Glial cell-specific expression of the serotonin 2 receptor gene: selective reactivation of a repressed promoter

Molecular Brain Research, 20 (1993) 181-191

181

© 1993 Elsevier Science Publishers B.V. All rights reserved 0169-328x/93/$06.00

BRESM 70656

Research Reports

Glial cell-specific expression of the serotonin 2 receptor gene: selective reactivation of a repressed promoter Daming Ding a,,, Miklos Toth a, Yongzhi Zhou a,,, Christopher Parks a, Beth J. Hoffman b and Thomas Shenk a a Howard Hughes Medical Institute, Department of Molecular Biology, Princeton University, Princeton, NJ 08544-1014 (USA) and b National Institute of Mental Health, Laboratory of Cell Biology, Bethesda, MD 20892 (USA)

(Accepted 20 April 1993)

Key words: Serotonin 5-HT2 receptor; Gene regulation; Promoter; Repression; Reactivation; Glial cell

The 5' flanking region of the 5-HT2 receptor gene has been cloned, sequenced and its transcriptional regulatory functions analyzed. The promoter lacks an identifiable TATA motif, and utilizes at least 11 clustered start sites. Promoter function was analyzed by transient assays in rat C6 glioma cells, which were shown to express the endogenous 5-HTe receptor gene, as well as in rat CREF and human HeLa cells which do not express the endogenous gene. The basal promoter functioned equally well in all three cell lines; and a repression domain, located upstream of the basal promoter, inhibited activity of the promoter in all three cell lines. A far upstream cell specific activator domain restored promoter activity in C6 glioma cells, but did not reactivate the silenced promoter in CREF or HeLa cells. The upstream activator domain, repressor domain and basal promoter functioned in concert to achieve cell type specific expression. The activator domain did not direct C6 glioma cell specific expression in the absence of the repressor domain or in constructs carrying a heterologous basal promoter. These results indicate that glial cell expression of the 5-HT2 receptor gene is achieved through a cell type specific reactivation of a repressed promoter.

INTRODUCTION S e r o t o n i n ( 5 - h y d r o x y t r y p t a m i n e ; 5 - H T ) is a n e u r o t r a n s m i t t e r t h a t m e d i a t e s a diverse a r r a y o f r e s p o n s e s in t h e m a m m a l i a n c e n t r a l a n d p e r i p h e r a l n e r v o u s systems. 5 - H T exerts its effects on m u l t i p l e r e c e p t o r subtypes, d e s i g n a t e d 5-HT1A, 5-HTIB , 5 - H T I c , 5-HT1D , 5 - H T 2, 5 - H T 3 a n d 5 - H T 4. T h e s e r e c e p t o r s have differe n t affinities for 5 - H T a n d distinct tissue distributions. Initially, t h e y w e r e c h a r a c t e r i z e d a n d g r o u p e d on t h e basis o f t h e i r affinities for v a r i o u s agonists a n d a n t a g o nists. M o r e recently, c D N A s c o r r e s p o n d i n g to several 5 - H T r e c e p t o r s have b e e n c l o n e d , facilitating t h e i r study at t h e m o l e c u l a r level ( r e v i e w e d in refs. 15, 17, 34). T h e 5 - H T 2 r e c e p t o r is well c h a r a c t e r i z e d p h a r m a c o logically, a n d its c D N A has b e e n c l o n e d f r o m t h e rat 18'35. R e c e n t l y , t h e g e n o m i c D N A c o r r e s p o n d i n g to

t h e h u m a n 5 - H T 2 r e c e p t o r g e n e has b e e n c l o n e d a n d p a r t i a l l y s e q u e n c e d 6. T h e g e n e consists o f t h r e e exons (412, 201 a n d 800 b p in lenght, respectively) s e p a r a t e d by two large i n t r o n s (3.2 kb a n d m o r e t h a n 8 kb, respectively). T h e 5 - H T 2 r e c e p t o r u n l i k e o t h e r 5 - H T r e c e p t o r s has low affinity for 5 - H T ( m i c r o m o l a r range), b u t b i n d s the h a l l u c i n o g e n , lysergic acid d i e t h y l a m i d e ( L S D ) , with n a n o m o l a r affinity. Several a n t a g o n i s t s like m i a n s e r i n a n d k e t a n s e r i n can effectively b l o c k l i g a n d b i n d i n g to this r e c e p t o r . T h e 5-HTz r e c e p t o r activates a h e t e r o t r i m e r i c G T P - b i n d i n g p r o t e i n which in t u r n s t i m u l a t e s p h o s p h o l i p a s e C - c a t a l y z e d hydrolysis o f p h o s p a t i d y l i n o s i t o l lipids to yield t h e s e c o n d messengers, inositol t r i p h o s p h a t e a n d diacylglycerol (rev i e w e d in refs. 15, 17). T h e 5 - H T 2 r e c e p t o r is e x p r e s s e d in a v a r i e t y o f cell types i n c l u d i n g n e u r o n s a n d glial cells in t h e c e n t r a l n e r v o u s system, as well as in platelets, lymphocytes,

Correspondence: T. Shenk, Howard Hughes Medical Institute, Department of Molecular Biology, Princeton University, Princeton, NJ 08544-1014,

USA. Fax: (1) (609) 258-1704. * Present address: International Department of Research and Development, Zhuhai S.E.Z. Lizhu Pharmaceutical (Group) Co., Ltd., Zhuhai, Guangdong, People's Republic of China.

