Curado, S., Anderson, R.M., Jungblut, B., Mumm, J., Schroeter, E., and Stainier, D.Y. (2007). Conditional targeted cell ablation in zebrafish: a new tool for regeneration studies. Dev. Dyn. 236, 1025–1035. Dranow, D.B., Tucker, R.P., and Draper, B.W. (2013). Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. Dev. Biol. 376, 43–50. Draper, B.W. (2017). Identification of germ-line stem cells in zebrafish. Methods Mol. Biol. 1463, 103–113. Draper, B.W., McCallum, C.M., and Moens, C.B. (2007). nanos1 is required to maintain oocyte production in adult zebrafish. Dev. Biol. 305, 589–598. Eggan, K., Jurga, S., Gosden, R., Min, I.M., and Wagers, A.J. (2006). Ovulated oocytes in adult mice derive from non-circulating germ cells. Nature 441, 1109–1114. Gemberling, M., Bailey, T.J., Hyde, D.R., and Poss, K.D. (2013). The zebrafish as a model for complex tissue regeneration. Trends Genet. 29, 611–620.
He, J., Lu, H., Zou, Q., and Luo, L. (2014). Regeneration of liver after extreme hepatocyte loss occurs mainly via biliary transdifferentiation in zebrafish. Gastroenterology 146, 789–800.e788. Houwing, S., Kamminga, L.M., Berezikov, E., Cronembold, D., Girard, A., van den Elst, H., Filippov, D.V., Blaser, H., Raz, E., Moens, C.B., et al. (2007). A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell 129, 69–82. Hruscha, A., Krawitz, P., Rechenberg, A., Heinrich, V., Hecht, J., Haass, C., and Schmid, B. (2013). Efficient CRISPR/Cas9 genome editing with low offtarget effects in zebrafish. Development 140, 4982–4987. Hu, S.Y., Lin, P.Y., Liao, C.H., Gong, H.Y., Lin, G.H., Kawakami, K., and Wu, J.L. (2010). Nitroreductase-mediated gonadal dysgenesis for infertility control of genetically modified zebrafish. Mar. Biotechnol. (NY) 12, 569–578. Johnson, J., Canning, J., Kaneko, T., Pru, J.K., and Tilly, J.L. (2004). Germline stem cells and follicular renewal in the postnatal mammalian ovary. Nature 428, 145–150. Kawakami, Y., Rodriguez Esteban, C., Raya, M., Kawakami, H., Martı´, M., Dubova, I., and Izpisu´a Belmonte, J.C. (2006). Wnt/beta-catenin signaling regulates vertebrate limb regeneration. Genes Dev. 20, 3232–3237. €sslein-Volhard, C. Knaut, H., Pelegri, F., Bohmann, K., Schwarz, H., and Nu (2000). Zebrafish vasa RNA but not its protein is a component of the germ plasm and segregates asymmetrically before germline specification. J. Cell Biol. 149, 875–888. Krøvel, A.V., and Olsen, L.C. (2002). Expression of a vas:EGFP transgene in primordial germ cells of the zebrafish. Mech. Dev. 116, 141–150. Lammers, J.H., Offenberg, H.H., van Aalderen, M., Vink, A.C., Dietrich, A.J., and Heyting, C. (1994). The gene encoding a major component of the lateral elements of synaptonemal complexes of the rat is related to X-linked lymphocyte-regulated genes. Mol. Cell. Biol. 14, 1137–1146. Leu, D.H., and Draper, B.W. (2010). The ziwi promoter drives germline-specific gene expression in zebrafish. Dev. Dyn. 239, 2714–2721. Liu, X., Wang, H., and Gong, Z. (2006). Tandem-repeated Zebrafish zp3 genes possess oocyte-specific promoters and are insensitive to estrogen induction. Biol. Reprod. 74, 1016–1025. Liu, C., Wu, C., Yang, Q., Gao, J., Li, L., Yang, D., and Luo, L. (2016). Macrophages mediate the repair of brain vascular rupture through direct physical adhesion and mechanical traction. Immunity 44, 1162–1176. Lu, H., Ma, J., Yang, Y., Shi, W., and Luo, L. (2013). EpCAM is an endodermspecific Wnt derepressor that licenses hepatic development. Dev. Cell 24, 543–553. Naillat, F., Prunskaite-Hyyryla¨inen, R., Pietila¨, I., Sormunen, R., Jokela, T., Shan, J., and Vainio, S.J. (2010). Wnt4/5a signalling coordinates cell adhesion and entry into meiosis during presumptive ovarian follicle development. Hum. Mol. Genet. 19, 1539–1550. Nakamura, S., Kobayashi, K., Nishimura, T., Higashijima, S., and Tanaka, M. (2010). Identification of germline stem cells in the ovary of the teleost medaka. Science 328, 1561–1563. €gge, L., and Driever, W. (2003). Onichtchouk, D., Aduroja, K., Belting, H.G., Gnu Transgene driving GFP expression from the promoter of the zona pellucida
gene zpc is expressed in oocytes and provides an early marker for gonad differentiation in zebrafish. Dev. Dyn. 228, 393–404. Poss, K.D., Wilson, L.G., and Keating, M.T. (2002). Heart regeneration in zebrafish. Science 298, 2188–2190. Sada, A., Suzuki, A., Suzuki, H., and Saga, Y. (2009). The RNA-binding protein NANOS2 is required to maintain murine spermatogonial stem cells. Science 325, 1394–1398. Shin, D., Shin, C.H., Tucker, J., Ober, E.A., Rentzsch, F., Poss, K.D., Hammerschmidt, M., Mullins, M.C., and Stainier, D.Y. (2007). Bmp and Fgf signaling are essential for liver specification in zebrafish. Development 134, 2041–2050. Shin, D., Weidinger, G., Moon, R.T., and Stainier, D.Y. (2012). Intrinsic and extrinsic modifiers of the regulative capacity of the developing liver. Mech. Dev. 128, 525–535. €sslein-Volhard, C. (2008). Germ line control of female Siegfried, K.R., and Nu sex determination in zebrafish. Dev. Biol. 324, 277–287. Smith, P., Wilhelm, D., and Rodgers, R.J. (2014). Development of mammalian ovary. J. Endocrinol. 221, R145–R161. Sreenivasan, R., Jiang, J., Wang, X., Ba´rtfai, R., Kwan, H.Y., Christoffels, A., and Orba´n, L. (2014). Gonad differentiation in zebrafish is regulated by the canonical Wnt signaling pathway. Biol. Reprod. 90, 45. Tzung, K.W., Goto, R., Saju, J.M., Sreenivasan, R., Saito, T., Arai, K., Yamaha, E., Hossain, M.S., Calvert, M.E., and Orba´n, L. (2015). Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports 4, 61–73. Vainio, S., Heikkila¨, M., Kispert, A., Chin, N., and McMahon, A.P. (1999). Female development in mammals is regulated by Wnt-4 signalling. Nature 397, 405–409. White, Y.A., Woods, D.C., and Wood, A.W. (2011). A transgenic zebrafish model of targeted oocyte ablation and de novo oogenesis. Dev. Dyn. 240, 1929–1937. Wills, A.A., Kidd, A.R., 3rd, Lepilina, A., and Poss, K.D. (2008). Fgfs control homeostatic regeneration in adult zebrafish fins. Development 135, 3063–3070. Wong, T.T., Saito, T., Crodian, J., and Collodi, P. (2011). Zebrafish germline chimeras produced by transplantation of ovarian germ cells into sterile host larvae. Biol. Reprod. 84, 1190–1197. Xie, T. (2008). Germline stem cell niches. In StemBook (Harvard Stem Cell Institute). Yuan, H., and Yamashita, Y.M. (2010). Germline stem cells: stems of the next generation. Curr. Opin. Cell Biol. 22, 730–736. Zhao, L., Borikova, A.L., Ben-Yair, R., Guner-Ataman, B., MacRae, C.A., Lee, R.T., Burns, C.G., and Burns, C.E. (2014). Notch signaling regulates cardiomyocyte proliferation during zebrafish heart regeneration. Proc. Natl. Acad. Sci. USA 111, 1403–1408. Zou, K., Yuan, Z., Yang, Z., Luo, H., Sun, K., Zhou, L., Xiang, J., Shi, L., Yu, Q., Zhang, Y., et al. (2009). Production of offspring from a germline stem cell line derived from neonatal ovaries. Nat. Cell Biol. 11, 631–636.
