Ghrelin improves body weight loss and skeletal muscle catabolism associated with angiotensin II-induced cachexia in mice

Regulatory Peptides 178 (2012) 21–28

Contents lists available at SciVerse ScienceDirect

Regulatory Peptides journal homepage: www.elsevier.com/locate/regpep

Ghrelin improves body weight loss and skeletal muscle catabolism associated with angiotensin II-induced cachexia in mice Masako Sugiyama a,⁎, Akira Yamaki a, Mayumi Furuya a, Norio Inomata a, Yoshiharu Minamitake b, Kazuhiro Ohsuye b, Kenji Kangawa c a b c

Faculty of Pharmacology I, Asubio Pharma Co., Ltd., 6-4-3, Minatojima-Minamimachi, Chuo-ku, Kobe, Hyogo 650‐0047, Japan Asubio Pharma Co., Ltd., 6-4-3, Minatojima-Minamimachi, Chuo-ku, Kobe, Hyogo 650‐0047, Japan National Cerebral and Cardiovascular Center Research Institute, 5-7-1, Fujishirodai, Suita Osaka 565‐8565, Japan

a r t i c l e

i n f o

Article history: Received 1 March 2012 Received in revised form 25 May 2012 Accepted 20 June 2012 Available online 28 June 2012 Keywords: Ghrelin Angiotensin II Body weight IGF-1 Muscle catabolism Cachexia

a b s t r a c t Ghrelin is a gastric peptide that regulates energy homeostasis. Angiotensin II (Ang II) is known to induce body weight loss and skeletal muscle catabolism through the ubiquitin–proteasome pathway. In this study, we investigated the effects of ghrelin on body weight and muscle catabolism in mice treated with Ang II. The continuous subcutaneous administration of Ang II to mice for 6 days resulted in cardiac hypertrophy and significant decreases in body weight gain, food intake, food efficiency, lean mass, and fat mass. In the gastrocnemius muscles of Ang II-treated mice, the levels of insulin-like growth factor 1 (IGF-1) were decreased, and the levels of mRNA expression of catabolic factors were increased. Although the repeated subcutaneous injections of ghrelin (1.0 mg/kg, twice daily for 5 days) did not affect cardiac hypertrophy, they resulted in significant body weight gains and improved food efficiencies and tended to increase both lean and fat mass in Ang II-treated mice. Ghrelin also ameliorated the decreased IGF-1 levels and the increased mRNA expression levels of catabolic factors in the skeletal muscle. IGF-1 mRNA levels in the skeletal muscle significantly decreased 24 h after Ang II infusion, and this was reversed by two subcutaneous injections of ghrelin. In C2C12-derived myocytes, the dexamethasone-induced mRNA expression of atrogin-1 was decreased by IGF-1 but not by ghrelin. In conclusion, we demonstrated that ghrelin improved body weight loss and skeletal muscle catabolism in mice treated with Ang II, possibly through the early restoration of IGF-1 mRNA in the skeletal muscle and the amelioration of nutritional status. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Chronic heart failure (CHF), which often includes body weight loss and skeletal muscle catabolism, is commonly termed cardiac cachexia and is a predictor of poor outcome [1]. Cachexia is a complex metabolic syndrome that is associated with an underlying illness and that is characterized by a loss of skeletal muscle with or without a loss of fat mass [2]. Several therapies for cachexia are being explored, all of which slightly increase body weight with little impact on muscle function [1]. The mechanisms of cardiac cachexia are poorly understood, but there is recent evidence that angiotensin II (Ang II) plays an important role. The Ang II plasma levels in patients with CHF associated Abbreviations: Ang II, angiotensin II; IGF-1, insulin-like growth factor 1; CHF, chronic heart failure; MuRF1, muscle RING finger protein 1; GHS-R, growth hormone secretagogue receptor; GH, growth hormone; sc, subcutaneous; ip, intraperitoneal; RT-PCR, real-time polymerase chain reactions; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; DEX, dexamethasone; SE, standard errors. ⁎ Corresponding author. Tel.: +81 78 306 5192; fax: +81 78 306 5971. E-mail address: [email protected] (M. Sugiyama). 0167-0115/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2012.06.003

with cachexia were higher than in those without cachexia [3]. Ang II infusions to rats have been shown to induce marked reductions in body weight that were accompanied by decreased levels of circulating and skeletal muscle insulin-like growth factor (IGF-1) [4]. In addition, Ang II infusion to transgenic mice with muscle-specific expression of IGF-1 did not result in decreased body weight or muscle mass [5]. These findings suggested that a down-regulation of IGF-1 signaling in the skeletal muscle could mediate the muscle catabolism that is associated with Ang II. Recent studies using in vitro models of muscle atrophy have indicated that IGF-1 acts through Akt and FoxO to suppress atrogin-1 and muscle RING finger protein 1 (MuRF1) transcription [6]. Atrogin-1 and MuRF1 are ubiquitin ligases, the expressions of which are increased in various muscle atrophy models [7]. Ang II induced an upregulation of atrogin-1 and MuRF1, which was followed by skeletal muscle catabolism [8]. Moreover, Ang II infusion increased circulating IL-6, suggesting that Ang II-induced inflammation contributed to muscle wasting [9]. It has also been reported that Ang II is involved in the wasting conditions that are associated with cancer, chronic renal failure, and sarcopenia [10–12], suggesting that Ang II plays a common role in the skeletal muscle catabolism that is associated with various diseases and aging.