182 and smooth muscle cells (reviewed in ref. 17). Expression of the 5-HT 2 receptor and its mRNA show regional differences in the central nervous system with the highest density in the cerebral cortex and olfactory bulb 29. Lower levels of the receptor were detected in the brainstem. It has also been shown that expression of the 5-HT 2 receptor and its m R N A is developmentally regulated 37. The heterogeneous expression pattern of the 5-HT 2 receptor requires a complex control mechanism. As a first step toward understanding the regulation of 5-HT 2 receptor gene expression, we have cloned and characterized its 5' flanking region. The 5-HT 2 receptor gene promoter contains multiple transcription initiation sites. Its basal promoter activity is inhibited in glial cells and fibroblasts by an upstream repressor domain, and expression is reactivated in a glial cell line, which normally expresses the receptor, by a far upstream cell type-specific activating domain. MATERIALS AND METHODS Cell lines Rat C6 glioma, rat C R E F fibroblast and h u m a n HeLa cells were grown in Dulbecco modified M E M supplemented with 15% horse plus 2.5% fetal calf serum. L~olation of a 5 - H ~ receptor genomic clone Molecular cloning was carried out using standard procedures 2¢'. To obtain a probe for genomic library screening, the rat 5-HT 2 receptor coding region was cloned following P C R amplification of reverse transcribed R N A by the procedure of Kawasaki et al. 22. First, c D N A was synthesized using total rat forebrain R N A and a primer ( 5 ' - C A T C G T A A C A C T C C T A G C T C - 3 ' ) corresponding to the nucleotides between 2151 and 2170 in the 3' noncoding region of the rat 5-HT 2 receptor c D N A (sequence numbers according to Pritchett et al.35). Then the PCR reaction was initiated by adding another primer ( 5 ' - T C T G C C T G A G A C T A A G A A G G - 3 ' ) corresponding to the nucleotides between 81 and 100 on the 5' nontranslated portion of the rat cDNA. The amplified fragment (2090 bp) was purified by gel electrophoresis, and cloned into the HinclI site of pGEM-3. Sequence analysis confirmed that the cloned fragment corresponded to the rat 5-HT 2 receptor cDNA. A Kpnl fragment from the 5' end of the cloned c D N A (from nucleotide 778 to 1015) was 32p-labeled and used as a hybridization probe to screen a mouse genomic library (gift of M. Roberts, Princeton University) made from B a l b / c D N A partially digested with Mbol and cloned into a A vector (EMBL3). The D N A corresponding to a positively hybridizing recombinant phage was characterized by restriction enzyme digestion and D N A blotting. A 6.9 kb HindIII fragment was identified which hybridized to the rat probe, and therefore contained the 5' portion of the rat 5-HT 2 receptor gene. The fragment was mapped by restriction endonucleases (see Fig. 1), and both strands of the portion of the fragment located upstream of the c D N A 5' end were sequenced (EMBL accession n u m b e r X72222) by the dideoxynucleotide chain termination method 38. Plasmids The 6.9 kb HindlII fragment identified in the D N A of the 5-HT 2 receptor-specific recombinant phage was inserted into pGEM3. The 5 kb HindIII-HpaI subfragment of the 6.9 kb HindIII fragment (see Fig. 1) was converted to a HindIII-HindIII fragment with a linker, and cloned into the HindIII site of pSKII (Stratagene), immediately

upstream of the bacterial C A T gene coding region, generating p5HT2R-5.6CAT. The flanking region of the 5-HT 2 receptor gene was shortened by excising D N A fragments and religating the remaining portion of the plasmid. Deletions between the HindlIl site at the upstream end of the control sequences and NdeI, XhoI or NsiI cleavage sites generated p5-HT2R-4.2CAT, p5-HT2R-2.7CAT and p5-HT2 R-1.5CAT, respectively. Two fragments from the 5' flanking region of the 5-HT 2 receptor gene was also fused to a minimal SV40 promoter-CAT construct (pCAT-promoter plasmid, Stratagene), generating 5-HT2R-5.6/4.2SVCAT and 5-HT2R-5.6/-2.7SVCAT. Two plasmids were produced for production of probes for ribonuclease protection assays. The C A T gene was excised from a plasmid similar to p5-HT2R-2.7CAT with HindllI and BamHI, placing the 5' flanking region of the receptor gene in close proximity (73 bp) to the T3 promoter of pSKII. The resulting plasmid (pRSR) was used to generate probe 1 and 2. A n o t h e r plasmid, pRSR2, was generated by excision of the C A T gene together with a small portion of the 5' flanking region with SphI and BamHl. This p R S R 2 was used to generate probe 3.

RNA isolation and transcription mapping R N A isolation from mouse forebrain employed the guanidium thiocyanate-CsCl procedure s. Probes for RNase protection assay were generated by in vitro transcription of appropriately linearized templates with T3 R N A polymerase in the presence of [32p]CTP (800 C i / m m o l ) . Probes 1 and 2 were synthesized with p R S R linearized by SphI and NciI, respectively. BssHII linearized pRSR2 was used to generate probe 3. Probes were purified by polyacrylamide gel electrophoresis. For RNase protection assays, the annealing temperature was 45°C, and digestion was carried out with a final concentrations of 2.5 U / m l RNase 1 and 100 U / m l R N a s e T l for 45 min at 30°C. Protected fragments were separated by electrophoresis in 6% polyacrilamide gels containing 7 M urea. Cloning of cDNAs including the 5' end of 5-HT2 receptor mRNAs Cloned c D N A s that include the 5' ends of different serotonin 5-HT 2 receptor m R N A s were prepared by the R A C E method u with some modifications. Total mouse forebrain R N A was prepared by the guanidinium isothiocyanate-cesium chloride method, and then further purified to remove contaminating genomic D N A by D N A s e I digestion followed by phenol extraction and ethanol precipitation. Two tzg of R N A was reverse transcribed with 200 units of Superscript reverse transcriptase (Bethesda Research Laboratories) according to the manufacturers recomendations. Oligonucleotide SR35 ( 5 ' - A C G C A A T G T T A A T G C C A T C A - 3 ' ) was used to prime the reverse transcription reaction. The reverse transcription reaction was terminated by adding E D T A to 20 m M and incubating the reaction at 100°C for 10 rain. T h e R N A was then degraded by adding R N A s e A to a final concentration of 100 ~,g per ml and incubating the reaction for 15 min at 37°C. The single-stranded c D N A was purified further by phenol extraction and ethanol precipaitation. A deoxyadenosine tail was added to the 3' end of the c D N A using terminal transferase 26. The tailed c D N A was precipitated with ethanol prior to its use as a template for P C R amplification. P C R was performed using conditions described previously 33. During the first PCR cycle (95°C, 1 min; 72°C, 3 rain; 45°C, 5 min; 72°C, 20 rain) only the adaptor primer (SR20: 5 ' - G C T C T G G A T C C A A G T C T A GA[T]18_3') was present and it was added to the reaction during the first 72°C incubation period. Near the end of the second 72°C incubation, primer SR35 and an adaptor primer lacking the poly T sequence (SRI2: 5 ' - G C T C T G G A T C C A A G T C T A G A - 3 ' ) was added and an additional 30 rounds of applification were performed (95°C, 1 rain; 58°C, 2 rain; 72°C, 3 min). Five % of this material was subjected to additional amplification with adapter primer SR12 and a second nested gene-specific primer (SRI0: 5 ' - C C C T T C T T A G T C T C A G G C A G - 3 ' ; Fig. 3). Ten % of this material was analyzed by agarose gel electophoresis and hybridization with a third gene-specific primer (SR34: 5 ' - T T T C A G C T I ' G T A T C ' T C r G G G - 3 ' ) to identify and note the apparent sizes of specific amplified c D N A s in the heterogenous

183 .Q

PCR product 33. Subsequently, 10% of the PCR product was electrophoresed on a low-melt agarose gel and slices were excised that corresponded to the size of bands identified by hybridization. Five/zl of melted gel slice was then amplified with primers SR10 and SR12. This PCR product was cloned into pGEM-3. SP6 and T7 primers were employed to sequence the inserted fragments.

Membrane preparation and drug binding assay Total cell membranes were collected by centrifugation (17,000 × g, 20 min.) in 10 mM Tris-HCl, pH 7.4 (25°C)/5 mM MgCI 2 as described 42. Binding assays were performed as described 19 in 50 mM Tris-HCl, pH 7.4 (25°C) using 30/zg membrane protein per 0.1 ml volume and 1 nM [1251]LSD. Non-specific binding was defined with 1 ~tM mianserin. Protein concentration was determined using the BCA reagent (Pierce) with bovine serum albumin as standard.