Cell Reports 26, 1709–1717, February 12, 2019 1717
STAR+METHODS KEY RESOURCES TABLE
REAGENT or RESOURCE
SOURCE
IDENTIFIER
Antibodies Rabbit anti-Vasa (1:2000)
Knaut et al., 2000
N/A
Anti-digoxigenin POD, Fab fragment
Roche
Cat#11207733910; RRID:AB_514500
Anti-digoxigenin AP, Fab fragment
Roche
Cat#11093274910; RRID:AB_514497
Donkey anti-rabbit IgG Alexa fluor 568-conjugated (1:1000)
Invitrogen
Cat#A11011; RRID:AB_143157
Donkey anti-rabbit IgG Alexa fluor 647-conjugated (1:1000)
Invitrogen
Cat#A31573; RRID:AB_2536183
Donkey anti-rabbit IgG Alexa fluor 488-conjugated (1:1000)
Invitrogen
Cat#A10042; RRID:AB_2534017
Chemicals, Peptides, and Recombinant Proteins Metronidazole
Sigma-Aldrich
M3761
Blocking reagent
Roche
11096176001
NBT/BCIP stock solution
Roche
11681451001
4’,6-Diamidino-2-phenylindole(DAPI)
Sigma-Aldrich
D8417
XAV939
Sigma-Aldrich
X3004
BGJ-198
MCE
HY-13311
DMH1
MCE
HY-12273
Critical Commercial Assays TSA Plus Cy5 Fluorescence System
Perkin Elmer
NEL745
Reverse Transcription Kit
Promega
A3500
FastStart Universal SYBR Green Master
Roche
04913914001
Click-iT EdU Alexa Fluor 647 HCS Assay
Invitrogen
C10357
Experimental Models: Organisms/Strains Zebrafish: Tg(vasa:Dendra2-NTR-vasa 30 UTR)cq41
This study
N/A
Zebrafish: Tg(hsp70l:dkk1b-GFP)w32
Shin et al., 2012
ZFIN: ZL2050
Zebrafish: Tg(hsp70l:dnfgfr1-EGFP)pd1
Shin et al., 2007
ZFIN: ZL1476
Shin et al., 2007
ZFIN: ZL1068
This study
N/A
CRISPR/Cas9 targeting site sequence: nanos2: GGAGCCACAGACTAAAGGCA
Invitrogen
N/A
Primers for in situ hybridizations, cloning and qRT-PCR, see Table S2
Invitrogen
N/A
Zebrafish: Tg(hsp70l:dnbmpr1-GFP)
w30Tg
Zebrafish: Tg(hsp70l:nanos2-nanos2 30 UTR)cq42 Oligonucleotides
Recombinant DNA pBluescript-vasa-Dendra2-NTR-vasa30 UTR
This study
N/A
pBluescript-hsp70l-nanos2-nanos2 30 UTR
This study
N/A
ZEN2010 Imaging software
Carl Zeiss
https://www.zeiss.com/ corporate/int/home.html
Graphpad Prism
Graphpad
https://www.graphpad.com
Software and Algorithms
CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for reagents may be directed to and will be fulfilled by the Lead Contact, Lingfei Luo (lluo@swu. edu.cn).
e1 Cell Reports 26, 1709–1717.e1–e3, February 12, 2019
EXPERIMENTAL MODEL AND SUBJECT DETAILS Animals All experimental protocols were approved by the School of Life Sciences, Southwest University (Chongqing, China), and the methods were carried out in accordance with the approved guidelines. The zebrafish facility and study were approved by the Institutional Review Board of Southwest University (Chongqing, China). The Zebrafish (Danio rerio) of the Casper genetic background Tg(vasa:DenNTR)cq41, Tg(hsp70l:dkk1b-GFP) (Shin et al., 2012), Tg(hsp70l:dnfgfr1-EGFP) (Shin et al., 2007), Tg(hsp70l:dnBmpr1GFP) (Shin et al., 2007), Tg(hsp70l:nanos2)cq42 transgenic lines and nanos2 mutant line were raised and maintained in accordance with the Guidelines of Experimental Animal Welfare from Ministry of Science and Technology of People’s Republic of China (2006) and the Institutional Animal Care and Use Committee protocols from Southwest University (2007). METHOD DETAILS CRISPR/Cas9 The CRISPR/Cas9 was performed as described (Chang et al., 2013; Hruscha et al., 2013). nanos2 sgRNA of In vitro transcription synthesis together with Cas9 mRNA were injected into 1-cell stage embryos and nanos2 mutants were screened in F2 generation by sequencing. Metronidazole treatment For germ cells ablation experiments, metronidazole (Mtz; Sigma,St. Louis, MO) was dissolved in system water containing 0.2% DMSO. Tg(vasa:DenNTR)cq41 fish were housed in static tanks of system water (ten fish/liter) supplemented with or without 8 mM Mtz for the duration of the experiment. because a long time(> 48 hours) treatment in a high concentration Mtz (> 8 mM) resulted in 50% lethality, we chose as our standard to treat female fish for 7x12h (hours) in 8 mM Mtz, with 12h of recovery between treatments. Since Mtz is sensitive to long exposure to light, fish were protected from light and fresh Mtz was added daily. For control, fishes were housed in system water with 0.2% DMSO. Zebrafish ovary resection The juvenile females fish of the Tg(vasa:DenNTR)cq41 were mildly anaesthetized in Tricaine and placed in a 1.5% agarose groove. Surgery tweezers were used to make a hole in the fluorescence ovary and removed the ovarian tissues. Fish were imaged and the ovary surface areas were quantified as previously reported (Poss et al., 2002) using a SteREO DiscoveryV20 microscope equipped with AxioVision Rel 4.8.2 software (Carl Zeiss). In situ hybridizations, Antibody staining and EdU labeling assays The females were anesthetized in Tricaine and then fixed overnight in 4% PFA at 4 C. The ovaries were dissected from the fixed fish. Whole-mount or FISHs were carried out as previously described (Liu et al., 2016) using the vasa, nanos2, sycp3, ziwi and lef1 probes. Antibody staining was performed as previously described (Lu et al., 2013), using antibodies against Vasa (1:2000) (Knaut et al., 2000), green and Dsred fluorescent protein (1:1000; Invitrogen). Antibody stained tissues were imaged using ZEN2010 software equipped on an LSM780 confocal microscope (Carl Zeiss). 5-ethynyl-20-deoxyuridine (EdU) was injected into abdomen of fish and fish were fixed overnight in 4% PFA at 4 C 2 hours after injection. EdU staining was performed as previously described (He et al., 2014). Histology Hematoxylin and Eosin (H&E) staining, dissected ovaries were fixed in 4% PFA, washed in PBS, dehydrated in methanol, then embedded in paraffin and sectioned. Deparaffinized slides (7 mm) were stained in H&E. Plasmid construction and qRT-PCR The vasa promoter and 30 UTR were amplified from genomic DNA as described (Krøvel and Olsen, 2002) and were respectively subcloned into the front and back end of Dendra2-NTR in the I-SceI vector. The nanos2 cds and 30 UTR were amplified from genomic DNA and were subcloned into the back end of hsp70l promoter in the I-SceI vector with cryaa-Cerulean. Then, the I-SceI constructs were microinjected with I-SceI meganuclease (NEB) into 1-cell stage embryos. The Tg(vasa:DenNTR)cq41 transgenic founders were isolated by the specific expression of Dendra2 in gonad of the next generation and Tg(hsp70l:nanos2)cq42 founders were screened by blue fluorescence in eyes of the next generation. For qRT-PCR, Ovary RNA was extracted using Trizol (Life Technologies) and reverse transcribed to cDNA using Omniscript reverse transcriptase kit (QIAGEN). Heat Shock The double transgenic fish Tg(vasa:DenNTRcq41; hsp70l:dkk1b-GFP), Tg(vasa:DenNTRcq41; hsp70l:dnfgfr1-EGFP) and Tg(vasa: DenNTRcq41; hsp70l:dnbmpr1-GFP) were heated shock after surgery at 39.5 C once per day for 2 hours. For overexpression of
Cell Reports 26, 1709–1717.e1–e3, February 12, 2019 e2
nanos2 experiments, the nanos2 mutants with Tg(vasa:DenNTRcq41; hsp70l:nanos2cq42) genetic background and wild-type were heated shock from 21 dpf to 7 dpa / 39 dpf or 2 dpa / 34 dpa at 39.5 C once per day for 2 hours. Chemical treatments The juvenile females were incubated following surgery until 5 dpa with 5 mM XAV939, 5 mM BGJ-398, 10 mM DMH1 or 0.1% DMSO as control. QUANTIFICATION AND STATISTICAL ANALYSIS nanos2+ cells were counted on whole mount in each left ovary in three dimensions using ZEN2010 Imaging software and the distances between two remaining ovarian tissues after amputation were quantified using a SteREO DiscoveryV20 microscope equipped with AxioVision Rel 4.8.2 software (Carl Zeiss). Quantification of regeneration ratio is calculated as % of regeneration = (red line length at 0dpa - red line length at 5dpa)/red line length at 0dpa. All statistical tests were performed with GraphPad Prism version 7.0. Statistical significance was determined using the Student’s t test.