22

M. Sugiyama et al. / Regulatory Peptides 178 (2012) 21–28

Table 1 Primers and probes for real-time PCR. Gene

Table 2 Effect of ghrelin on body weight gain, cumulative food intake and food efficiency in mice treated with angiotensin II.

Sequence

Atrogin-1

Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer TaqMan probe Forward primer Reverse primer Taqman probe

MuRF1 FoxO1 FoxO3a IGF-1

GAPDH

AGCGACCTCAGCAGTTACTGC CTTCTGGAATCCAGGATGGC TGTCTGGAGGTCGTTTCCG GTGCCGGTCCATGATCACTT CTCGAACCAGCTCAAATGCTAGTAC GTGGATACACCAGGGAATGCA TCGTCTCTGAACTCCTTGCGT TGGAGTGTCTGGTTGCCGT AGTGTTGCTTCCGGAGCTGT GGCTGCTTTTGTAGGCTTCAGT ATCTGAGGAGACTGGAGATGTACTGTGCCC TGCACCACCAACTGCTTAG GGATGCAGGGATGATGTTC CAGAAGACTGTGGATGGCCCCTC

Ghrelin was identified as an endogenous ligand for the growth hormone secretagogue receptor (GHS-R) in the stomach [13]. While ghrelin has a potent orexigenic effect that is independent of growth hormone (GH) secretion [14], ghrelin has also been shown to have a number of pleiotropic effects on energy metabolism, such as a reduction of fat utilization, the stimulation of adiposity, and the inhibition of sympathetic nerve activity and inflammatory cytokines [15–17]. These observations suggest that ghrelin might improve cachectic conditions. Anabolic effects of ghrelin have been expected based on the activation of the GH– IGF-1 axis. Indeed, recent reports have suggested that ghrelin was able to improve lean body mass in tumor-bearing rats [18] and in a chronic kidney disease model of 5/6 nephrectomy in rats [19] and inhibited muscle protein breakdown in rats with thermal injury [20]. However, it has not been examined how and when ghrelin acts on

Control Body weight gain (g) Total food intake (g) Food efficiency

Vehicle

0.1 mg/kg ghrelin

1.0 mg/kg ghrelin

0.87 ± 0.12

−0.23 ± 0.29⁎⁎

0.44 ± 0.22

1.42 ± 0.25##

21.3 ± 1.0

17.9 ± 3.6

18.3 ± 3.3

19.8 ± 2.6

0.040 ± 0.005

−0.034 ± 0.035⁎⁎ 0.015 ± 0.016

0.068 ± 0.012##

Body weight gain and total food intake were evaluated during ghrelin or vehicle treatment period (Day 1 to Day 6). Food efficiency was calculated by dividing body weight gain with total food intake. Values represent the means±SE of 16 mice. ⁎⁎Pb 0.01 vs the control group by t-test. ##Pb 0.01 vs the vehicle group by Dunnett's test.

Ang II-induced muscle catabolism and the expression of anabolic and catabolic factors in the skeletal muscle. In the present study, we investigated the effects of ghrelin on the body weight and body composition of mice with Ang II-induced cachexia. In addition, we examined the effects of ghrelin on the IGF-1 contents in serum and skeletal muscle and the mRNA expression levels of IGF-1 and catabolic factors such as atrogin-1 and MuRF1 in skeletal muscle. We have further tested whether ghrelin suppresses the mRNA expression levels of atrogin-1 in the skeletal muscle with cultured C2C12 cells, which are myoblasts that have been established from a mouse leg muscle and that are known to differentiate to myocytes [21,22].

A 18.5 18.0

lean mass (g)

2 1

##

##

0

**

**

**

**

Daily food intake (g)

17.0

**

16.5

**

15.5 -2 0

1

2

3

4

5

6

AngII

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

ghrelin

B

5 4

control 7

Days after AngII infusion

B

17.5

16.0

**

-1

4.2

#

3

4.0

*

*

**

2 **

1 0 0

1

2

3

4

5

6

7

Days after AngII infusion Fig. 1. Effects of ghrelin on body weight gain (A) and daily food intake (B) in mice treated with angiotensin II (Ang II). Ang II (1 μg/kg/min) was administered to mice for 6 days by subcutaneous infusion. Day 0 indicates the first day of Ang II infusion. Ghrelin (0.1 or 1.0 mg/kg) was subcutaneously administered twice daily for 5 days from Day 1 to Day 5. The arrows indicate ghrelin administration. Open triangles: saline+vehicle (control group); open circles: Ang II+vehicle (vehicle group); solid triangles: Ang II+0.1 mg/kg ghrelin (0.1 mg/kg group); solid circles; Ang II+1.0 mg/kg ghrelin (1.0 mg/kg group). Data represent the means±standard error (SE) of 16 mice. *Pb 0.05, **Pb 0.01 vs the control group by t-test. #P b 0.05, ##P b 0.01 vs the vehicle group by Dunnett's test.

fat mass (g)

Body weight change (g)

A

3.8

*

3.6 3.4 3.2 control

AngII

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

ghrelin

Fig. 2. Effects of ghrelin on body composition in mice treated with Ang II on Day 6. (A) Lean mass. (B) Fat mass. Data represent the means ± SE of 16 mice. *P b 0.05, **P b 0.01 vs the control group by t-test.