O1 rd 1

-Hlndlll

<

i:

°:i

elO I-<

O

|,

,p,, _-I Ncll

_

-,-I

tD °

o~

BssHII-

Transient expression assays Transfections were performed by the calcium phosphate-DNA coprecipitation method 13. Ten /zg of plasmid DNA per cell monolayer in a 60 mm Petri dish was used for each transfection. After overnight incubation with the DNA precipitate, cells were washed and fresh medium was added. After incubation for a total of 2 days, cells were collected and CAT activity was determined according to the procedure of Gorman et alJ 2 with minor modifications. The final concentration of Coenzyme A was 8 mM in the enzymatic reaction and the incubation was continued for 3-4 h at 37°C. Protein concentration was determined 4 using bovine serum albumine as a standard. Typically 100-200 /zg of cell protein was used for each CAT assay, and reaction products were separated on TLC silica plates (Baker). Bands corresponding to acetylated and nonacetylated [14C]chloramphenicol were scraped from the plates and radioactivity was quantified in a scintillation counter.

-Nsll

"7,

co

- Xhol

r,,.

- Pstl

- Boll

-Ndel

RESULTS

-xbal - Accl

Isolation of the 5' flanking region of the mouse 5-HT2 receptor gene. To identify regulatory sequences controlling expression of the 5-HT 2 receptor gene we isolated the 5' flanking region of the gene. The region was cloned by screening a mouse genomic h phage library with a probe consisting of the rat 5-HT 2 receptor cDNA. The inserted mouse D N A present in a positive recombinant phage was analyzed by restriction enzyme mapping and hybridization. This analysis identified a 6.9 kb HindlII fragment which hybridized to the 5' portion of the rat cDNA. The fragment was subcloned, and sequence analysis revealed that a sequence homologous to the 5' portion of the rat cDNA was located close to one end of the 6.9 kb HindlII fragment (Fig. 1). The homology between rat cDNA and mouse genomic sequence was particularly high in the coding region. At the 3' end of the cloned 6.9 kb HindlII fragment, adjacent to the region which showed homology to the rat cDNA, was a nonhomologous sequence of 896 bp (Fig. 1). The presence of consensus donor and acceptor splice sites at the junction of the coding and unknown sequence (412 bp downstream from the beginning of the coding region) indicated the presence of an exon-intron junction. The location of the junction in the mouse sequence corresponded exactly to the junction between

-Accl

O

-a..a-

Fig. 1. Structure of the 5' flanking region of the mouse 5HT 2 receptor gene. The upper portion of the figure represents a cloned HindlII fragment: solid and striped portions of the bar represent the coding sequence following the ATG and a portion of an intron, respectively; the open portion of the bar represents the 5' flanking region of the gene. Arrows above the bar designate the location of RNA probes (1-3) used for mapping the transcription initiation sites by ribonuclease protection assay. The broken line above the bar represents the mouse sequence homologous to nucleotides 1 to 1015 of the rat cDNA. The bottom portion of the figure shows the structure of p5-HT2-5.6CAT, which was assembled from the 5' flanking region, the coding region of the bacterial CAT gene, and the poly A plus splice sites of SV40 large T antigen.

the first exon and intron in the human 5-HT 2 receptor gene 6. The coding region plus the downstream intron sequence occupy 1.3 kb at the end of the 6.9 kb HindlII fragment. Assuming that no introns are present upstream of the 5' end of the cloned cDNA sequence, the remaining 5.6 kb of the 6.9 kb HindlII fragment corresponds to the 5' flanking region of the 5-HT 2 receptor gene. Both strands of the 5.6 kb segment were sequenced. Portion of the sequence is dis-

184 ATTTTCTAACATGAAGTTTTTCATTATTT

CTT GGCGACAGGTTTGAGATG- 1 5 4 0

$HT2R-I.SCAT AAGAAAAGTAAGCTAGTTACAGGAT(~(~ATACACATAGCAATAGTGTGT GT- 1 4 9 e GCTTAAAT GCATTTAA GTAACTAAAAATTGTT CTGATAGTTTATCAGTTA- 1 4 4 0 TTG CCACAGACTTCCTGATTCCTCTGAACTCATGTCGCCACGGTCAGCCA-1390 TCCCTCCTGGACACATCATCACTGGCTTGGATAGAAGTGCTGGATGCTCC-134e CAGATCC CAGGACATGCCGTTTTCTAGCCTTATTTATCTT CTCATTCTTC-1290 ACC CCTCAGCCTAAAAATATGACTGCCATGTACC CCTCCTGCCTGCTGTC-1240 CCCTAAGCTGTCTC CTTGTTCTCT CTTTTTTTAAGGAAAGGTTC CTAATT- 1 1 9 0

. &P"~

_ 9oi

AAC CTGTAGCAGAAAGAATGGGGGC~CGCJ~GGGG,~GGGGG~'TGTTTGG'I~-1 1 4 0

CGC$C[CF'TCC'[]GGCTGT TG CCACCT TGCAGGTTAT GACA? GTGACAGAGG- 1 ' 9 0 GAGGTCTGAGGAAGGAGGCAACCAGGAGGG G C T T A A T T C T T T T ~ G A ~ - 1 ' 4 '

?

"~

.

GA GCCTCTTGA GTAC~GA~qU~C A GCGTT T C~T~CTTTCCT G C ~ ' 9 9 1 1

Io

~

A

II

TTGTGTGACTTTGAGAGGgGCTCCCTAGTGA'C'rGATTCCTCTCTGTGCGC - 9 4 0 TCGCCTCAGCAAGCAGCCAGGCTCTGGGAGGGAAGACCCAACCAAGCTCA - 8 9 e GCAGTAGCAGAAGCAGCCAGCACAGACTTCAACCGTGCTGGAACCGGCAT - 8 4 e GCGTTTTTGAAGTCAGCAGAAACAGAAATCAAATTACTATCATCTTATGC - 7 9 g TGCTAGAAGCTCAAAGAGAGGGGATTCCACACTGGCCTAGTCACCATGCG - 7 4 e ACAGGCAAGTCACAGGATAGCGGACCCTGGCGACAATGAATGTAAGTTCC - 6 9 e TCGGCTGCTGTCCTTTACTGCTGTGGGATTTTCTTTCTGCTTAAAGTCAC - 6411 GCTTGGCTAGAATGCCGTCATTGCCGCGAGAATTTCTGATGTGGAAAGTT - 5 9 0 I-,D, mt eDNA ~ CAT CTCTCTGGCGCTTCGGGATGCGTTTTCCTTTCGTTAACTGAGCCAGAGAT - 5 4 0 ACAAGCTGAAATTCCTGACCATCGCTGCGGGATTCTGCCTGAGACTAAAA - 4 9 e A GGGTTAACCCTTAT GATGGCATTIACATT GCGT GGATTTTTAATT GACT - 4 4 B $R U PCR primer TCCTTAATTAATATAGAGGGCACACAGCCCTCCCTCCTCGTTTTGGATCT