e3 Cell Reports 26, 1709–1717.e1–e3, February 12, 2019
Germline Stem Cells Drive Ovary Regeneration in Zebrafish Graphical Abstract
Authors Zigang Cao, Xiaoyu Mao, Lingfei Luo
Correspondence [email protected]
In Brief Germline stem cells maintain ovarian high fecundity throughout the life cycle in zebrafish. Cao et al. demonstrate that the GSC marker nanos2 is required for the maintenance of GSCs and provide evidence that ovary regeneration is a GSC-driven process in zebrafish.
Highlights d
d
d
d
nanos2 is required for the maintenance of GSCs Ablation of GSCs causes conversion of ovaries to sterile testes GSC-driven ovary regeneration is defective in the nanos2 mutant Wnt signaling regulates GSC-driven ovary regeneration
Cao et al., 2019, Cell Reports 26, 1709–1717 February 12, 2019 ª 2019 The Authors. https://doi.org/10.1016/j.celrep.2019.01.061
Cell Reports
Report Germline Stem Cells Drive Ovary Regeneration in Zebrafish Zigang Cao,1,2 Xiaoyu Mao,1 and Lingfei Luo1,3,* 1Key Laboratory of Freshwater Fish Reproduction and Development, Ministry of Education, Laboratory of Molecular Developmental Biology, School of Life Sciences, Southwest University, Beibei, 400715 Chongqing, China 2Jiangxi Key Laboratory of Organ Developmental Biology, College of Life Sciences, JingGangShan University, Ji’an, 343009 Jiangxi, China 3Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2019.01.061
SUMMARY
Germline stem cells (GSCs) sustain gametogenesis during the organismal life cycle. Although evidence suggests that GSCs are consistently present in the zebrafish ovary and support oogenesis, whether GSCs are involved in zebrafish ovary regeneration is poorly understood. Here, we found that nanos2, a conserved vertebrate GSC marker, is required for maintaining GSCs in zebrafish. We applied genetic ablation and tissue resection techniques to delineate the function of GSCs in zebrafish ovary regeneration. After GSC ablation, ovaries fail to regenerate and are converted to sterile testes. Amputated ovarian tissues completely regenerate as a result of the proliferation of residual GSCs, but nanos2 mutant ovaries fail to regenerate after amputation due to a lack of GSCs. The repression of Wnt signaling leads to reduced numbers of GSCs and delayed ovary regeneration. Our results provide insight into the key role of GSCs in driving ovary regeneration. INTRODUCTION Stem cells are a population of cells that are able to self-renew and produce differentiated progenies, which play important roles in embryonic development, tissue homeostasis, and regeneration. The germline stem cell is an unipotent stem cell type because it exclusively gives rise to two end-differentiated cell types, namely, sperm or oocyte (Yuan and Yamashita, 2010). In the mammalian ovary, oogenesis is completed after birth. It is widely accepted that the postnatal ovary is endowed by a fixed and non-renewing number of oocytes (Smith et al., 2014). A few reports suggest that mammals have stem-like germ cells and mitotic oogonia in their postnatal ovaries, which still remains controversial (Eggan et al., 2006; Johnson et al., 2004; Zou et al., 2009). Nevertheless, some lower vertebrates obtain high fecundity throughout their life, indicating the presence of GSCs in their mature ovaries. In the ovary of adult medaka fish, GSCs have been identified by lineage-tracing experiments, which are specifically labeled by nanos2 and surrounded by sox9b-expressing somatic cells (Nakamura et al., 2010). Some reports suggest that the presence of GSCs in zebrafish sustain
oocyte production (Beer and Draper, 2013; Draper, 2017; Draper et al., 2007; Wong et al., 2011). But key factors involved in this process remain to be elucidated. Zebrafish has strong regenerative capabilities and becomes a powerful vertebrate model to study cellular and molecular mechanisms of organ regeneration (Gemberling et al., 2013). The commonly used techniques include the metronidazole (MTZ) and bacterial nitroreductase (NTR)-mediated ablation of specific cell types (Curado et al., 2007; He et al., 2014) and tissue resection or injury (Poss et al., 2002). Reproductive organs of low vertebrates, such as fish, have powerful regenerative capabilities. For example, oocytes in adult zebrafish after ablation by MTZ under the Tg(zpc:G4VP16/UAS: NfsB-mCherry) transgenic background achieve recoveries (White et al., 2011). Although the point that ovary regeneration is due to the proliferation of residual germ cells has been raised, the roles and functional mechanisms of GSCs in ovary regeneration are rarely described. Signaling pathways have been reported to regulate tissue regeneration (Kawakami et al., 2006; Wills et al., 2008; Zhao et al., 2014). However, the pathways involved in gonadal regeneration are poorly understood. Wnt signaling regulates ovary development and sex determination in vertebrates (Chassot et al., 2011; Naillat et al., 2010; Sreenivasan et al., 2014; Vainio et al., 1999). Therefore, whether Wnt signaling plays regulatory roles in GSC behaviors and ovary regeneration is worth investigating. In this study, we show that a nanos2 mutation led to the loss of GSCs and a female-to-male sex reversal, revealing the roles of nanos2 in the maintenance of zebrafish GSCs. Furthermore, we established two zebrafish ovary regeneration models, including genetic ablation and tissue amputation, by using the Tg(vasa:Dendra2-NTR-vasa 30 UTR)cq41 transgenic line. Our data show that ovary regeneration is mainly driven by GSCs, in which Wnt signaling plays regulatory roles. RESULTS nanos2 Is Required for the Maintenance of GSCs Similar to medaka (Nakamura et al., 2010), zebrafish nanos2 is exclusively expressed in cells with GSC characteristics in the gonads of both females and males (Beer and Draper, 2013; Draper, 2017). To investigate the functions of nanos2, we generated two zebrafish nanos2 mutant alleles by using CRISPR/Cas9 mutagenesis (Chang et al., 2013; Hruscha et al., 2013), in which two and seven base pairs (bps) within the nanos2 genetic loci were
Cell Reports 26, 1709–1717, February 12, 2019 ª 2019 The Authors. 1709 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
