- Email: [email protected]
Getting the students involved: overhead projector — the icebreaker
137 require this and given them practice. This will cause them to develop their own ways of finding information and also to appraise the information they find critically. For example, it is not all 'correct', it may change, it may be conflicting. When students start to realise this, we can say that they are developing the critical faculties of a true scientist. A second example is that students need to develop ways of communicating biochemical knowledge. Experiments are fine but the results have little value until they are communicated to the scientific community and evaluated and criticised. A third example is that students need to develop the ability to interpret biochemical data presented in a variety of forms. This has many aspects to it, including their understanding the particular technique used to obtain the data and its limitations - - again, bringing about a critical evaluation of these data. The message to the teachers is that if this is what we want students to do, then we should require it of them, give them instruction and give them practice, and then evaluate their achievements. Ways have to be found for developing these sorts of skills - - by teaching, by practice and by the appropriate assessment and incentives. Such skills are quite different from those involved in learning the textbook and writing it out in the exam.
Valuing Teaching Finally, there is the question of how to persuade faculty to take their teaching more seriously. University staff are usually hired for their research prowess not for their teaching skills. Krebs used to talk about "teaching in an atmosphere of research" - - a worthy aim - - but we all know that teaching is seriously undervalued. Promotion and tenure do not often come as rewards for good teaching: better to concentrate on the research if you want to get on. Thus teaching becomes a chore that gets in the way of one's progress. What can be done? There are moves in some institutions towards teacher appraisal. Research produces a tangible outcome - - publications, grant money - - but it is more difficult to see and to evaluate a product in the case of teaching. Some institutions are encouraging teachers to accumulate a Teaching Profile. Teaching may be appraised by students (eg by questionnaires), by oneself (eg by checklist against perceived performance), and by one's peers (now teaching becomes a less 'private' activity). It is important that people evaluate their teaching skills and improve them, but they also need to be given incentives to do this. Meanwhile, I suppose we need to continue to remind people of the importance of the task, convince them that training the next generation of biochemists is a worthwhile activity. Some institutions have developed a Code of G o o d Practice in Teaching. Such Codes typically reco m m e n d that there should be a shifting of emphasis away from the acquisition of knowledge, reducing scheduled and lecture time, so that we begin to promote indepen-
BIOCHEMICAL EDUCATION 20(3) 1992
dent learning and problem solving, indeed, train biochemists for the activities that will be required of them during the next 10, 20, 30 years.
Getting the Students Involved: Overhead Projector The Icebreaker MURRAY SAFFRAN
Department of Biochemistry & Molecular Biology Medical College of Ohio Toledo, Ohio 43699-0008, USA Problem H o w can a teacher get the students involved in a discussion in the classroom when so many students are shy or afraid to speak?
Answer Use the overhead projector as an icebreaker. Many of us use the overhead projector in lectures, most often as an 'electric blackboard'. We write on its acetate strip instead of on a blackboard because of its convenience and visibility. In addition, many of us prepare transparencies ahead of time to display during a lecture instead of conventional slides because the room lights do not need dimming and because of the versatility of the overhead projector. But how many of us use the overhead projector to encourage participation by the students in discussion?
Barriers For a student to speak out in class two barriers must be overcome: (a) shyness, and (b) fear of saying something silly or wrong. It is somehow less of a personal act for a student to write on the stage of the overhead projector than to speak. The student seems to communicate with the inanimate sheet of acetate rather than with classmates when words are written. Once the writing is done and the words are out for all to see, the student realizes that, whether the words are right or wrong, there is no disgrace and no penalty for trying. The sympathy of the class is with the student at the front of the class and they show it with their responses. The act of writing helps the student to overcome the fear of being wrong before an audience. This, in turn, helps the student to overcome the shyness that inhibits speech. When asked to read and comment on the words just written, the student does so with far less hesitation than when asked to speak without a 'script'.
Multiple choice items Many classroom exercises can be used to involve student responses on the overhead projector. The student can be asked to select the best answer to a multiple choice question or to supply a missing word or phrase in a 'fill-inthe-blank' question. I have gone a step further and asked the students to write their own multiple choice questions on the material just discussed on acetate film. The
138
Complete the structure of galactose:
questions are displayed to the class by the authors, who ask for the answer. Then the author must justify the correct answer and show why the other responses are incorrect. In this scenario the student-author is the authority with the correct answer. This lessens the anxiety of being 'wrong'. Metabolic pathways Metabolic maps in simplified form can be displayed on the screen and the students asked to come up to the projector and label the c o m p o n e n t compounds, enzymes, etc. A n o t h e r overhead projector exercise is to distribute an outline of a process, such as the Krebs cycle, to the class and ask them to fill in details on an acetate overlay. The outline is displayed on the screen and students are asked to fit their acetate with details onto the outline already on the screen and to defend their product.
Figure 3 Complete the structure of guanine:
Other examples This technique can be used at several levels of complexity and difficulty. A D N A sequence is displayed on the screen. The students are given a c - D N A p r o b e on an acetate sheet and are asked to find the best fit in the D N A . N a m e s of amino acids can be matched with structures, single-letter abbreviations and properties. In a protein structure on the screen, students can fill in Hbonds. In each of the above examples, the task is explained and defended by the student. I am sure you can think of m a n y other examples of the use of the overhead projector, and particularly the ability to add overlays, for active participation by students. H e r e are some examples (Figs 1-6).