-

39e

CATGCTGTTTTAACTTTGTGATGGCTGAACTCTTGAAAGCAGCATATCCA - 3 4 e ACCCGAGAATTGGCTGAAAGATTCTCACCGGATACAAAACTTTTCTTCCT - 2 9 6 TAACCAGGAACACGTTTGTGTCTCCAAATGCTCCACACTGCTTTTTTTGC - 24@ CTTTGCTTCCGTGAGAACTTACCTGCCGCCGTGACTCTCCCTAGCACTGT - 1 9 ¢ GAAGCGAGGCATAATCAAGAGCCATCACACTTCTGTAACTCTTACTATGG - 14Q AAGAGGAGAAAGCAGCCAGAGGAGCCACACAGGTCTCCGCTTCAGCATGC - 9Q CCTAGCTCCAGGACGTAAAGATGAATGGTGACCCCGGCTATGACTCGCTA - 4 e +1 GTCTCTCCACACTTCATCTGCTACAACTTCCGGCTTAGACATGGAAATTC + l e

METGLU ILE

Fig. 2. Sequence of the region within the 5' flanking domain of the 5-HT 2 receptor gene containing m R N A 5' ends. 5' Ends are represented by lines above the sequence covering seven residues to account for the uncertainty in the precise position of start points determined in the ribonuclease protection assay. Open arrowheads represent the 5' ends of c D N A clones amplified from total forebrain R N A by the R A C E procedure. The homology between the mouse genomic D N A and the rat c D N A is indicated, as is the position used to construct C A T plasmids. Nucleotide numbering is relative to the first residue of the A T G translational initiation codon which is set to + 1.

played in Fig. 2; and the entire sequence has been deposited in the GenBank database. 5 - H T 2 receptor gene transcription initiation sites

Three different probe RNAs (Fig. 1) were employed to localize the 5' ends of 5-HT 2 mRNAs within mouse forebrain RNA. In a ribonuclease protection assay, all

of the 5-HT 2 DNA sequence in probe 1 was protected, indicating that it was located downstream of the major start sites (data not shown). Probe 2, which extended further upstream, produced several shortened bands, but the majority of the RNAs were still initiated upstream of the probe (data not shown). Probe 3 extended the furthest upstream, and it generated at least 11 protected fragments (Fig. 3). The lengths of protected fragments were determined relative to markers, and the ends they represent were localized within the 5' flanking sequence (bars above the sequence localize the domain within which each end is located, Fig. 2). One minor band (designated RT in Fig. 3) corresponded in length to a fragment in which the entire 5-HT 2 sequence was protected, indicating that a small portion of mRNAs (less than 5%) contains sequences upstream of the 5' end of the probe 3 RNA. As a complementary method to identify transcription initiation sites in the 5' flanking region of the 5-HT 2 receptor gene, primer extension followed by PCR amplification ( R A C E 1]) was carried out. Oligonucleotide SR35 (Fig. 2) was used to prime the reverse transcription reaction, cDNAs were amplified, PCR products were cloned and sequenced. Fig. 3 shows that the position of the 5' ends of cDNAs obtained by RACE (mc6, mc25, mc4, mcl2, mc2 and mc3) corresponded to the more frequently used transcription initiation regions (bands 1, 4, 6 and 7) mapped by ribonuclease protection assay. Sequence data in Fig. 2 shows that the 5' ends of all but one of the cDNA clones mapped exactly into the transcription initiation regions determined by ribonuclease protection assay. The 5' end of clone mc25 was 2 bp outside of region 4. Several shorter PCR products were also sequenced that contained 5' ends downstream of the discontinuities localized by the ribonuclease protection assay. These ends could have been generated by premature termination during the reverse transcription step of the RACE procedure or they might represent low abundance 5-HT 2 mRNAs. The ribonuclease protection and RACE analyses argue that mouse forebrain RNA contains 5-HT 2 mRNAs initiated at a variety of positions. The predominant species contain 5' ends within a region located between - 1 0 0 0 and - 1 1 1 0 relative to the translational start site (Figs. 2 and 3). This mapping indicates that the major 5-HT 2 mRNA start sites are well upstream of the 5' end present in the original rat cDNA 35 (located at position - 6 1 7 , Fig. 2). The 5' end of the rat cDNA might, however, correspond to a minor start site, and it remains possible that the initiation sites used in the rat differ from the 5' ends we have mapped for the mouse.

185 C6 glioma cells express 5-HT 2 receptor specific m R N A and receptor In order to assay transcriptional regulatory functions within the 5' flanking region, it was first necessary to identify a cell line that expresses the 5-HT 2 receptor. Such a cell line would presumably contain all of the factors needed for normal expression of the 5-HT 2

--

Drugs were assayed for their ability to compete with 125I-LSD for binding to membranes prepared from C6 glioma cells. IC50 values required to displace 50% of the labeled LSD were determined experimentally and converted to K i values according to the equation K i = IC50(1 + C/Kd), where C is the concentration and K d is the IC50 of the radioligand 7. The values presented are the mean of three independent determinations, with each determination performed in triplicate.

- -

Probe

- -

RT

1

-1100

<::)

mc6

246

6 --~b.-

- ~

7 8

mc4, mc12 mc2 mc3

-1000

9 10

mc25

-1050

5

IC5o (nM) 2.5 + 0.2 6.3 + 0.5 8.0 _+0.7

Ki (nM) 1.2+ 0.1 3.0+ 0.3 3.8+ 0.4

RACE

492

123

Pharmacological profile of the 5-HT receptor in C6 glioma cells

Drug Mianserin Ketanserin Spiperone

z

RNase protection

369

TABLE I

--~

- 950

Fig. 3. Identification of 5-HT z receptor mRNA 5' ends by ribonuclease protection assay (RNase protection) and primer extension followed by PCR amplification (RACE). Total mouse forebrain RNA was hybridized with probe 3 (see Fig. 1 for location). RT designates readthrough transcripts. Arrows (1-11) show the positions of transcription initiation sites obtained by ribonuclease protection assay. The lenght of arrows indicates the intensity of corresponding bands. Arrows with open arrowheads show the positions of the 5' ends of cloned cDNAs (mc). Nucleotide numbering is relative to the first residue of the ATG translational initiation codon which is set to + 1.