deleted, respectively. These deletions led to a frameshift of the open reading frame and the creation of premature stop codons in the Nanos2 Zinc finger-nanos RNA-binding domain (Figures 1A and 1B). The expression of nanos2 in the sexually bi-potential gonad was initiated from 21 days post-fertilization (dpf) (Beer and Draper, 2013); therefore, analyses of the mutant gonads were carried out after that. No difference was observed in the mutant gonads compared to the wild-type (WT) at 21 dpf, 25 dpf, and 28 dpf (Figures 1C–1E00 ), suggesting that the establishment of GSCs occurs independent of nanos2. However, at 32 dpf when sex has been determined, GSCs specifically labeled by nanos2 became absent in the nanos2 mutant (Figures 1F–1F00 ). At 35 dpf, the early stage germ cells, including mitotically dividing oogonia and cells that are actively entering meiosis cells (stage IA oocytes), were absent in the nanos2-mutant ovaries in contrast to wild-type (Figures 1G–1G00 ). The nanos2 mutant testes have no germ cells at 35 dpf (Figures S1A and S1B). From 60 dpf to 75 dpf, the female nanos2 mutants became sex-reverted to males without detectable germ cells, based on the phenotypic conversion of mutant gonads, cloacae, and fin pigmentations (Figures S1C–S1K00 ). Eventually, the nanos2 mutants exclusively developed into sterile males (Figures 1H–1J00 ) due to a lack of GSCs. These results indicate that zebrafish nanos2 is required for the maintenance of GSCs, similar to the requirement of nanos2 for maintaining GSCs in the testis in mice (Sada et al., 2009). To further confirm the requirement of nanos2 in the maintenance of the ovary, we generated the Tg(hsp70l:nanos2-nanos2 30 UTR)cq42, abbreviated as Tg(hsp70l:nanos2)cq42, transgenic line to replenish Nanos2 in the nanos2 mutant. Heat shock was performed once per day from 21 dpf on, and the ovaries were analyzed at 40 dpf. The results show that the mutant ovaries do have early germ cells after the replenishment of Nanos2, similar to wild-type (Figures 1L–1N), suggesting that the replenishment of nanos2 rescues ovary maintenance. Genetic Ablation of GSCs Causes Failure of Ovary Regeneration To study the roles of GSCs in zebrafish ovary regeneration, we generated the Tg(vasa: Dendra2-NTR-vasa 30 UTR)cq41 transgenic line, abbreviated as Tg(vasa:DenNTR)cq41, with the fluorescent protein Dendra2 fused to NTR and driven by the germline-specific promoter vasa. Tg(vasa:egfp) was reported to exclusively express in oocytes but not pre-meiotic cells (Leu and Draper, 2010). In our transgenic line, the Dendra2 fully overlapped with Vasa in germ cells of the Tg(vasa:DenNTR)cq41 females (Figure 2A), indicating that Dendra2 is able to label all of the germ cells. The adult Tg(vasa:DenNTR)cq41 females at three months of age (Figures 2B and 2B0 ) were incubated with 8 mM Mtz for one week to ablate germ cells. The ovary size largely decreased at 5 days post-treatment (dpt) (Figures 2C and 2C0 ). Furthermore, except for stage I and II oocytes, all the other germ cells were ablated compared to the control (Figures 2B00 and 2C00 ). At 30 dpt, although the ovarian volume increased (Figure 2D), Dendra2 epifluorescence (Figure 2D0 ) and the early stage germ cells were non-detectable (Figure 2D00 ). At 60 dpt, only stage V mature cells still resided in the ovaries (Figures 2E–2E00 ). Although females at
1710 Cell Reports 26, 1709–1717, February 12, 2019
this stage could still produce eggs, the majority of eggs were unfertilizable (Table S1). Finally, at 90 dpt, the Tg(vasa:DenNTR)cq41 females treated with Mtz reverted to sterile males (Figures 2F– 2F00 and S2A–S2H). To further confirm whether GSCs are completely ablated by Mtz, Vasa antibody staining was carried out, showing an absence of early stage germ cells in the ovaries at 5 dpt (Figures S2I and S2J). Moreover, the ovaries at 5 dpt did not express nanos2 (Figures S2K and S2L) and the meiotic entry marker sycp3 (Lammers et al., 1994) (Figures S2M and S2N), indicating complete ablation of GSCs and meiotic entry cells. After a withdrawal of Mtz, no early stage germ cells appeared and the females were unable to continuously produce oocytes due to a lack of GSCs. The number of oocytes in the ovaries was limited, similar to the mammalian postnatal ovaries. Because germ cells are essential for maintaining ovaries in zebrafish (Dranow et al., €sslein-Volhard, 2008; Tzung et al., 2013; Siegfried and Nu 2015), the females treated with Mtz spawned all of the mature eggs and ultimately reverted to the sterile males (Figures S2A– S2H). Consistent with previously reported data that pre-meiotic germ cells isolated from an adult ovary and transplanted into sterile zebrafish led to the restoration of germ cell production and fertility (Wong et al., 2011), our results indicate that ovary regeneration fails to occur without GSCs. GSCs Proliferate and Drive Ovary Regeneration To explore the roles of GSCs in ovary regeneration, ovarian tissue amputation was performed as another regeneration model. Approximately 95% of left ovarian tissues were removed at 50 dpf (Figures 3A, 3B, and 3F). The amputated ovary barely regenerated at 5 days post-amputation (dpa) (Figures 3C and 3F). However, at 15 dpa, the remaining ovarian tissues exhibited an approximately ten-fold amplification (Figures 3D and 3F). At 30 dpa, the ovary regenerated to a size comparable to that before amputation (Figures 3E and 3F). At around 50 dpa, the amputated females were able to produce fertilizable eggs, suggesting a full recovery of their reproductive functions. In contrast, regeneration failed to occur when the left ovary was completely removed (Figures 3A0 –3F0 ), indicating that the remaining ovarian tissues are essential for the ovary regeneration. In addition, when the majority of left ovarian tissues were removed in 4-month-old adults, regeneration completed at 20 dpa (Figure S3A). These results indicate the strong regenerative capability of the zebrafish ovary. To determine whether the regeneration was mediated by GSCs in the remaining ovarian tissues, we assessed the number and proliferation of GSCs by fluorescence in situ hybridization (FISH) of nanos2 and 5-ethynyl-20 -deoxyuridine (EdU)-labeling assays. In contrast to controls at different stages, including 50 dpf, 65 dpf, and 80 dpf, the number of proliferative GSCs in the post-amputated ovaries at 15 dpa (equivalent to 65 dpf) significantly increased (Figures 3G–3L). qRT-PCRs showed an upregulation of nanos2 expression at 15 dpa/65 dpf compared to the controls (Figure 3M), suggesting that the injury signals activate the proliferation of GSCs. Similar results were obtained during adult ovary regeneration (Figures S3B–S3D). These data show that the proliferation of residual GSCs is activated by ovary injuries.
Figure 1. nanos2 Is Required for Maintaining GSCs (A) Schematic diagram of nanos2 genomic structure and mutation genotypes. (B) Schematic representation of the protein functional domains of nanos2 from wild-type (WT) and two kinds of mutants (Zf-nanos, Zinc finger-nanos). (C–G) Body length of wild-type (WT) and nanos2 homozygous at 21 (C), 25 (D), 28 (E), 32 (F), and 35 (G) dpf. (C0 –G0 0 ) Triple fluorescent labeling with FISH-nanos2, anti-Vasa antibodies, and 40 ,6-diamidino-2-phenylindole (DAPI) staining in the ovaries of wild-type and nanos2 homozygous at 21, 25, 28, 32, and 35 dpf. Note loss of GSCs (arrowheads) in the mutant starting at 32 dpf. (H–J) Adult wild-type female (H), the nanos2 mutant (I), and wild-type males (J). (H0 –J0 ) Lateral views of gonads. (H0 0 –J0 0 ) H&E staining of gonad sections shows that all of the nanos2 mutants develop into the sterile males. (K–M) At 40 dpf after heat-shock, double staining by anti-Vasa antibodies, and DAPI in the nanos2 mutants with (L) or without (K) Tg(hsp701:nanos2) transgenic background, and in the wild-type (M) shows that overexpression of nanos2 could rescue the phenotypes of nanos2 mutant. Arrows indicate early germ cells. Oo, oogonia; IAz, zygotene-stage-IA; IB, stage IB oocyte. Scale bars: 500 mm (C–G), 50 mm (C0 –G0 0 ), 1 mm (H0 –J0 ), 200 mm (H0 0 –J0 0 ), 50 mm (K–M). See also Figure S1.