M. Sugiyama et al. / Regulatory Peptides 178 (2012) 21–28

2. Material and methods 2.1. Animals This study was approved by the Committee for Ethics in Animal Experiments of Asubio Pharma Co., Ltd. We used 9-week-old male C57BL/6N mice (Charles River Laboratories International, Inc., Yokohama, Japan). Mice were housed individually in plastic cages containing wood chips. Mice were maintained under controlled light conditions (lights from 7:00 to 19:00), and constant temperature with food and water available ad libitum. 2.2. Ang II and ghrelin treatment Under brief ether anesthesia, an osmotic pump (model 1007D, DURECT Corporation, Cupertino, CA, USA) was implanted under the dorsal skin for the subcutaneous (sc) infusion of Ang II (Peptide Institute, Inc., Osaka, Japan) at a rate of 1 μg/kg/min or of saline. Day 0 indicated the first day of Ang II infusion. Human ghrelin was synthesized as described previously [23]. Human ghrelin (0.1 or 1.0 mg/kg) was dissolved in a 5% mannitol solution and administered twice daily (sc; around 10:30 and 18:00) from Day 1 to Day 5. We confirmed that ghrelin induced food intake and GH release in normal mice at these dosages (data not shown). The body weight and food intake of the mice were measured daily at around 8:00. Food efficiency was calculated by dividing the cumulative weight gain by the cumulative food intake. Mice were anesthetized with intraperitoneal (ip) injections of pentobarbital (50 mg/kg), and body compositions were measured with PIXImus2

(GE Medical Systems, Madison, WI, USA) by the dual-energy X-ray absorptiometry method on Day 6. Immediately after the measurement of body composition, blood was collected from the vena cava. The gastrocnemius muscles and the hearts were isolated, weighed, frozen in liquid nitrogen, and stored at −80 °C until the analysis. The blood samples were centrifuged at 12,000 rpm for 5 min at 4 °C, and the serum samples were kept at −80 °C until the IGF-1 analysis. In the second experiment, the mice were treated with a sc infusion of Ang II, and gastrocnemius muscles were harvested under pentobarbital (50 mg/kg, ip) anesthesia on Days 1, 3, and 6. In the third experiment, the mice were implanted with an osmotic pump containing Ang II in the morning of Day 0, and ghrelin (0.1 or 1.0 mg/kg, sc) was injected in the evening of Day 0 (around 18:00) and in the morning of Day 1 (around 10:00) in order to investigate the short-term effect of ghrelin. Around 4 h after the second ghrelin injection, the gastrocnemius muscles were isolated while the mice were under pentobarbital (50 mg/kg, ip) anesthesia. 2.3. Measurement of IGF-1 Gastrocnemius muscle samples were homogenized in a RIPA buffer that was composed of phosphate-buffered saline, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl sulfate containing protease inhibitors (1 mg/mL Pefabloc, Roche Diagnostics GmbH, Mannheim, Germany). The homogenates were frozen and thawed and then centrifuged at 12,000 rpm at 4 °C for 10 min. IGF-1 levels were measured in the supernatant samples. Serum samples were treated with HCl in order to separate IGF-binding proteins from IGF-1. IGF-1 concentrations in the supernatant and HCl-treated serum were determined

B

12

500

##

11

serum IGF-1 (ng/mL)

muscle IGF-1 (ng/g)

A

**

10

9 AngII

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

300 200 100

control

AngII

-

-

AngII

AngII

ghrelin 0.1 mg/kg 1.0 mg/kg

D

8

IGF-1/GAPDH (% control)

HW/BW (mg/g)

400

0 control

ghrelin

C

23

**

6

4

2

0

400

**

300 200 100 0

control

AngII

AngII

AngII

control

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

-

-

ghrelin 1.0 mg/kg

ghrelin

Fig. 3. Effects of ghrelin on the insulin-like growth factor 1 (IGF-1) contents in gastrocnemius muscle (A), serum IGF-1 levels (B), heart weight (HW) to body weight (BW) ratio as an index of cardiac hypertrophy (C), and the mRNA expression levels of IGF-1 in the heart (D) of mice treated with Ang II on Day 6. Data represent the means ± SE of 16 mice. **P b 0.01 vs the control group by t-test. ##P b 0.01 vs the vehicle group by Dunnett's test.