receptor gene. Ananth et al. reported that rat C6 glioma cells contain 5-HTz-like receptor activity which mediates enhanced phosphoinositide hydrolysis by 5HT 1. Two experiments were performed to confirm that C6 glioma cells express the 5-HT 2 receptor. The first experiment assayed for the presence of receptor binding activity. C6 glioma cell membranes bound the 5-HT agonist, [125I]LSD ( B m a ~ = 3 8 + 4 f m o l / m g membrane protein); while rat C R E F fibroblasts displayed negligible binding (Bmax = 0.5-F0.1 f m o l / m g membrane protein). Competition binding experiments indicated that nanomolar concentrations of mianserin, spiperone and ketanserin competed with [125I]LSD for binding to C6 glioma membranes (Table I), as has been reported previously for rat cortical membranes 19 which are known to be rich in 5-HT 2 receptors 29. Thus, the pharmacological profile of the receptor in C6 glioma cells is consistent with the presence of 5-HT z receptor. The second experiment was a ribonuclease protection analysis that assayed for specific mRNA. C6 glioma cells, but not C R E F fibroblasts, contained RNA that hybridized to the 5-HT 2 receptor specific probe (Fig. 4). We conclude that C6 glioma cells contain both 5-HT 2 receptor m R N A and receptor binding activity. Sequences close to the transcription initiation sites confer constitutive promoter activity The 5-HT 2 receptor promoter contains neither TATAA nor CAAT sequence elements upstream of the transcription initiation sites. Promoters without a TATAA motif often contain multiple GC boxes 3, interacting with a variety of transcription factors, including SP-12s, LSF 23, ETF 2t, GCF-12° and AP-2 3°. Although the arrangement of GC boxes in non-TATAA gene promoters is quite variable, they are usually found a short distance upstream of the initiation sites. Therefore we scanned the 5' flanking sequence for transcription factor binding sites upstream of the transcription

186 initiation sites. Three GC boxes (one consensus SP-I site, one possible SP-1 site and an AP-2 site) and a PEA3 site were identified close to the transcription initiation site located the furthest upstream of the A U G (Fig. 2, site 1). Although we did not test whether SP-1 and AP-2 bound to these sites, the sequence homologies suggested that the GC boxes and the transcription initiation sites form the basal promoter of the 5-HT 2 receptor gene. Functional assays were performed to test this prediction. p5-HT2R-1.5CAT was constructed, which contained approximately 1 kb from the 5' flanking region of the receptor gene (nucleotide positions from - 5 5 5 to - 1512) positioned upstream of the bacterial chloramphenicol acetyltransferase (CAT) coding region followed by an intron plus polyadenylation site derived from the SV40 genome (Fig. 1). C6 glioma cells, which express the endogenous 5-HT 2 receptor, and CREF cells, in which the endogenous gene is silent, were employed in transient transfection experiments (Fig. 5). In order to compare transfection efficiency in the different cell lines a TK-CAT construct (pBLCAT225) was also included in the assays, and resulted in a high level of acetylation of chloramphenicol in both C6 and C R E F cells, while a promoterless CAT gene showed no detectable activity (Fig 5A). p5-HT2R-1.5CAT showed low but reproducible activity ( 3 - 5 % ) in both cells (Fig. 5A, representative experiment; Fig. 5B, average of four independent experiments). No difference in the level of CAT activity in the different cell lines was observed if normalized to the TK-CAT activity. This experiment indicates that the 5-HT 2 receptor 5' flanking sequences between - 5 5 5 and - 1 5 1 2 (relative to the translational start site), which include a series of mRNA 5' ends plus GC motifs, contain a weak promoter that functions equally well in ceils that express or fail to express their endogenous 5-HT 2 receptor gene.

Glial cell specificity is achieL'ed by selectiue reactication of the repressed 5-HT 2 receptor gene promoter To search for additional elements that might determine cell-type specificity of expression, we generated a series of CAT constructs, which contained increasing amounts of upstream sequence from the 5' flanking domain of the 5-HT 2 receptor gene (Fig. 5). p5-HT2R2.7CAT contained approximately 1200 bp more upstream sequence than the previously analyzed p5HT2R-1.5CAT construct, and exhibited an enhanced level of CAT activity in both C6 glioma cells and C R E F fibroblasts (Fig. 5A,B). However, when the control region was extended by another 1500 bp of upstream sequence, producing p5-HT2R-4.2CAT, a sub-

IJ. w

~i~ ,ilii !!ii ~ii!i!!!iiliili ¸¸

369

246

Rat 5HT 2 R

123

2.2 kb Rat 5HT2 cDNA

I

~1- SP6

I Ncol

I ~ probe Protected fragment

Fig. 4. Ribonuclease protection experiment demonstrating that C6 glioma cells express 5-HT 2 receptor specific RNA. Total C6 glioma or C R E F cell R N A was hybridized with a probe corresponding to a portion of the 5-HT 2 receptor coding region, as diagrammed at the bottom of the figure.

stantial inhibition of CAT expression was observed in both cell lines. The activity of p5-HT2R-4.2CAT was even lower than the weak activity of the p5-HT2R1.5CAT construct. This result indicates that a repressor element, which inhibits 5-HT 2 receptor expression in both C6 glioma cells and C R E F fibroblasts, is located between - 4 . 2 and - 2 . 7 kb in the 5' flanking region. Interestingly, glial cell-specific expression of the CAT gene was achieved by addition of the most upstream 1.4 kb fragment of the cloned 5' flanking re-

187 gion. p5-HT2R-5.6CAT is expressed much more efficiently in C6 cells than in CREF cells (Fig. 5A,B). p5-HT2R-5.6CAT exhibited the same activity as p5HT2R-4.2CAT in CREF cells, demonstrating that the element between - 5 . 6 and 4.2 kb did not influence expression in fibroblasts. However, the same 1.4 kb fragment reactivated the repressed promoter in C6 glioma ceils. p5-HT2R-2.7CAT, p5-HT2R-4.2CAT and p5-HT2R5.6CAT, representing the basal, silenced and reactivated promoter in C6 cells were also tested in HeLa epithelial cells (Fig. 5B), which served as another control cell line. Expression in HeLa cells was similar to that observed for CREF fibroblasts, confirming our conclusion that the repressor element between - 4 . 2 and -2.7 kb is not cell type specific, while the activating element between -5.6 and -4.2 functioned only in a cell type normally expressing 5-HT 2 receptor mRNA. The glial ceil-specific domain was subdivided, generating two new CAT constructs, p5-HT2R-5.1 CAT contained the start site proximal portion of the domain

( - 5 . 1 to -4.2 kb upstream of the translational start site) located in its normal position upstream of the repression domain plus basal promoter. It displayed low basal activity in both C6 glioma and CREF ceils, similar to that displayed by p5-HT2R-4.2CAT which contains only the basal promoter and repressor domains (Fig. 6, constructs c and e). This suggests that the sequence between -5.1 and -4.2 kb does not, on its own, confer glial cell specificity, p5-HT2R-5.6(A 5 . 0 / - 4.2)CAT was derived from p5-HT2R-5.6CAT by deletion of the sequence between - 5 . 0 and -4.2 kb. This construct displayed glial cell specificity (Fig. 6, construct d), indicating that the sequence contained one or more positive acting, glial cell-specific elements. This construct, however, was not as active in glial cells as was p5-HT2-5.6CAT (Fig. 6, compare constructs a and d). Even though the region between -5.1 and - 4 . 2 kb exhibited no detectable glial cell specificity when assayed in the absence of the upstream domain extending to -5.6 kb, it was clearly able to specifically enhance glial cell activity in the presence of the upstream domain. It appears, then, that sequence ele-