Cell Reports 26, 1709–1717, February 12, 2019 1711
Figure 2. Ovary Regeneration Is Defective after Genetic Ablation of GSCs and Sex Reversal Finally Occurs (A) Comparison of Vasa protein and vasa:DenNTR expression in ovary shows the Dendra2 fully overlaps with Vasa, suggesting that vasa:DenNTR is able to label all of the germ cells. (B–B0 0 ) The Tg(vasa:DenNTR)cq41 females of about 3 months old have big ovaries in bright field (BF) (B), strong green fluorescent (B0 ), and different stage germ cells (B0 0 ). (C–C0 0 ) At 5 dpt, the ovarian size largely decreases (C and C0 ) and except stage I and II oocytes, the germ cells are ablated by Mtz (C0 0 ). (D–D0 0 ) The ovaries become large and have mature oocytes at 30 dpt (D) but little green fluorescent is observed (D0 ), and the early stage germ cells were not detected (D0 0 ). (E–E0 0 ) By 60 dpt, the fish ovaries only have stage V cells. (F–F0 0 ) Testis (arrowheads) that lack germ cells appears at 90 dpt, showing that the females treated with Mtz reverted to sterile males. Oo, oogonia; IAz, zygotene-stage-IA; IA, stage IA oocytes; IB, stage IB oocyte; II, stage II oocyte; III, stage III oocyte; IV, stage IV oocyte; V, stage V oocyte. Scale bars: 50 mm (A), 1 mm (B–F0 ), 200 mm (B0 0 –F0 0 ). See also Figure S2.
To investigate the functional significance of GSCs in ovary regeneration, nanos2 mutants with defects in GSC maintenance were analyzed. Because a complete loss of GSCs initially appears at 32 dpf in the nanos2 mutant (Figure 1F00 ), amputation of the ovary was performed at this stage. In contrast to gradual regeneration of wild-type ovaries within a week (Figures 4A– 4E), defects in ovary regeneration were observed in the nanos2 mutant at 4 dpa and 7 dpa (Figures 4A0 –4D0 and 4E). However, defective ovary regeneration in the nanos2 mutant was rescued by the replenishment of Nanos2 through continuous heat shock from 21 dpf under the Tg(hsp70l:nanos2) background (Figures 4A00 –4D00 and 4E). Furthermore, at 4 dpa, the nanos2-expressing GSCs were absent in the nanos2 mutant (Figures 4F and 4G),
1712 Cell Reports 26, 1709–1717, February 12, 2019
which was confirmed by FISH of ziwi that is normally expressed in both GSCs and other germ cells, such as vasa (Figures 4H and 4I). Because the nanos2 mutant lacks both GSCs and other germ cells after 35 dpf (Figures 1G00 , 4G, and 4I), we further investigated whether the ovary regeneration is mainly driven by GSCs or the proliferation of existing germ cells. Continuous heat shock was applied from 21 dpf on but stopped at 2 dpa/34 dpf. At 4 dpa, two days after termination of heat shock, all the germ cells remained in the regenerating ovary except the nanos2+ GSCs (Figure 4J). Consequently, termination of heat shock led to the discontinuation of ovary regeneration from 4 dpa to 7 dpa (Figures 4A000 , 4D000 , and 4E). These results demonstrate that GSCs are required for ovary regeneration.
Figure 3. Residual GSCs Are Highly Proliferative during Ovary Regeneration (A–E) Most of the left ovary was removed and could be completely recovered in a month. Zebrafish ovary at 50 dpf/before amputation (A), 0 (B), 5 (C), 15 (D), and 30 (E) dpa. Arrowheads indicate the remaining or regenerating ovarian tissues (n = 5). (A0 –E0 ) Complete amputation of the left ovary causes failure of regeneration (n = 5). (F and F0 ) Quantification of ovary surface area at 0, 5, 15, and 30 dpa. Values represent the size of the largest left ovary surface area (n = 5, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). (G–J) Triple fluorescent labeling of ovaries with FISH-nanos2, anti-Vasa antibodies, and EdU at different stages including 50 (G), 65 (I), and 80 (J) dpf without amputation, as well as 15 dpf/65 dpf after amputation (H). Note the increased number and proliferation of nanos2-positive cells (arrowheads) at 15 dpa. (K) Quantification of nanos2-positive cells per left ovary before amputation and at 15 dpa, 65 dpf, and 80 dpf (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). (L) Quantification of nanos2+ EdU+ double-positive cells per left ovary before amputation and at 15 dpa, 65 dpf, and 80 dpf. (n = 7, mean ± SEM, **p < 0.01, *p < 0.05, two-tailed t test, error bars indicate SEM). (M) nanos2 expression level measured by qRT-PCR (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). Scale bars: 1 mm (A–E0 ), 50 mm (G–J). See also Figure S3.
Cell Reports 26, 1709–1717, February 12, 2019 1713
Figure 4. The Ovary of nanos2 Mutant Fails to Regenerate
(A–D0 ) The ovaries of the wild-type juvenile under the Tg(vasa:DenNTR)cq41 transgenic background were imaged at before amputation/32 dpf (A), 0 (B), 4 (C), and 7 (D) dpa. The ovaries of nanos2 mutant were imaged at the same stages (A0 –D0 ), showing little regeneration in contrast to the wild-type (A–D). (A0 –D0 ) The nanos2 mutants juvenile with Tg(vasa:DenNTRcq41; hsp70l:nanos2cq42) genetic background were heated shock from 21 dpf on and the ovaries were amputated at 32 dpf. (A0 0 –D0 0 ) Heat-shock (hs) is from 21 dpf to 7 dpa/39 dpf. (A0 0 0 –D0 0 0 ) Heat-shock is from 21 dpf to 2 dpa/34 dpf. (E) Quantification of ovary surface area of wild-type and nanos2 mutant at 0, 4, and 7 dpa. (n = 5, mean ± SEM, ***p < 0.001, **p < 0.01, NS represents no significance, two-tailed t test, error bars indicate SEM). (F and G) Triple fluorescent labeling with FISH-nanos2, anti-Vasa antibodies, and DAPI staining in the ovaries of wild-type (F) and the nanos2 mutant (G) 4 dpa. (H and I) Double labeling of FISH-ziwi and DAPI staining in the ovaries of wild-type (H) and nanos2 mutant (I) at 4 dpa. (J) Triple fluorescent labeling with nanos2 RNA probe, Vasa antibodies, and DAPI staining in the nanos2 homozygous ovaries at 4 dpa, which were heat-shocked from 21 dpf to 2 dpa. Scale bars: 500 mm (A–D0 0 0 ), 50 mm (F–J).
Inhibition of Wnt Signaling Compromises Ovary Regeneration Wnt signaling plays important roles in the regulation of sex determination and ovary development in zebrafish (Sreenivasan et al., 2014). To explore the involvement of Wnt signaling in regeneration, we first examined the expression of lymphocyte enhancer
1714 Cell Reports 26, 1709–1717, February 12, 2019
binding factor 1 (lef1), a Wnt target gene (Kawakami et al., 2006). In contrast to 0 dpt, lef1 expression at 2 dpa was upregulated (Figures 5A and 5B), suggesting activation of Wnt signaling after injury and its potential involvement in ovary regeneration. To further investigate the functional significance of Wnt signaling in ovary regeneration, a Tg(hsp70l:dkk1b-GFP) transgenic
Figure 5. Wnt Signaling Is Activated and Regulates Ovary Regeneration (A) RNA fluorescent in situ hybridization of lef1 shows upregulation of lef1 expression at 2 dpa compared to 0 dpa. (B) lef1 expression level measured by qRT-PCR (***p < 0.001, two-tailed t test, error bars indicate SEM). (C) The ovary regeneration in dkk1b-overexpressing fish is blocked at 5 dpa compared to heat-shocked wild-type (hsWT). The red lines represented the distance between two remaining ovarian tissues after amputation. (D) Quantification of the red line lengths of hsWT and hsDkk1b at 0 dpa and 5 dpa for 7 samples in the same group (n = 7). (E) Quantification of regenerative ratio of hsWT and hsDkk1b at 5 dpa (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). (F) Triple fluorescent labeling with nanos2 RNA probe, Vasa antibodies, and DAPI staining both in the hsWT and hsDkk1b fishes at 5 dpa. Arrowheads point to GSCs. (G) Quantification of the number of GSCs in the ovarian remnant per left ovary at 5 dpa (n = 7, mean ± SEM, **p < 0.01, two-tailed t test, error bars indicate SEM). (H) nanos2 expression level measured by qRTPCR (n = 7, mean ± SEM, ***p < 0.001, two-tailed t test, error bars indicate SEM). Scale bars: 100 mm (A), 1 mm (C), 50 mm (F). See also Figures S4 and S5.