Amino their
acids
with
structure
a benzene
ring in
include
) Figure 4 Fill in the names of compounds in the cycle:
Urea'-
(A) l y s i n e (B) leucine (C) tyrosine (D) histidine
Figure 5
(E) phenylalanine
Match the cDNA
Figure 1
The (A) (B) (C) (D) (E)
\
organ
with
the lowest
pH is the
duodenum s a l i v a r y gland colon stomach lung
to
the mRNA
Probe-TTTGTACTCCTAA mRNA:
CAUUCAAACAUGAGGAUUACCCA AGUGCCUCAACCGGGGGUUUGAA
Figure 6 EDUCATION
probe
CAUGCUUCGUACUAAAUAUGGAA
Figure 2 BIOCHEMICAL
J
20(3) 1992
Valuing Teaching Finally, there is the question of how to persuade faculty to take their teaching more seriously. University staff are usually hired for their research prowess not for their teaching skills. Krebs used to talk about "teaching in an atmosphere of research" - - a worthy aim - - but we all know that teaching is seriously undervalued. Promotion and tenure do not often come as rewards for good teaching: better to concentrate on the research if you want to get on. Thus teaching becomes a chore that gets in the way of one's progress. What can be done? There are moves in some institutions towards teacher appraisal. Research produces a tangible outcome - - publications, grant money - - but it is more difficult to see and to evaluate a product in the case of teaching. Some institutions are encouraging teachers to accumulate a Teaching Profile. Teaching may be appraised by students (eg by questionnaires), by oneself (eg by checklist against perceived performance), and by one's peers (now teaching becomes a less 'private' activity). It is important that people evaluate their teaching skills and improve them, but they also need to be given incentives to do this. Meanwhile, I suppose we need to continue to remind people of the importance of the task, convince them that training the next generation of biochemists is a worthwhile activity. Some institutions have developed a Code of G o o d Practice in Teaching. Such Codes typically reco m m e n d that there should be a shifting of emphasis away from the acquisition of knowledge, reducing scheduled and lecture time, so that we begin to promote indepen-
BIOCHEMICAL EDUCATION 20(3) 1992
dent learning and problem solving, indeed, train biochemists for the activities that will be required of them during the next 10, 20, 30 years.
Getting the Students Involved: Overhead Projector The Icebreaker MURRAY SAFFRAN
Department of Biochemistry & Molecular Biology Medical College of Ohio Toledo, Ohio 43699-0008, USA Problem H o w can a teacher get the students involved in a discussion in the classroom when so many students are shy or afraid to speak?
Answer Use the overhead projector as an icebreaker. Many of us use the overhead projector in lectures, most often as an 'electric blackboard'. We write on its acetate strip instead of on a blackboard because of its convenience and visibility. In addition, many of us prepare transparencies ahead of time to display during a lecture instead of conventional slides because the room lights do not need dimming and because of the versatility of the overhead projector. But how many of us use the overhead projector to encourage participation by the students in discussion?
Barriers For a student to speak out in class two barriers must be overcome: (a) shyness, and (b) fear of saying something silly or wrong. It is somehow less of a personal act for a student to write on the stage of the overhead projector than to speak. The student seems to communicate with the inanimate sheet of acetate rather than with classmates when words are written. Once the writing is done and the words are out for all to see, the student realizes that, whether the words are right or wrong, there is no disgrace and no penalty for trying. The sympathy of the class is with the student at the front of the class and they show it with their responses. The act of writing helps the student to overcome the fear of being wrong before an audience. This, in turn, helps the student to overcome the shyness that inhibits speech. When asked to read and comment on the words just written, the student does so with far less hesitation than when asked to speak without a 'script'.
Multiple choice items Many classroom exercises can be used to involve student responses on the overhead projector. The student can be asked to select the best answer to a multiple choice question or to supply a missing word or phrase in a 'fill-inthe-blank' question. I have gone a step further and asked the students to write their own multiple choice questions on the material just discussed on acetate film. The
138
Complete the structure of galactose:
questions are displayed to the class by the authors, who ask for the answer. Then the author must justify the correct answer and show why the other responses are incorrect. In this scenario the student-author is the authority with the correct answer. This lessens the anxiety of being 'wrong'. Metabolic pathways Metabolic maps in simplified form can be displayed on the screen and the students asked to come up to the projector and label the c o m p o n e n t compounds, enzymes, etc. A n o t h e r overhead projector exercise is to distribute an outline of a process, such as the Krebs cycle, to the class and ask them to fill in details on an acetate overlay. The outline is displayed on the screen and students are asked to fit their acetate with details onto the outline already on the screen and to defend their product.
Figure 3 Complete the structure of guanine:
Other examples This technique can be used at several levels of complexity and difficulty. A D N A sequence is displayed on the screen. The students are given a c - D N A p r o b e on an acetate sheet and are asked to find the best fit in the D N A . N a m e s of amino acids can be matched with structures, single-letter abbreviations and properties. In a protein structure on the screen, students can fill in Hbonds. In each of the above examples, the task is explained and defended by the student. I am sure you can think of m a n y other examples of the use of the overhead projector, and particularly the ability to add overlays, for active participation by students. H e r e are some examples (Figs 1-6).
Amino their
acids
with
structure
a benzene
ring in
include
) Figure 4 Fill in the names of compounds in the cycle:
Urea'-
(A) l y s i n e (B) leucine (C) tyrosine (D) histidine
Figure 5
(E) phenylalanine
Match the cDNA
Figure 1
The (A) (B) (C) (D) (E)
\
organ
with
the lowest
pH is the
duodenum s a l i v a r y gland colon stomach lung
to
the mRNA
Probe-TTTGTACTCCTAA mRNA:
CAUUCAAACAUGAGGAUUACCCA AGUGCCUCAACCGGGGGUUUGAA
Figure 6 EDUCATION
probe
CAUGCUUCGUACUAAAUAUGGAA
Figure 2 BIOCHEMICAL
J
20(3) 1992