A

C6

CREF - 5.6

C6 CREF C6 CREF C6 CREF - 4.2

- 2.7

C6

CREF C6

TK-CAT

B

CREF

-1.5 0-CAT

5HT2RCAT constructs

C6 o~

CREF

HeLa

35

30 ~) 0

o

25 2O

5

o 5.6

- 4.2

- 2.7

-1.5

5HT2RCAT constructs

- 5.6

- 4.2

- 2.7

-1.5

5HT2RCAT constructs

-5.6 -4.2 -2.7

5H~RCAT constructs

Fig. 5. Analysis of transcriptional regulatory regions within the 5' flanking region of the 5-HT 2 receptor gene by CAT assay. A: representative CAT assay experiment in C6 glioma and CREF cells. B: summary of four independent experiments in C6 glioma, CREF and HeLa cells. CAT activity represent the % conversion of [14C]chloramphenicol.

188 -5.6 I

-5.1 - 5.0 II

-4.2 I //

-2.7 I

CAT a c t i v i t y %

-0.6 I

I

10 I

20 I

I

30 i

I

40 i

I

50 i

|

60 I

I

70 ,

I

80 i

I

90 I

I

CREF

5HT2R-S.6CAT C6 b

I

I

~

CREF

5HT2R.5.6( A-4.2/-2.7)CAT

I

CREF

5HT2R-S.ICAT

I

I

5HT2R-5.6( z~-5.0/..4.2)CAT C6 CREF

5HT:~-4.2CAT SV40

i

I

IIII

....

CREF

I

5HT2R-S.6h4.2SVCAT C6 IIII CREF

I

5HT2R-5.6/-2.7SVCAT

,,,, SVCAT

Fig. 6. Analysis of the glial cell specificity domain by CAT assay. The basal promoter is represented by a black bar, the repressor domain is represented by a stippled bar, the glial cell specificity domain is represented by an open bar, and the SV40 basal promoter is drawn as a series of closely spaced lines in diagrams of control regions. Solid bars represent C6 glioma cells and open bars designate CREF cells in the bar graphs presenting the results of at least four independent CAT assays (except construct f which was analyzed in duplicate transfections in a single experiment).

ments in two different portions of the - 5.6 to - 4.2 kb domain cooperate to induce optimal glial cell-specific expression. It is unlikely that a single element at the junction of the two domains is the critical sequence since the domains were prepared so that they overlap between the - 5 . 1 and - 5 . 0 positions (Fig. 6, constructs c and d). The sequence of the domain that endows glial cell specificity on transcription of the 5-HT2R gene contains consensus binding sites for NFE1 and AP-1, but it does not have a motif corresponding to the glial cell activating protein (GF123) binding site (data not shown). The upstream domain was also tested for its ability to confer glial cell-specific expression on the basal promoter in the absence of the repressor domain. C A T expression directed by p5-HT2-5.6(A - 4 . 2 / - 2.7)CAT (lacks the repression domain) was only slightly reduced in C6 glioma as compared to CREF cells (Fig. 6, construct b), demonstrating a requirement for the re-

pression domain. Finally, the SV40 promoter (Spl binding sites, T A T A motif and start site) was substituted for the 5-HT 2 receptor's basal promoter. The SV40 basal promoter directed the expression of low levels of CAT activity in C6 glioma and C R E F cells (Fig. 6, construct h). The upstream, glial cell specific domain alone or together with the repression domain substantially increased the activity of the SV40 pro-

Gllal

emenl

Gllal ~ 1 element2

r

Glial-spectli¢ aclivity

Basal Promoter

J

Fig. 7. A repressed basal promoter is reactivated to achieve C6 glioma cell-specific expression.

189 moter, but the 5-HT 2 receptor elements were not able to direct glial cell specific expression of the SV40 promoter (Fig. 6, constructs f and g). The failure of the upstream domains to regulate expression in concert with the SV40 promoter was not due to a difference in promoter strength that might overwhelm the upstream regulatory functions. The SV40 promoter was somewhat less active than the basal promoter of the 5-HT 2 repressor gene in C6 glioma and CREF cells (compare 5-HT2-1.5 in Fig. 5 to SVCAT in Fig. 6). We conclude that the C6 glioma cell-specific activation domain contains multiple elements that cooperate, and it requires the presence of the repressor domain as well as the basal promoter to achieve cell type specificity. DISCUSSION Our analysis of the 5-HT 2 receptor 5' flanking region provides insight to the mechanism by which tissue-specific expression of the gene is achieved (Fig. 7). The gene contains a basal promoter (between -555 and -1512 relative to the translational start site) that is active in all cell types tested. It includes a series of start sites as well as putative Spl motifs. The low activity of the promoter is enhanced in the three cell types tested by the sequence (between -1512 and -2746) immediately upstream of the basal domain. Computer analysis revealed consensus binding sites for several ubiquitous transcription factors in this region, including PEA3 and AP2. A domain located further upstream (between -2747 and -4256) repressed the promoter. CAT constructs containing the entire region or parts of the region located between -555 and -4257 are expressed at similar levels in C6 glioma, CREF and HeLa cells (Fig. 5B). Glial cell specificity is conferred by a domain located even further upstream (between -4257 and -5639). CAT constructs containing this element are expressed efficiently in C6 glioma cells, but not in CREF or HeLa ceils (Fig. 5B). This domain contains at least two elements that cooperate, and the repression domain as well as the basal promoter domain are required to achieve maximal cell type-specific expression (Fig. 6). Specific expression of the 5-HT 2 receptor gene in C6 glioma cells is achieved by first repressing a basal promoter, and then reactivating it in the appropriate cell type (Fig. 7). It is intreguing that the glial cell-specific activator domain is not able to generate significant cell-type specificity in constructs lacking the repressor domain or in constructs carrying a heterologous basal promoter (Fig. 6). Apparently, factors binding within each of these domains do not function independently. It is