line with inducible Dickkopf, a secreted inhibitor of Wnt signaling, was applied. The Tg(vasa:DenNTRcq41; hsp70l:dkk1b-GFP) double-transgenic juvenile fishes were heat-shocked for 2 h per day after ovary amputation. At 5 dpa, ectopic expression of Dkk1b-GFP led to delayed ovary regeneration (Figures 5C– 5E) as well as significantly reduced numbers of GSCs and reduced expression of nanos2 (Figures 5F–5H). To validate these results, a chemical inhibitor of Wnt signaling, XAV939, was applied. XAV939 caused delayed ovary regeneration (Figures S4A–S4C) and reduced GSC numbers and nanos2 expression (Figures S4D–S4F). These results suggest that inhibition of Wnt signaling suppresses GSC proliferation and ovary regeneration. To further explore whether fibroblast growth factor (FGF) and bone morphogenetic protein (Bmp) signaling pathways are involved in ovary regeneration, genetic inhibitions using the Tg(hsp70l:dnfgfr1-EGFP) and Tg(hsp70l:dnbmpr1-GFP) transgenic backgrounds or chemical inhibitors BGJ-398 and DMH1 were used to inhibit FGF and Bmp signaling, respectively. Neither ectopically expressed dnFgfr1-EGFP/dnBmpr1-GFP (Figures S5A–S5C) nor BGJ-398/DMH1 (Figures S5D–S5F) affect ovary regeneration, suggesting that FGF and Bmp signaling are not involved in ovary regeneration.
DISCUSSION In this study, we explored the roles of GSCs in zebrafish ovary regeneration. Our data reveal that zebrafish ovary regeneration is mainly driven by GSCs. First, nanos2 mutant analyses suggest that zebrafish oocyte production is a GSC-driven process. Moreover, a complete genetic ablation of GSCs in the adult ovary leads to sex reversal and infertility, whereas the amputated ovarian tissues completely regenerate in a GSC-dependent manner. Wnt signaling is activated by the amputation and regulates GSC proliferation and nanos2 expression during regeneration. However, current results are limited without the lineage-tracing experiments to further confirm GSC-driven ovary regeneration. Previous studies have shown that nanos2 expression is exclusively restricted to GSCs in both medaka and mice (Nakamura et al., 2010; Sada et al., 2009). Although the mutation analyses showing the roles of nanos2 in maintaining GSCs have so far only been reported in mice testis (Sada et al., 2009), this function is potentially conserved in vertebrates. The ovarian phenotypes of the zebrafish nanos2 mutant in this study was similar to a previously described nanos3 mutant (Beer and Draper, 2013; Draper et al., 2007), suggesting partially redundant roles of
Cell Reports 26, 1709–1717, February 12, 2019 1715
nanos2 and nanos3 in maintaining female GSCs. However, nanos3 is exclusively expressed in females (Draper et al., 2007), whereas nanos2 is detectable in the GSCs of both ovary and testis (Beer and Draper, 2013) and, thus, is able to maintain GSCs in both females and males. Three NTR-Mtz models have been generated to ablate germ cells. Two of them were established using the zp promoter (Hu et al., 2010; White et al., 2011), and the remaining one was based on the ziwi promoter (Dranow et al., 2013). Because zp is exclusively expressed in oocytes (Liu et al., 2006; Onichtchouk et al., 2003), these models cannot ablate GSCs. ziwi, similar to vasa, is detectable in all germ cells (Houwing et al., 2007; Leu and Draper, 2010). But the mild Mtz treatment conditions did not completely ablate GSCs. So, the Tg(ziwi:CFP-NTR) females treated with Mtz ultimately reverted to the fertile males (Dranow et al., 2013). The ovarian phenotypes of our model at 5 dpt after withdrawal of Mtz are similar to those of the nanos2 mutant at 35 dpf, in which GSCs are missing. A minimal number of oocytes is required to maintain stable female phenotypes in zebrafish €sslein-Volhard, 2008; (Dranow et al., 2013; Siegfried and Nu Tzung et al., 2015), similar to postnatal mammalian ovary that is endowed by a finite egg number. Sex reversal in the females treated with Mtz suggests that GSCs are essential for the maintenance of prolific reproductive capacity and sexual phenotypes of the female zebrafish. Ovary amputation experiments exhibit the regenerative capacity of the zebrafish ovary, which can be used for further studies of cellular and molecular mechanisms of ovary regeneration. The ovaries at the two months of age generally contain only a small amount of GSCs, which are mainly localized in the ovarian GSC niche (Beer and Draper, 2013; Xie, 2008). When most of the ovarian tissues at one side are removed, the injury microenvironments stimulate proliferation of the remaining ovarian GSCs. Replenishment of Nanos2 from 21 dpf to 2 dpa/ 34 dpf in the nanos2 mutant restores all types of germ cells at 4 dpa except the nanos2+ GSCs, which leads to discontinuation of ovary regeneration after 4 dpa. These results highlight the essential role of GSCs in ovary regeneration but do not exclude the possibility that the existing germ cells support regeneration by transforming into nanos2+ GSCs. Further lineage tracing or transplantation experiments are required to address this issue. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d d
KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Animals METHOD DETAILS B CRISPR/Cas9 B Metronidazole treatment B Zebrafish ovary resection B In situ hybridizations, Antibody staining and EdU labeling assays B Histology
1716 Cell Reports 26, 1709–1717, February 12, 2019
B
Plasmid construction and qRT-PCR Heat Shock B Chemical treatments QUANTIFICATION AND STATISTICAL ANALYSIS B
d
SUPPLEMENTAL INFORMATION Supplemental Information includes five figures and five tables and can be found with this article online at https://doi.org/10.1016/j.celrep.2019.01.061. ACKNOWLEDGMENTS We thank H. Knaut for anti-Vasa antibody and J. Chen, J. He, and L. Le for discussions and technical assistances. This work was supported by the National Key Basic Research Program of China (2015CB942800), National Natural Science Foundation of China (31730060, 31330051, 81860282, and 91539201), the 111 Program (B14037), Fundamental Research Funds for the Central Universities (XDJK2017A007), Natural Science Foundation Project of Jiangxi Province (20171BAB204018), and Science and Technology Foundation of the Education Department of Jiangxi Province (GJJ160735). AUTHOR CONTRIBUTIONS L.L. and Z.C. designed the experimental strategy, analyzed data, and wrote the manuscript; X.M. performed H&E staining and nanos2 mutant phenotype analyses; and Z.C. performed all the other experiments. DECLARATION OF INTERESTS The authors declare no competing interests. Received: May 6, 2018 Revised: December 20, 2018 Accepted: January 16, 2019 Published February 12, 2019 REFERENCES Beer, R.L., and Draper, B.W. (2013). nanos3 maintains germline stem cells and expression of the conserved germline stem cell gene nanos2 in the zebrafish ovary. Dev. Biol. 374, 308–318. Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., and Xi, J.J. (2013). Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23, 465–472. Chassot, A.A., Gregoire, E.P., Lavery, R., Taketo, M.M., de Rooij, D.G., Adams, I.R., and Chaboissier, M.C. (2011). RSPO1/b-catenin signaling pathway regulates oogonia differentiation and entry into meiosis in the mouse fetal ovary. PLoS One 6, e25641. Curado, S., Anderson, R.M., Jungblut, B., Mumm, J., Schroeter, E., and Stainier, D.Y. (2007). Conditional targeted cell ablation in zebrafish: a new tool for regeneration studies. Dev. Dyn. 236, 1025–1035. Dranow, D.B., Tucker, R.P., and Draper, B.W. (2013). Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. Dev. Biol. 376, 43–50. Draper, B.W. (2017). Identification of germ-line stem cells in zebrafish. Methods Mol. Biol. 1463, 103–113. Draper, B.W., McCallum, C.M., and Moens, C.B. (2007). nanos1 is required to maintain oocyte production in adult zebrafish. Dev. Biol. 305, 589–598. Eggan, K., Jurga, S., Gosden, R., Min, I.M., and Wagers, A.J. (2006). Ovulated oocytes in adult mice derive from non-circulating germ cells. Nature 441, 1109–1114. Gemberling, M., Bailey, T.J., Hyde, D.R., and Poss, K.D. (2013). The zebrafish as a model for complex tissue regeneration. Trends Genet. 29, 611–620.