24

M. Sugiyama et al. / Regulatory Peptides 178 (2012) 21–28

by enzyme-linked immunosorbent assays, which were conducted according to the methods described in the instruction manuals for the use of the Monoclonal Anti-mouse IGF-1 Antibody (R&D Systems, Inc., Minneapolis, MN, USA). All samples were measured in duplicate. 2.4. Real-time polymerase chain reactions (RT-PCR) The total RNA of the gastrocnemius muscle and heart was extracted using RNeasy Lipid Kits (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions. RT-PCR was performed with a 7500 Real Time PCR System (Life Technologies Corporation, Carlsbad, CA, USA). Primers were obtained from previously published sequences of atrogin-1, MuRF1, FoxO3a [24], and FoxO1 [25]. Specific primers and probes for IGF-1 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined with the Primer Express software (Life Technologies Corporation). Primers and probes are listed in Table 1. RT-PCR was conducted with the following cycle parameters: 2 min at 50 °C, and 10 min at 95 °C, which were followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. All specific quantities were corrected according to the amount of GAPDH amplification. 2.5. Culture and differentiation of C2C12 cells and the effect of ghrelin on the levels of mRNA expression of atrogin-1 in vitro

treated with ghrelin or vehicle by two daily sc injections for 5 days (Days 1 to 5) (Fig. 1A, B). Although the repeated sc administration of ghrelin twice daily for 5 days showed little effect in the 0.1 mg/kg group, it showed a trend toward increased body weight in the 1.0 mg/kg group compared to the Ang II group (vehicle group) from Day 3 onward, and significant differences were observed on Days 5 and 6 (Fig. 1A, Table 2). Ghrelin at a dose of 1.0 mg/kg significantly increased the daily food intake on Day 5 compared to that in the vehicle group and showed a trend toward higher values on the other days (Fig. 1B, Table 2). The food efficiency in the vehicle group was significantly lower than that of the control group, suggesting that Ang II treatment interfered with energy utilization. In the 0.1 mg/kg and 1.0 mg/kg ghrelin groups, the food efficiencies were higher than that of the vehicle group, and a significant increase was observed in the 1.0 mg/kg group (Table 2).

3.2. Effect of ghrelin on body composition in mice treated with Ang II In Ang II-treated mice, both lean mass and fat mass were significantly decreased compared to those in the control group on Day 6 (Fig. 2). Ghrelin at 0.1 mg/kg did not affect body composition. In the

A

3.1. Effect of ghrelin on body weight, food intake, and food efficiency in mice treated with Ang II The continuous sc infusion of Ang II induced a significant decrease in body weight gain compared to that of the Ang II-untreated group (control group) throughout the treatment period (Fig. 1A, Table 2). Ang II also significantly decreased the daily food intake on Days 1, 2, 4, and 5 compared to the control group (Fig. 1B). Because the reduction of body weight and food intake by Ang II was most prominent at Day 1, we divided the Ang II-treated mice into 3 groups that were treated with vehicle, 0.1, or 1.0 mg/kg of ghrelin on Day 1 and then

15

20

25

30

25

30

Body weight (g)

B

800 r2=0.0354

serum IGF-1 (ng/mL)

3. Results

10

5 10

2.6. Statistical analysis Data are presented as the means ± standard errors (SE). Statistics were computed using EXSAS (Arm Systex Co., Ltd., Osaka, Japan). The results were analyzed using Student's t-tests on the data from the 2 experimental groups. Statistical analyses between the Ang II or DEX group and the ghrelin-treated groups were conducted by multiple comparisons using Dunnett's test. For the in vitro study, comparisons between the DEX group and the IGF-1-treated groups were analyzed by Tukey–Kramer tests. P values less than 0.05 were considered statistically significant. Linear regression analyses were used to determine the correlations between body weight and IGF-1 levels.

15 r2=0.5118

muscle IGF-1 (ng/g)

C2C12 cells, which are a mouse myoblast cell line [21], were obtained from DS Pharma Biomedical Co., Ltd. (Osaka, Japan) and maintained in Dulbecco's modified Eagle's medium (DMEM) with 100 U/mL penicillin, 100 μg/mL streptomycin, and 10% fetal bovine serum (FBS). The undifferentiated C2C12 cells were plated onto 6-well plates and cultured in DMEM containing 10% FBS until the cells reached confluence. The medium was then replaced with DMEM containing 2% horse serum and incubated for another 4 days in order to induce myogenic differentiation. Differentiated myocytes were treated with 100 nM of dexamethasone (DEX) and ghrelin (1 to 100 nM) or IGF-1 (10 ng/mL) in DMEM containing 1% bovine serum albumin for 24 h. The data were obtained in 3 or 5 independent experiments. Total RNA was extracted using RNeasy Lipid Kits.

600

400

200

0 10

15

20

Body weight (g) Fig. 4. Correlations between body weight and IGF-1 contents in gastrocnemius muscle (A), or serum (B). Open triangles, saline + vehicle (control group); open circles, Ang II + vehicle (vehicle group); solid triangles, Ang II + 0.1 mg/kg ghrelin (0.1 mg/kg group); solid circles, Ang II+ 1.0 mg/kg ghrelin (1.0 mg/kg group).

M. Sugiyama et al. / Regulatory Peptides 178 (2012) 21–28

B MuRF1/GAPDH (% control)

atrogin-1/GAPDH (% control)

A 150

100

##

50

0

ghrelin

control

AngII

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

FoxO3a/GAPDH (% control)

D 200

*

100

0 control

AngII

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

150

100

## 50

0 control

AngII

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

ghrelin

C FoxO1/GAPDH (% control)

25

ghrelin

150

100

## 50

0 control

AngII

AngII

AngII

-

-

0.1 mg/kg

1.0 mg/kg

ghrelin

Fig. 5. Effects of ghrelin on the expression of catabolic factors in gastrocnemius muscle in mice treated with Ang II on Day 6. Atrogin-1 (A), muscle RING finger protein 1 (MuRF1) (B), FoxO1 (C), and FoxO3a (D). Data represent the means±SE of 16 mice. *Pb 0.05 vs the control group by t-test. ##Pb 0.01 vs the vehicle group by Dunnett's test.