conceivable that the factors bound within the three domains interact with each other, either directly or through adaptor proteins that bridge between them. As yet, C6 glioma cells are the only established cell line known to express the 5-HT 2 receptor, so it has not been possible to test whether the regulatory system we have described using glial cells as a model, i.e. universal repression followed by selective reactivation, will hold true in neurons and other cell types where the receptor is expressed. Given the lack of suitable cell lines, experiments are in progress with transgenic animals carrying the 5-HT 2 receptor 5' flanking region controlling expression of a test gene. Why is expression of the 5-HT 2 receptor gene regulated by a complex mechanism involving both activation and repression? Presumably, the combination of repression and reactivation provides the flexibility required to express the gene in a diverse array of cell types that include glial cells, neurons, megakaryocytes, and smooth muscle cells 17. After the basal promoter has been repressed, it has the potential to be reactivated by a variety of different transcriptional activators present in the different cell types. This variety could be in DNA-binding proteins or in adaptor proteins (posited above) that bridge between proteins bound at the activation, repression and basal promoter domains. The assortment of DNA binding and adaptor proteins that functions in glial ceils might be different than that available within, say, smooth muscle cells. It is also conceivable that different domains within the 5-HT 2 receptor gene 5' flanking sequence will direct reactivation of the repressed promoter in various cell types where the gene is expressed. Alternatively, the repressor could fail to function in a subset of the cell types where the gene is actively transcribed, providing further flexibility to the control of 5-HT 2 receptor expression. Repressor domains have been described in several other genes expressed in the central nervous system, including the SCG10 31' 32,43, type II sodium channel 24'27 and choline acetyltransferase gene 16. The repressor domains of these genes preferentially suppress activity of their associated promoter in cells that do not express the gene product. The repression domains are relatively inactive in cells that express the products. This stands in contrast to expression of the 5-HT 2 receptor gene in C6 glioma cells. In this case the repression domain functions not only in cells that do not express the receptor, but also in glial cells that do express it. 5-HT 2 receptor gene expression in C6 glioma cells fits more closely with the paradigm set for a variety of genes expressed outside the central nervous system where a repressor is coupled with a tissue-

190 TABLE II

We thank M. Roberts for a murine genomic library, and for advice in how to screen it. C. Parks was a postdoctoral fellow of the American Cancer Society during the early phase of this work. T.S. is an American Cancer Society Professor and an Investigator of the Howard Hughes Medical Institute.

Acknowledgments.

Sequence motifs at the initiation sites o f the 5-HT 2 receptor gene

Sequences spanning individual initiation sites (1-11, Fig. 2) are divided into two groups based on similarities in their sequence, and consensus sequences are indicated. Arrowheads above the individual initiation sites represent the mapped position of 5' end of mRNAs.

REFERENCES

V

1 GACACAG GACAGAG GTCTGAG 5 V~ 2

6

7 8

CAGACAG

9

GTTTCCT ACTTTCC GCTCTTT

1o 11

ATTCITI"rG GCTCC~G

---l~ ~I-~

ACITrGA ATTCCTC

GA~ "A~;AG RYYYYYY Consensus

s p e c i f i c e n h a n c e r (e.g. l y s o s y m e 2, a l b u m i n t4, fl-globin 9,1°, v i t e l l o g e n i n 4 ° ) . The 5-HT 2 receptor gene promoter contains multiple t r a n s c r i p t i o n i n i t i a t i o n sites (Figs. 2 a n d 3), as has b e e n f o u n d for m a n y c e l l u l a r g e n e s , i n c l u d i n g g e n e s e x p r e s s e d in t h e c e n t r a l n e r v o u s system, like S C G 1 0 32 a n d N C A M 5. T h e s e q u e n c e s s p a n n i n g t h e 5 - H T 2 rec e p t o r i n i t i a t i o n sites c a n b e g r o u p e d i n t o t w o c a t e g o r i e s b a s e d o n s e q u e n c e h o m o l o g y ; o n e is c o m p r i s e d o f a s y m m e t r i c a l p u r i n e - r i c h s e q u e n c e , a n o t h e r consists o f p y r i m i d i n e r e s i d u e s ( T a b l e II). T h e s e q u e n c e c o n servation among the elements suggests that they might e n c o d e a s p e c i f i c f u n c t i o n . T h e y a r e n o t s i m i l a r to t h e initiator sequences of the terminal transferase, adeno v i r u s m a j o r l a t e a n d a d e n o - a s s o c i a t e d virus P5 p r o m o t e r s 36'39"41. H o w e v e r , t h e 5 - H T 2 r e c e p t o r c o n t r o l r e g i o n does not contain a TATAA

motif, and initiator ele-

m e n t s c a n f u n c t i o n to d i r e c t t r a n s c r i p t i o n a l i n i t i a t i o n in t h e

absence

o f this c o m m o n

promoter

element.

F u r t h e r , S p l b i n d i n g sites h a v e b e e n s h o w n to e n h a n c e t h e activity o f k n o w n i n i t i a t o r e l e m e n t s 39'4], a n d t h e 5 - H T 2 p r o m o t e r c o n t a i n s S p l m o t i f s in t h e vicinity o f t h e start sites (Fig. 2). T h u s , t h e o r g a n i z a t i o n o f t h e 5 - H T 2 r e c e p t o r p r o m o t e r is c o n s i s t e n t w i t h t h e n o t i o n t h a t t h e c o n s e r v e d s e q u e n c e s at t h e m u l t i p l e i n i t i a t i o n sites a r e n e w classes o f i n i t i a t o r e l e m e n t s , a n d e x p e r i m e n t s a r e in p r o g r e s s to t e s t this h y p o t h e s i s .

1 Ananth, U.S., Leli, U. and Hauser, G., Stimulation of phosphoinositide hydrolysis by serotonin in C6 glioma cells, J. Neurochern., 48 (1987) 253-261. 2 Baniahmad, A., Muller, M., Steiner, C. and Renkawitz, R., Activity of two different silencer elements of the chicken lysozyme gene can be compensated by enhancer elements, EMBO J., 6 (1987) 2297-2302. 3 Blake, M.C., Jambou, R.C., Swick, A.G., Kahn, J.W. and Azizkhan, J.L., Transcription initiation is controlled by upstream GC-box interactions in a TATAA-less promoter, Mol. Cell. Biol., 10 (1990) 6632-6641. 4 Bradford, M.A., Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem., 72 (1976) 248-254. 5 Chen, A., Reyes, A. and Akeson, R., Transcription initiation sites and structural organization of the extreme 5' region of the rat neural cell adhesion molecule gene, Mol. Cell. Biol., 10 (1990) 3314-3324. 6 Chen, K., Yang, W., Grimsby, J. and Shih, J.C., The human 5-HT 2 receptor is encoded by a multiple intron-exon gene. Mol. Brain Res., 14 (1992) 20-25. 7 Cheng, Y. and Prusoff, W.H., Relationship between the inhibition constant (K i) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzyme reaction, Biochem. Pharmacol., 22 (1973) 3099-3108. 8 Chirgwin, J.J., Przbyla, A.E., MacDonald, R.J. and Rutter, W.J., Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease, Biochemistry, 18 (1979) 5294-5299. 9 Emerson, B.M., Nickol, J.M. and Fong, T.C., Erythroid-specific activation and derepression of the chick /3-globin promoter in vitro, Cell, 57 (1989) 1189-1200. l(I Evans, T., Reitman, M. and Felsenfeld, G., An erythroid-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin gene, Proc. Natl. Acad. Sci. USA, 85 (1988) 5976-5980. 11 Frohman, M.A., RACE: Rapid amplification of cDNA ends. In M.A. lnnis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, 1990, pp. 28-38. 12 Gorman, C.M., Moffat, L.F. and Howard, B.H., Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells, Mol. Cell. Biol., 2 (1982) 1044-1051. 13 Graham, F.L. and van der Eb, A.J., A new technique for the assay of infectivity of human adenovirus 5 DNA, Virology, 52 (1973) 456-467. 14 Herbst, R.S., Friedman, N., Darnell, J.E., Jr. and Babiss, L.E., Positive and negative regulatory elements in the mouse albumin enhancer, Proc. Natl. Acad. Sci. USA, 86 (1989) 1553-1557. 15 Hoyer, D. and Schoeffter, P., 5-HT receptors: subtypes and second messengers, J. Receptor Res., 11 (1991) 197-214. 16 Ibanez. C.F., Ernfors, P. and Persson, H., Developmental and regional expression of choline acetyltransferase mRNA in the rat central nervous system, J. Neurosci. Res., 3 (1991) 1309-1315. 17 Julius, D., Molecular biology of serotonin receptors, Annu. Ret,. Neurosci., 14 (1991) 335-360. 18 Julius, D., Huang, K.N., Livelli, T.J., Axel, R. and Jessel, T.M., The 5-HT2 receptor defines a family of structurally distinct but functionally conserved serotonin receptors, Proc. Natl. Acad. Sci. USA, 87 (1990) 928-932. 19 Kadan, M.J., Krohn, A.-M., Evans, E.J., Waltz, R.L. and Hartig, P.R., Characterization of tZSl-lysergic acid diethylamide binding to serotonin receptors in rat frontal cortex, J. Neurochem., 43 (1984) 601-606.