He, J., Lu, H., Zou, Q., and Luo, L. (2014). Regeneration of liver after extreme hepatocyte loss occurs mainly via biliary transdifferentiation in zebrafish. Gastroenterology 146, 789–800.e788. Houwing, S., Kamminga, L.M., Berezikov, E., Cronembold, D., Girard, A., van den Elst, H., Filippov, D.V., Blaser, H., Raz, E., Moens, C.B., et al. (2007). A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell 129, 69–82. Hruscha, A., Krawitz, P., Rechenberg, A., Heinrich, V., Hecht, J., Haass, C., and Schmid, B. (2013). Efficient CRISPR/Cas9 genome editing with low offtarget effects in zebrafish. Development 140, 4982–4987. Hu, S.Y., Lin, P.Y., Liao, C.H., Gong, H.Y., Lin, G.H., Kawakami, K., and Wu, J.L. (2010). Nitroreductase-mediated gonadal dysgenesis for infertility control of genetically modified zebrafish. Mar. Biotechnol. (NY) 12, 569–578. Johnson, J., Canning, J., Kaneko, T., Pru, J.K., and Tilly, J.L. (2004). Germline stem cells and follicular renewal in the postnatal mammalian ovary. Nature 428, 145–150. Kawakami, Y., Rodriguez Esteban, C., Raya, M., Kawakami, H., Martı´, M., Dubova, I., and Izpisu´a Belmonte, J.C. (2006). Wnt/beta-catenin signaling regulates vertebrate limb regeneration. Genes Dev. 20, 3232–3237. €sslein-Volhard, C. Knaut, H., Pelegri, F., Bohmann, K., Schwarz, H., and Nu (2000). Zebrafish vasa RNA but not its protein is a component of the germ plasm and segregates asymmetrically before germline specification. J. Cell Biol. 149, 875–888. Krøvel, A.V., and Olsen, L.C. (2002). Expression of a vas:EGFP transgene in primordial germ cells of the zebrafish. Mech. Dev. 116, 141–150. Lammers, J.H., Offenberg, H.H., van Aalderen, M., Vink, A.C., Dietrich, A.J., and Heyting, C. (1994). The gene encoding a major component of the lateral elements of synaptonemal complexes of the rat is related to X-linked lymphocyte-regulated genes. Mol. Cell. Biol. 14, 1137–1146. Leu, D.H., and Draper, B.W. (2010). The ziwi promoter drives germline-specific gene expression in zebrafish. Dev. Dyn. 239, 2714–2721. Liu, X., Wang, H., and Gong, Z. (2006). Tandem-repeated Zebrafish zp3 genes possess oocyte-specific promoters and are insensitive to estrogen induction. Biol. Reprod. 74, 1016–1025. Liu, C., Wu, C., Yang, Q., Gao, J., Li, L., Yang, D., and Luo, L. (2016). Macrophages mediate the repair of brain vascular rupture through direct physical adhesion and mechanical traction. Immunity 44, 1162–1176. Lu, H., Ma, J., Yang, Y., Shi, W., and Luo, L. (2013). EpCAM is an endodermspecific Wnt derepressor that licenses hepatic development. Dev. Cell 24, 543–553. Naillat, F., Prunskaite-Hyyryla¨inen, R., Pietila¨, I., Sormunen, R., Jokela, T., Shan, J., and Vainio, S.J. (2010). Wnt4/5a signalling coordinates cell adhesion and entry into meiosis during presumptive ovarian follicle development. Hum. Mol. Genet. 19, 1539–1550. Nakamura, S., Kobayashi, K., Nishimura, T., Higashijima, S., and Tanaka, M. (2010). Identification of germline stem cells in the ovary of the teleost medaka. Science 328, 1561–1563. €gge, L., and Driever, W. (2003). Onichtchouk, D., Aduroja, K., Belting, H.G., Gnu Transgene driving GFP expression from the promoter of the zona pellucida
gene zpc is expressed in oocytes and provides an early marker for gonad differentiation in zebrafish. Dev. Dyn. 228, 393–404. Poss, K.D., Wilson, L.G., and Keating, M.T. (2002). Heart regeneration in zebrafish. Science 298, 2188–2190. Sada, A., Suzuki, A., Suzuki, H., and Saga, Y. (2009). The RNA-binding protein NANOS2 is required to maintain murine spermatogonial stem cells. Science 325, 1394–1398. Shin, D., Shin, C.H., Tucker, J., Ober, E.A., Rentzsch, F., Poss, K.D., Hammerschmidt, M., Mullins, M.C., and Stainier, D.Y. (2007). Bmp and Fgf signaling are essential for liver specification in zebrafish. Development 134, 2041–2050. Shin, D., Weidinger, G., Moon, R.T., and Stainier, D.Y. (2012). Intrinsic and extrinsic modifiers of the regulative capacity of the developing liver. Mech. Dev. 128, 525–535. €sslein-Volhard, C. (2008). Germ line control of female Siegfried, K.R., and Nu sex determination in zebrafish. Dev. Biol. 324, 277–287. Smith, P., Wilhelm, D., and Rodgers, R.J. (2014). Development of mammalian ovary. J. Endocrinol. 221, R145–R161. Sreenivasan, R., Jiang, J., Wang, X., Ba´rtfai, R., Kwan, H.Y., Christoffels, A., and Orba´n, L. (2014). Gonad differentiation in zebrafish is regulated by the canonical Wnt signaling pathway. Biol. Reprod. 90, 45. Tzung, K.W., Goto, R., Saju, J.M., Sreenivasan, R., Saito, T., Arai, K., Yamaha, E., Hossain, M.S., Calvert, M.E., and Orba´n, L. (2015). Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports 4, 61–73. Vainio, S., Heikkila¨, M., Kispert, A., Chin, N., and McMahon, A.P. (1999). Female development in mammals is regulated by Wnt-4 signalling. Nature 397, 405–409. White, Y.A., Woods, D.C., and Wood, A.W. (2011). A transgenic zebrafish model of targeted oocyte ablation and de novo oogenesis. Dev. Dyn. 240, 1929–1937. Wills, A.A., Kidd, A.R., 3rd, Lepilina, A., and Poss, K.D. (2008). Fgfs control homeostatic regeneration in adult zebrafish fins. Development 135, 3063–3070. Wong, T.T., Saito, T., Crodian, J., and Collodi, P. (2011). Zebrafish germline chimeras produced by transplantation of ovarian germ cells into sterile host larvae. Biol. Reprod. 84, 1190–1197. Xie, T. (2008). Germline stem cell niches. In StemBook (Harvard Stem Cell Institute). Yuan, H., and Yamashita, Y.M. (2010). Germline stem cells: stems of the next generation. Curr. Opin. Cell Biol. 22, 730–736. Zhao, L., Borikova, A.L., Ben-Yair, R., Guner-Ataman, B., MacRae, C.A., Lee, R.T., Burns, C.G., and Burns, C.E. (2014). Notch signaling regulates cardiomyocyte proliferation during zebrafish heart regeneration. Proc. Natl. Acad. Sci. USA 111, 1403–1408. Zou, K., Yuan, Z., Yang, Z., Luo, H., Sun, K., Zhou, L., Xiang, J., Shi, L., Yu, Q., Zhang, Y., et al. (2009). Production of offspring from a germline stem cell line derived from neonatal ovaries. Nat. Cell Biol. 11, 631–636.