B

100

control AngII

**

0 0

1

2

3

4

5

6

7

600

**

400 200 0

0

Days after AngII infusion

1

2

4

5

6

7

control AngII

**

600 400 200 0

0

Days after AngII infusion

D

1

2

3

4

5

6

7

Days after AngII infusion

E 120

IGF-1/GAPDH

3

##

100 80

**

60 40 20 0

ghrelin

control

AngII

-

-

AngII

atrogin-1/GAPDH

50

800 control AngII

MuRF1/GAPDH

150

C

800

atrogin-1/GAPDH

IGF-1/GAPDH

A 200

700 600 500 400 300 200 100 0

AngII

0.1 mg/kg 1.0 mg/kg

ghrelin

**

control

AngII

-

-

AngII

AngII

0.1 mg/kg 1.0 mg/kg

Fig. 6. Changes in the mRNA expression levels of IGF-1 (A), atrogin-1 (B), and MuRF1 (C) after the initiation of Ang II infusion in mice, and the effect of ghrelin on the mRNA expression levels of IGF-1 (D) and atrogin-1 (E) in the gastrocnemius muscle in mice treated with Ang II on Day 1. The infusion of Ang II was started on Day 0, and ghrelin was subcutaneously injected in the evening of Day 0 and in the morning of Day 1 at 0.1 or 1.0 mg/kg. Values are the means ± SE of 8 mice. **P b 0.01 vs the control group by t-test. ##P b 0.01 vs the vehicle group by Dunnett's test.

M. Sugiyama et al. / Regulatory Peptides 178 (2012) 21–28

3.3. Effects of ghrelin on IGF-1 levels in gastrocnemius muscle and serum, cardiac hypertrophy, and cardiac IGF-1 mRNA levels in mice treated with Ang II In Ang II-treated mice, the IGF-1 contents in the gastrocnemius muscle were significantly decreased compared to that of the control group, and 1.0 mg/kg of ghrelin significantly inhibited the reductions of muscular IGF-1 contents (Fig. 3A). Serum IGF-1 levels were not influenced by Ang II and ghrelin (Fig. 3B). Cardiac hypertrophy was evaluated by the heart weight to body weight ratio. Ang II induced cardiac hypertrophy, and ghrelin showed no effects on it (Fig. 3C). Ang II significantly increased the levels of expression of IGF-1 mRNA in the heart in both vehicle- and ghrelin-treated groups (Fig. 3D). The body weights of mice were significantly correlated with the IGF-1 contents in the gastrocnemius muscle, but not with those in serum (Fig. 4A, B). 3.4. Effects of ghrelin on the levels of expression of the mRNA of catabolic factors in the gastrocnemius muscle in mice treated with Ang II In Ang II-treated mice, the mRNA levels of atrogin-1, MuRF1, and FoxO3a did not change compared to those in the control group, but the mRNA levels of FoxO1 in the gastrocnemius muscle on Day 6 were significantly increased (Fig. 5). The mRNA expression levels of atrogin-1, MuRF1, and FoxO3a were significantly attenuated by 1.0 mg/kg of ghrelin. The increased levels of expression of FoxO1 mRNA tended to recover in the 1.0 mg/kg ghrelin group compared to the Ang II group. We next examined the changes in the levels of mRNA expression of IGF-1, atrogin-1, and MuRF1 in the gastrocnemius muscle after the initiation of Ang II treatment. As shown in Fig. 6A–C, a marked decrease in IGF-1 mRNA levels and notable increases in the mRNA levels of atrogin-1 and MuRF1 were observed on Day 1, and their levels recovered to control levels on Day 6. Then, we investigated the effects of the two injections of ghrelin just after the initiation of Ang II infusion on the mRNA expression levels of these factors in the skeletal muscle. On Day 1, 1.0 mg/kg of ghrelin did not affect the Ang II-induced increase in mRNA levels of atrogin-1, but it significantly increased mRNA expression levels of IGF-1 in the gastrocnemius muscle (Fig. 6D, E). Ghrelin did not affect Ang II-induced decreases in food intake and body weight by the two injections on Day 1 (body weight: vehicle: 20.18 ± 0.26 g, 1.0 mg/kg ghrelin: 20.29 ± 0.32 g; food intake: vehicle: 1.85 ± 0.23 g, 1.0 mg/kg ghrelin: 1.70 ± 0.23 g). 3.5. The effects of ghrelin on the mRNA expression levels of atrogin-1 in differentiated C2C12 myocytes in vitro In order to clarify a direct effect of ghrelin on atrogin-1 mRNA expression levels in the skeletal muscle, we investigated this issue with cultured C2C12 myocytes. In the differentiated C2C12 cells, DEX (100 nM) increased atrogin-1 mRNA levels (Fig. 7A). Ghrelin (1 to 100 nM) did not affect atrogin-1 mRNA levels. However, IGF-1 (10 ng/mL) attenuated the levels of expression of atrogin-1 mRNA both in the presence and absence of DEX (Fig. 7B). 4. Discussion It has been previously reported that the overexpression of IGF-1 in the skeletal muscle effectively blocks Ang II-induced muscle loss [5]. In the present study, we demonstrated that the repeated sc administration of ghrelin improved body weight gain and skeletal muscle catabolism without affecting cardiac hypertrophy in Ang II-treated mice. Our results suggested that ghrelin ameliorated the cachectic

A atrogin-1/GAPDH

1.0 mg/kg ghrelin group, both lean mass and fat mass were higher than those of the vehicle group.