191 20 Kageyama, R. and Pastan, I., Molecular cloning and characterization of a human DNA binding factor that represses transcription, Cell, 59 (1989) 815-825. 21 Kageyama, R., Merlino, G. and Pastan, I., Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box, J. BioL Chem., 264 (1989) 15508-15514. 22 Kawasaki, E.S., Clark, S.S., Coyne, M.Y., Smith, S.D., Champlin, R., Witte, O.N. and McCormick, F.P., Diagnosis of chronic myeloid and acute lymphocytic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro, Proc. Natl. Acad. Sci. USA, 85 (1988) 5698-5702. 23 Kim, C.H., Heath, C., Bertruch, A. and Hansen, U., Specific stimulation of simian virus 40 late transcription in vitro by a cellular factor binding the simian virus 40 21 base pair repeat promoter element, Proc. Natl. Acad. Sci. USA, 84 (1987) 60256029. 24 Kraner, S.D., Chong, J.A., Tsay, H.-J. and Mandel, G., Silencing the type II sodium channel gene: a model for neural-specific gene regulation, Neuron, 9 (1992) 37-44. 25 Luckow, B. and Schlitz, G., CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements, Nucleic Acid Res., 15 (1987) 5490-5496. 26 Maniatis, T., Frisch, E.F. and Sambrook, J., Molecular cloning: A laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. 27 Maue, R.A., Kraner, S.D., Goodman, R.H. and Mandel, G., Neuron-specific expression of the rat brain type II Na + channels by nerve growth factor, Proc. Natl. Acad. Sci. USA, 85 (1990) 924-928. 28 McKnight, S. and Tjian, R., Transcriptional selectivity of viral genes in mammalian cells, Cell, 46 (1986) 795-805. 29 Mengod, G., Pompeiano, M., Martinez-Mir, M.I. and Palacios, J.M., Localization of the mRNA for the 5-HT 2 receptor by in situ hybridization histochemistry. Correlation with the distribution of receptor sites, Brain Res., 524 (1990) 139-143. 30 Mitchell, P.J., Wang, C. and Tjian, R., Positive and negative regulation of transcription in vitro: enhancer binding protein AP2 is inhibited by SV40 T antigen, Cell, 50 (1987) 847-861. 31 Mori, N., Schoenherr, C., Vandenbergh, D.J. and Anderson, D.J., A common silencer element in the SCG10 and type II Na ÷ channel genes binds a factor present in non-neuronal but not in neuronal cells, Neuron, 9 (1992) 45-54.

32 Mori, N., Stein, R., Sigmund, O. and Anderson, D.J., A cell type-preferred silencer element that controls the neural-specific expression of the SCG10 gene, Neuron, 4 (1990) 583-594. 33 Parks, C.L., Chang, L.-S. and Shenk, T., A polymerase chain reaction mediated by a single primer: cloning of genomic sequences adjacent to a serotonin receptor protein coding region, Nucleic Acids Res., 19 (1992) 7155-7160. 34 Peroutka, S.J., 5-Hydroxytryptamine receptor subtypes: molecular, biochemical and physiological characterization, Trends Neurosci., 11 (1988) 496-500. 35 Pritchett, D.B., Bach, A.W.J., Wozny, M., Taleb, O., Dal Toso, R., Shih, J.C. and Seeburg, P.H., Structure and functional expression of cloned rat serotonin 5-HT-2 receptor, EMBO J., 7 (1988) 4135-4140. 36 Pugh, B.F. and Tjian, R., Transcription from a TATA-Iess promoter requires a multisubunit TFIID complex, Genes Dev., 5 (1991) 1935-1945. 37 Roth, B.L., Hamblin, M.W. and Ciaranello, R.D., Developmental regulation of 5-HT 2 and 5-HTlc mRNA and receptor levels. Dec. Brain Res., 58 (1991) 51-58. 38 Sanger, F.S., Nicklen, S. and Coulson, A.R., DNA sequencing with chain terminating inhibitors, Proc. Natl. Acad. Sci. USA, 74 (1977) 5363-5467. 39 Seto, E., Shi, Y. and Shenk, T., YY1 is an initiator sequencebinding protein that directs and activates transcription in vitro, Nature, 354 (1991) 241-245. 40 Seal, S.N., Davis, D.L. and Burch, J.B.E., Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter, Mol. Cell. Biol., 11 (1991) 2704-2717. 41 Smale, S.T. and Baltimore, D., The "initiator" as a transcription control element, Cell, 57 (1989) 103-113. 42 Teitler, M., Leonhardt, S., Weisberg, E.L. and Hoffmann, B.J., 4-[t25]Iodo-(2,5-dimethoxy)phenylisopropylamine and [3H]ketanserin labeling of 5-hydroxytryptamine 2 (5HT 2) receptors in mammalian cells transfected with a rat 5HT 2 cDNA: evidence for multiple states and not multiple 5HT 2 receptor subtypes, Mol. Pharmacol., 38 (1990) 594-598. 43 Wuenschell, C.W., Mori, N. and Anderson, D.J., Analysis of SCG10 gene expression in transgenic mice reveals that neural specificity is achieved through selective derepression, Neuron, 4 (1990) 595-602.