Cell Reports 26, 1709–1717, February 12, 2019 1717
STAR+METHODS KEY RESOURCES TABLE
REAGENT or RESOURCE
SOURCE
IDENTIFIER
Antibodies Rabbit anti-Vasa (1:2000)
Knaut et al., 2000
N/A
Anti-digoxigenin POD, Fab fragment
Roche
Cat#11207733910; RRID:AB_514500
Anti-digoxigenin AP, Fab fragment
Roche
Cat#11093274910; RRID:AB_514497
Donkey anti-rabbit IgG Alexa fluor 568-conjugated (1:1000)
Invitrogen
Cat#A11011; RRID:AB_143157
Donkey anti-rabbit IgG Alexa fluor 647-conjugated (1:1000)
Invitrogen
Cat#A31573; RRID:AB_2536183
Donkey anti-rabbit IgG Alexa fluor 488-conjugated (1:1000)
Invitrogen
Cat#A10042; RRID:AB_2534017
Chemicals, Peptides, and Recombinant Proteins Metronidazole
Sigma-Aldrich
M3761
Blocking reagent
Roche
11096176001
NBT/BCIP stock solution
Roche
11681451001
4’,6-Diamidino-2-phenylindole(DAPI)
Sigma-Aldrich
D8417
XAV939
Sigma-Aldrich
X3004
BGJ-198
MCE
HY-13311
DMH1
MCE
HY-12273
Critical Commercial Assays TSA Plus Cy5 Fluorescence System
Perkin Elmer
NEL745
Reverse Transcription Kit
Promega
A3500
FastStart Universal SYBR Green Master
Roche
04913914001
Click-iT EdU Alexa Fluor 647 HCS Assay
Invitrogen
C10357
Experimental Models: Organisms/Strains Zebrafish: Tg(vasa:Dendra2-NTR-vasa 30 UTR)cq41
This study
N/A
Zebrafish: Tg(hsp70l:dkk1b-GFP)w32
Shin et al., 2012
ZFIN: ZL2050
Zebrafish: Tg(hsp70l:dnfgfr1-EGFP)pd1
Shin et al., 2007
ZFIN: ZL1476
Shin et al., 2007
ZFIN: ZL1068
This study
N/A
CRISPR/Cas9 targeting site sequence: nanos2: GGAGCCACAGACTAAAGGCA
Invitrogen
N/A
Primers for in situ hybridizations, cloning and qRT-PCR, see Table S2
Invitrogen
N/A
Zebrafish: Tg(hsp70l:dnbmpr1-GFP)
w30Tg
Zebrafish: Tg(hsp70l:nanos2-nanos2 30 UTR)cq42 Oligonucleotides
Recombinant DNA pBluescript-vasa-Dendra2-NTR-vasa30 UTR
This study
N/A
pBluescript-hsp70l-nanos2-nanos2 30 UTR
This study
N/A
ZEN2010 Imaging software
Carl Zeiss
https://www.zeiss.com/ corporate/int/home.html
Graphpad Prism
Graphpad
https://www.graphpad.com
Software and Algorithms
CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for reagents may be directed to and will be fulfilled by the Lead Contact, Lingfei Luo (lluo@swu. edu.cn).
e1 Cell Reports 26, 1709–1717.e1–e3, February 12, 2019
EXPERIMENTAL MODEL AND SUBJECT DETAILS Animals All experimental protocols were approved by the School of Life Sciences, Southwest University (Chongqing, China), and the methods were carried out in accordance with the approved guidelines. The zebrafish facility and study were approved by the Institutional Review Board of Southwest University (Chongqing, China). The Zebrafish (Danio rerio) of the Casper genetic background Tg(vasa:DenNTR)cq41, Tg(hsp70l:dkk1b-GFP) (Shin et al., 2012), Tg(hsp70l:dnfgfr1-EGFP) (Shin et al., 2007), Tg(hsp70l:dnBmpr1GFP) (Shin et al., 2007), Tg(hsp70l:nanos2)cq42 transgenic lines and nanos2 mutant line were raised and maintained in accordance with the Guidelines of Experimental Animal Welfare from Ministry of Science and Technology of People’s Republic of China (2006) and the Institutional Animal Care and Use Committee protocols from Southwest University (2007). METHOD DETAILS CRISPR/Cas9 The CRISPR/Cas9 was performed as described (Chang et al., 2013; Hruscha et al., 2013). nanos2 sgRNA of In vitro transcription synthesis together with Cas9 mRNA were injected into 1-cell stage embryos and nanos2 mutants were screened in F2 generation by sequencing. Metronidazole treatment For germ cells ablation experiments, metronidazole (Mtz; Sigma,St. Louis, MO) was dissolved in system water containing 0.2% DMSO. Tg(vasa:DenNTR)cq41 fish were housed in static tanks of system water (ten fish/liter) supplemented with or without 8 mM Mtz for the duration of the experiment. because a long time(> 48 hours) treatment in a high concentration Mtz (> 8 mM) resulted in 50% lethality, we chose as our standard to treat female fish for 7x12h (hours) in 8 mM Mtz, with 12h of recovery between treatments. Since Mtz is sensitive to long exposure to light, fish were protected from light and fresh Mtz was added daily. For control, fishes were housed in system water with 0.2% DMSO. Zebrafish ovary resection The juvenile females fish of the Tg(vasa:DenNTR)cq41 were mildly anaesthetized in Tricaine and placed in a 1.5% agarose groove. Surgery tweezers were used to make a hole in the fluorescence ovary and removed the ovarian tissues. Fish were imaged and the ovary surface areas were quantified as previously reported (Poss et al., 2002) using a SteREO DiscoveryV20 microscope equipped with AxioVision Rel 4.8.2 software (Carl Zeiss). In situ hybridizations, Antibody staining and EdU labeling assays The females were anesthetized in Tricaine and then fixed overnight in 4% PFA at 4 C. The ovaries were dissected from the fixed fish. Whole-mount or FISHs were carried out as previously described (Liu et al., 2016) using the vasa, nanos2, sycp3, ziwi and lef1 probes. Antibody staining was performed as previously described (Lu et al., 2013), using antibodies against Vasa (1:2000) (Knaut et al., 2000), green and Dsred fluorescent protein (1:1000; Invitrogen). Antibody stained tissues were imaged using ZEN2010 software equipped on an LSM780 confocal microscope (Carl Zeiss). 5-ethynyl-20-deoxyuridine (EdU) was injected into abdomen of fish and fish were fixed overnight in 4% PFA at 4 C 2 hours after injection. EdU staining was performed as previously described (He et al., 2014). Histology Hematoxylin and Eosin (H&E) staining, dissected ovaries were fixed in 4% PFA, washed in PBS, dehydrated in methanol, then embedded in paraffin and sectioned. Deparaffinized slides (7 mm) were stained in H&E. Plasmid construction and qRT-PCR The vasa promoter and 30 UTR were amplified from genomic DNA as described (Krøvel and Olsen, 2002) and were respectively subcloned into the front and back end of Dendra2-NTR in the I-SceI vector. The nanos2 cds and 30 UTR were amplified from genomic DNA and were subcloned into the back end of hsp70l promoter in the I-SceI vector with cryaa-Cerulean. Then, the I-SceI constructs were microinjected with I-SceI meganuclease (NEB) into 1-cell stage embryos. The Tg(vasa:DenNTR)cq41 transgenic founders were isolated by the specific expression of Dendra2 in gonad of the next generation and Tg(hsp70l:nanos2)cq42 founders were screened by blue fluorescence in eyes of the next generation. For qRT-PCR, Ovary RNA was extracted using Trizol (Life Technologies) and reverse transcribed to cDNA using Omniscript reverse transcriptase kit (QIAGEN). Heat Shock The double transgenic fish Tg(vasa:DenNTRcq41; hsp70l:dkk1b-GFP), Tg(vasa:DenNTRcq41; hsp70l:dnfgfr1-EGFP) and Tg(vasa: DenNTRcq41; hsp70l:dnbmpr1-GFP) were heated shock after surgery at 39.5 C once per day for 2 hours. For overexpression of
Cell Reports 26, 1709–1717.e1–e3, February 12, 2019 e2
nanos2 experiments, the nanos2 mutants with Tg(vasa:DenNTRcq41; hsp70l:nanos2cq42) genetic background and wild-type were heated shock from 21 dpf to 7 dpa / 39 dpf or 2 dpa / 34 dpa at 39.5 C once per day for 2 hours. Chemical treatments The juvenile females were incubated following surgery until 5 dpa with 5 mM XAV939, 5 mM BGJ-398, 10 mM DMH1 or 0.1% DMSO as control. QUANTIFICATION AND STATISTICAL ANALYSIS nanos2+ cells were counted on whole mount in each left ovary in three dimensions using ZEN2010 Imaging software and the distances between two remaining ovarian tissues after amputation were quantified using a SteREO DiscoveryV20 microscope equipped with AxioVision Rel 4.8.2 software (Carl Zeiss). Quantification of regeneration ratio is calculated as % of regeneration = (red line length at 0dpa - red line length at 5dpa)/red line length at 0dpa. All statistical tests were performed with GraphPad Prism version 7.0. Statistical significance was determined using the Student’s t test.
e3 Cell Reports 26, 1709–1717.e1–e3, February 12, 2019