250

**

200 150 100 50 0

ghrelin (nM)

B

-

-

-

-

DEX

DEX

DEX

DEX

0

1

10

100

0

1

10

100

300

** atrogin-1/GAPDH

26

200

##

100

0

-

IGF-1

DEX -

DEX IGF-1

Fig. 7. Effects of ghrelin (A) and IGF-1 (B) on the mRNA expression levels of atrogin-1 in the absence or presence of 100 nM of dexamethasone (DEX) in differentiated C2C12 myocytes. IGF-1 was added to the differentiated C2C12 myocytes at 10 ng/mL. Data represent the means ± SE of 3 experiments. **P b 0.01 vs the control-group, ##P b 0.01 vs the DEX-treated group by Tukey–Kramer test.

state by enhancing food intake, energy utilization, and IGF-1 signaling in the skeletal muscle. We confirmed that Ang II-induced cachexia occurred in mice through decreases in body weight gain, food intake, food efficiency, lean mass, and IGF-1 levels in the gastrocnemius muscle and through increases in mRNA expression levels of atrogin-1 and MuRF1 in the gastrocnemius muscle (Figs. 1, 2, 3, and 5). The decrease in body weights was the most drastic phenomenon that was observed shortly after the initiation of Ang II treatment, as reported previously [5]. In addition, we found that changes in daily food intake and in the mRNA expression levels of IGF-1, atrogin-1, and MuRF1 in the skeletal muscle were most prominent 1 day after the initiation of Ang II treatment (Figs. 1B, 6A–C). Therefore, we started the administration of ghrelin on Day 1 in our first study. Ghrelin (1.0 mg/kg, sc, twice daily) significantly improved body weight gain and food efficiency in mice treated with Ang II (Table 2). Ghrelin also improved food intake in Ang II-treated mice (Fig. 1B). These results suggested that the effects of ghrelin on food intake and energy utilization might be involved, at least partly, in the improvements of body weight gain. Ghrelin also showed a trend for an improvement in both lean mass and fat mass in the mice treated with Ang II (Fig. 2). Although it has been reported that the repeated sc administration of ghrelin (approximately 8 mg/kg) to mice specifically increased fat mass alone [15], the present results suggested that ghrelin could increase not only

M. Sugiyama et al. / Regulatory Peptides 178 (2012) 21–28

fat mass, but also skeletal muscle mass. Our results are in accordance with the recent reports that showed anabolic effects of ghrelin in animals with various diseases [18–20,26,27]. Ang II induced cardiac hypertrophy and an increase in the levels of expression of IGF-1 mRNA in the heart (Fig. 3C, D). It has been reported that treatment with hydralazine abolished the induction of IGF-1 mRNA levels in the left ventricle by Ang II infusion, indicating that Ang II induces cardiac IGF-1 mRNA expression levels through a pressure-mediated mechanism [28]. Ghrelin, which is known to have a vasodilating activity, ameliorates cardiac remodeling in rats with myocardial infarctions [27,29]. In the present study, ghrelin did not affect cardiac hypertrophy and IGF-1 mRNA levels in the heart (Fig. 3C, D), suggesting that ghrelin did not reduce the blood pressure in this experimental condition. Ghrelin did not affect serum IGF-1 levels, but significantly improved IGF-1 contents in the gastrocnemius muscle in mice treated with Ang II (Fig. 3). We found that the body weight gains in mice highly correlated with the IGF-1 contents in the gastrocnemius muscle, but not with those in serum (Fig. 4A, B). It has been reported that systemic IGF-1 infusion did not reverse Ang II-induced catabolic effects [4], but the muscle-specific overexpression of IGF-1 reversed the muscle wasting induced by Ang II [5]. Taken together, these findings suggest that the local IGF-1 expression induced in the skeletal muscle by ghrelin is important for muscle regeneration and hypertrophy. The effects of ghrelin on the IGF-1 levels or mRNA expression levels in the gastrocnemius muscle, serum, or heart suggested that ghrelin enhanced IGF-1 in a skeletal muscle-specific manner. The mechanisms underlying the tissue-specific actions of ghrelin are not clear, but similar results were reported in a study by Barazzoni et al. in which ghrelin enhanced Akt signaling in the skeletal muscle but not in the liver [30]. It is known that serum IGF-1 is derived mostly from liver and that the IGF-1 contents in liver are much higher than in the skeletal muscle [31]. Ghrelin is a potent stimulator of GH release [13], suggesting that ghrelin increased muscle IGF-1, possibly by GH secretion. Ghrelin-induced GH secretion might not be sufficient to enhance the IGF-1 contents in liver where the basal IGF-1 levels were already very high. However, it is known that skeletal muscle IGF-1 is affected by nutritional conditions [32], and we could not rule out the possibility that ghrelin improved muscle IGF-1 through the enhancement of food intake and energy utilization. Indeed, it has been reported that the orexigenic effects of ghrelin are required for the preservation of the lean mass in the skeletal muscle of rats with chronic kidney disease [33]. Ghrelin did not directly inhibit the expression of atrogin-1 mRNA in C2C12 myocytes, but IGF-1 directly inhibited the expression of atrogin-1 in the present study (Fig. 7). It has been reported that GH releasing peptide-2, which is a peptidergic GHS-R agonist, directly attenuates atrogin-1 and MuRF1 mRNA levels through GHS-R in C2C12 myocytes [34]. These conflicting results may be derived from differences in cell subtypes or culture conditions. Yamamoto et al. reported that GHS-R mRNA was present in differentiated C2C12 cells but not in undifferentiated C2C12 cells. In contrast, we observed that the expression of GHS-R mRNA was in a very low level in C2C12 cells and myocyte differentiation did not upregulate GHS-R mRNA (data not shown). We found that the two treatments of ghrelin just after the initiation of the Ang II infusions significantly improved the decreases in the mRNA expression levels of IGF-1, but not the increases in the expression levels of the catabolic factors (Fig. 6). The dosing schedule of ghrelin was not equal to that of our first study, but we did not observe an increase in food intake by ghrelin on Day 1 in both the first and third experiments. These results suggest that ghrelin increased the mRNA expression levels of IGF-1 in the skeletal muscle independently from its orexigenic actions. Nevertheless, we speculate that the decrease in the mRNA expression levels of the catabolic factors was preceded by the early reversal of IGF-1 mRNA in the skeletal muscle by ghrelin.

27

In conclusion, the repeated sc administration of ghrelin at a dose of 1.0 mg/kg twice daily improved the body weight gain and skeletal muscle catabolism that were associated with Ang II-induced cachexia in mice. Our results demonstrated that ghrelin ameliorated the cachectic state by improving the nutritional status and IGF-1 signaling in the skeletal muscle. In addition, these results suggested that the early restoration of IGF-1 mRNA in the skeletal muscle by ghrelin might lead to improvements of muscle catabolism at later periods at least in this model.

References [1] von Haehling S, Lainscak M, Springer J, Anker SD. Cardiac cachexia: a systematic over view. Pharmacol Ther 2009;121:227–52. [2] Evans WJ, Morley JE, Argiles J, Bales C, Baracos V, Guttridge D, Jatoi A, Kalantar-Zageh K, Lochs H, Mantovani G, Marks D, Mitch WE, Muscaritoni M, Najand A, Ponikowski P, Fanelli FR, Schambelan M, Schols A, Schuster M, Thomas D, et al. Cachexia: a new definition. Clin Nutr 2008;27:793–9. [3] Nagaya N, Uematsu M, Kojima M, Date Y, Nakazato M, Okumura H, Hosoda H, Shimizu W, Yamagishi W, Oya H, Koh H, Yutani C, Kangawa K. Elevated circulating level of ghrelin in cachexia associated with chronic heart failure. Circulation 2001;104:2034–8. [4] Brink M, Price SR, Chrast J, Bailey JL, Anwar A, Mitch WE, Delafontaine P. Angiotensin II induced skeletal muscle wasting through enhanced protein degradation and down-regulates autocrine insulin-like growth factor I. Endocrinology 2001;142: 1489–96. [5] Song YH, Li Y, Du J, Mitch WE, Rosenthal N, Delafontaine P. Muscle-specific expression of IGF-1 blocks angiotensin II-induced skeletal muscle wasting. J Clin Invest 2005;115:451–8. [6] Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 2004;14:395–403. [7] Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA, Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM, DeChiara TM, Stitt TN, Yancopoulos GD, Glass DJ. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 2001;294:1704–8. [8] Yoshida T, Semprun-Prieto L, Sukhanov S, Delafontaine P. IGF-1 prevents ANG II-induced skeletal muscle atrophy via Akt- and Foxo-dependent inhibition of the ubiquitin ligase atrogin-1 expression. Am J Physiol Heart Circ Physiol 2010;298:H1565–70. [9] Zhang L, Du J, Hu Z, Han G, Delafontaine P, Garcia G, Mitch WE. IL-6 and serum amyloid a synergy mediates angiotensin II-induced muscle wasting. J Am Soc Nephrol 2009;20:604–12. [10] Sanders PM, Russell ST, Tisdale MJ. Angiotensin II directly induces muscle protein catabolism through the ubiquitin–proteasome proteolytic pathway and may play a role in cancer cachexia. Br J Cancer 2005;93:425–34. [11] Workeneh BT, Mitch WE. Review of muscle wasting associated with chronic kidney disease. Am J Clin Nutr 2010;91:1128S–32S. [12] Sumukadas D, Struthers AD, McMurdo ME. Sarcopenia—a potential target for Angiotensin-converting enzyme inhibition? Gerontology 2006;52:237–42. [13] Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 1999;402: 656–60. [14] Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K, Matsukura S. A role for ghrelin in the central regulation of feeding. Nature 2001;409:194–8. [15] Tschöp M, Smiley DL, Heiman ML. Ghrelin induces adiposity in rodents. Nature 2000;407:908–13. [16] Yasuda T, Masaki T, Kakuma T, Yoshimatsu H. Centrally administered ghrelin suppresses sympathetic nerve activity in brown adipose tissue of rats. Neurosci Lett 2003;349:75–8. [17] Dixit VD, Schaffer EM, Pyle RS, Collins GD, Sakthivel SK, Palaniappan R, Lillard Jr JW, Taub DD. Ghrelin inhibits leptin- and activation-induced proinflammatory cytokine expression by human monocytes and T cells. J Clin Invest 2004;114:57–66. [18] DeBoer MD, Zhu XX, Levasseur P, Michael MM, Suzuki S, Inui A, Taylor JE, Halem HA, Dong JZ, Datta R, Culler MD, Marks DL. Ghrelin treatment caused increased food intake and retention of lean body mass in a rat model of cancer cachexia. Endocrinology 2007;148:3004–12. [19] DeBoer MD, Zhu XX, Levasseur P, Inui A, Hu Z, Han G, Mitch WE, Taylor JE, Halem HA, Dong JZ, Datta R, Culler MD, Marks DL. Ghrelin treatment of chronic kidney disease: improvement in lean body mass and cytokine profile. Endocrinology 2007;149:827–35. [20] Balasubramaniam A, Joshi R, Su C, Friend LA, Sheriff S, Kagan RJ, James JH. Ghrelin inhibits skeletal muscle protein breakdown in rats with thermal injury through normalizing elevated expression of E3 ubiquitin ligases MuRF1 and MAFbx. Am J Physiol Regul Integr Comp Physiol 2009;296:R893–901. [21] Yafee D, Saxel O. Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature 1997;270:725–7. [22] McMahon DK, Anderson PA, Nassar R, Bunting JB, Saba Z, Oakeley AE, Malouf NN. C2C12 cells: biophysical, biochemical, and immunocytochemical properties. Am J Physiol 1994;266:C1795–802. [23] Makino T, Matsumoto M, Suzuki Y, Kitajima Y, Yamamoto K, Kuramoto M, Minamitake Y, Kangawa K, Yabuta M. Semisynthesis of human ghrelin:

28

[24]

[25]

[26] [27]

[28]

[29]

M. Sugiyama et al. / Regulatory Peptides 178 (2012) 21–28 condensation of a Boc-protected recombinant peptide with a synthetic O-acylated fragment. Biopolymers 2005;79:238–47. Gilson H, Schakman O, Combaret L, Lause P, Grobet L, Attaix D, Ketelslegers JM, Thissen JP. Myostatin gene deletion prevents glucocorticoid-induced muscle atrophy. Endocrinology 2007;148:452–60. Jorgensen SB, Wojtaszewski JF, Viollet B, Fabrizio A, Birk JB, Hellsten Y, Schjerling P, Vaulont S, Neufer PD, Richter EA, Pilegaard H. Effects of α-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle. FASEB J 2005;19:1146–8. Nagaya N, Itoh T, Murakami S, Oya H, Uematsu M, Miyatake K, Kangawa K. Treatment of cachexia with ghrelin in patients with COPD. Chest 2005;128:1187–93. Okumura H, Nagaya N, Enomoto M, Nakagawa E, Oya H, Kangawa K. Vasodilatory effect of ghrelin, an endogenous peptide from the stomach. J Cardiovasc Pharmacol 2002;39:779–83. Brink M, Chrast S, Price CS, Mitch WE, Delafontaine P. Angiotensin II stimulates gene expression of cardiac insulin-like growth factor I and its receptor through effects on blood pressure and food intake. Hypertension 1999;34:1053–9. Soeki T, Kishimoto I, Schwenke DO, Tokudome T, Horio T, Yoshida M, Hosoda H, Kangawa K. Ghrelin suppresses cardiac sympathetic activity and prevents early left ventricular remodeling in rats with myocardial infarction. Am J Physiol Heart Circ Physiol 2008;294:H426–32.

[30] Barazzoni R, Zanetti M, Cattin MR, Visintin L, Vinci P, Cattin L, Stebel M, Guarnieri G. Ghrelin enhances in vivo skeletal muscle but not liver AKT signaling in rats. Obesity Silver Spring 2007;15:2614–23. [31] Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B, LeRith D. Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci U S A 1999;96:7324–9. [32] Masternak MM, Al-Regaiey KA, Lim MMDR, Jimenez-Ortega V, Panici JA, Bonkowski MS, Bartke A. Effects of caloric restriction on insulin pathway gene expression in the skeletal muscle and liver of normal and long-lived GHR-KO. Exp Gerontol 2005;40:602–11Crit Care Med 2005;38:602–11. [33] Barazzoni R, Zhu X, Deboer M, Datta R, Culler MD, Zanetti M, Guarnieri G, Marks DL. Combined effects of ghrelin and higher food intake enhance skeletal muscle mitochondrial oxidative capacity and AKT phosphorylation in rats with chronic kidney disease. Kidney Int 2010;77:23–8. [34] Yamamoto D, Ikeshita N, Matsubara T, Tasaki H, Herningtyas EH, Toda K, Iida K, Takahashi Y, Kaji H, Chihara K, Okimura Y. GHRP-2, a GHS-R agonist, directly acts on myocytes to attenuate the dexamethasone-induced expressions of muscle-specific ubiquitin ligases, atrogin-1 and MuRF1. Life Sci 2007;82:460–6.