Glucose transporter-1 gene expression is associated with pancreatic cancer invasiveness and MMP-2 activity

Glucose transporter-1 gene expression is associated with pancreatic cancer invasiveness and MMP-2 activity Hiromichi Ito, MD, Mark Duxbury, MRCS, Michael J. Zinner, MD, Stanley W. Ashley, MD, and Edward E. Whang, MD, Boston, Mass

Background. Overexpression of the facilitative glucose transporter-1 (GLUT-1) has been observed for a wide range of human cancers, with the degree of overexpression generally being inversely correlated with prognosis. We tested the effects of modulating GLUT-1 expression on pancreatic cancer cellular invasiveness. Methods. GLUT-1 expression in MIAPaCa-2, PANC-1, BXPC-3, and CAPAN-2 cells was assayed using Western blotting. Cells were stably transfected with a GLUT-1 expression vector or a GLUT-1 RNA interference vector to alter GLUT-1 expression. Matrix metalloproteinase-2 (MMP-2) activity and expression were assayed using zymography and Western blotting, respectively. In vitro cellular invasiveness was assayed using Matrigel Boyden chambers, and in vivo metastatic potential was assessed using a nude mouse xenograft model. Results. Variable baseline GLUT-1 expression levels were detected among the cell lines. Forced overexpression of GLUT-1 induced increases in MMP-2 expression and activity and in cellular invasiveness. GLUT-1 silencing induced reductions in MMP-2 expression and activity, cellular invasiveness, and metastatic potential in vivo. Conclusion. GLUT-1 promotes pancreatic cellular invasiveness. The therapeutic implications of this finding warrant further study. (Surgery 2004;136:548-56.) From the Department of Surgery, Brigham and Women’s Hospital, Harvard Medical School, Boston, Mass

HIGH CONSTITUTIVE GLUCOSE UPTAKE AND METABOLISM are characteristic features of malignant cells.1 Glucose transporter-1 (GLUT-1) is a member of the GLUT family of facilitative glucose transporters that mediate Na+-independent cellular uptake of glucose. GLUT-1, to a large degree, accounts for the high uptake of glucose by malignant cells. GLUT-1 has been reported to be overexpressed in a wide range of human cancers, including those of the colon and rectum,2 lung,3 thyroid,4 ovary,5 breast,6 prostate,7 stomach,8 and pancreas.9 In general, tumoral GLUT-1 expression levels are inversely correlated with prognosis.2-7 However, the mechanisms by which GLUT-1 might promote cancer progression are unknown.

Presented at the 65th Annual Meeting of the Society of University Surgeons, St. Louis, Missouri, February 11-14, 2004. Reprint requests: Edward E. Whang, MD, Department of Surgery, Brigham and Women’s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02215. 0039-6060/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.surg.2004.05.032

548 SURGERY

In this study, we tested the hypothesis that GLUT-1 expression levels are directly correlated with cellular invasiveness, an important attribute of malignant cells, in 4 human pancreatic cancer cell lines. In addition, because of the critical role believed to be played by matrix metalloproteinases (MMPs) in cancer invasion, we examined the effects of modulating GLUT-1 expression on MMP expression and activity. Our results suggest that GLUT-1 promotes pancreatic cancer cellular invasiveness and may represent a potential therapeutic target for this aggressive malignancy. MATERIAL AND METHODS Material. Culture media and fetal bovine serum (FBS) were obtained from Gibco BRL (Gaithersburg, Md). Anti-MMP2 monoclonal antibody and anti-actin monoclonal antibody were obtained from NeoMarkers Inc (Fremont, Calif); antiGLUT-1 antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, Calif). The BCA assay kit and the DAB liquid substrate kit were obtained from Sigma (St. Louis, Mo), and the Vecstain ABC protein detection system kit was obtained from Vector Laboratory (Burlingame, Calif). All other

Surgery Volume 136, Number 3

reagents were purchased from Sigma unless otherwise specified. Cell culture. Human pancreatic cancer cells (PANC-1, MIAPaCa-2, BXPC-3, CAPAN-2) were obtained from the American Type Culture Collection (Rockville, Md). Cells were maintained in Dulbecco modified Eagle medium (for BXPC-3, MIAPaCa-2, Panc-1) or McCoy 5A medium (for CAPAN-2) containing 10% FBS in 75-cm2 culture flasks kept in a humidified (37oC, 5% CO2) chamber. For the experiments described below, cells were trypsinized and harvested when they had reached 80% to 90% confluency. Generation of GLUT-1 cDNA and GLUT-1 expression vector. Total RNA was isolated from MIAPaCa-2 cells using Trizol (Gibco BRL) as described previously.10 Reverse transcriptionpolymerase chain reaction (RT-PCR) was used to generate GLUT-1 cDNA from 800 ng of total RNA using the QIAGEN one-step PCR kit, according to the manufacturer’s instructions (Qiagen, Valencia, Calif). The sequences for the GLUT-1 sense and antisense primers were 5#-TCAGAGTCGCAGTGGGAGTC-3# and 5#-ACTCACACTTGGGAATCAGC3#, respectively. A 1599 bp product was amplified and cloned into the TA cloning site of the pCR3.1 expression vector (Invitrogen, Carlsbad, Calif), which includes a cytomegalovirus promoter and a neomycin resistance gene. The orientation of GLUT-1 cDNA insert was confirmed by sequencing the plasmid using T7 primer. The mock vector used as control for the experiments described below consisted of the pCR3.1 vector without the GLUT-1 cDNA insert. Generation of GlUT-1 RNA interference (RNAi)-inducing vector. To suppress GLUT-1 expression, we generated an expression vector encoding GLUT-1-specific siRNA. Two complementary oligonucleotides encoding a short hairpin RNA targeting the GLUT-1 coding region (5#GATCCCGTTCAATGCTGATGATGAACTTCAAGAGTTCATCATCAGCATTGAATTTTTTGGAAA-3#, and 5#-AGCTTTTCCAAAAAATTCAATGCTGATGATGAACTCTCTTGAAGTTCATCATCAGCATTGAACGG-3#) were custom synthesized by Sigma. These oligonucleotides were annealed and cloned into the p-silencer 3.1-H1 neo plasmid (Ambion, Austin, Tex), which includes an H1 RNA promoter and a neomycin resistance gene. The short hairpin RNA targeting the GLUT-1 coding region encoded by this vector is processed by the cellular machinery into GLUT-1-specific siRNA.11 The control vectors for the experiments described below were (1) empty p-silencer 3.1-H1 neo (mock) and (2) p-silencer 3.1-H1 neo containing a scrambled

Ito et al 549

sequence oligonucleotide bearing no known homology to any gene sequence. Transfection with GLUT-1 expression vector or GLUT-1 RNAi vector. 5 3 105 cells (MIAPaCa-2, PANC-1, CAPAN-2) were plated onto wells of 6-well culture plates and allowed to adhere overnight. Cells were then transfected with GLUT-1 expression vector (1 mg), GLUT-1RNAi vector (1 mg), or corresponding control vectors using lipofectamine (Invitrogen) in 800 mL of culture medium. Twenty-four hours after the transfection, the media was removed and replaced with fresh media containing 500 mmol neomycin. Stable transfectants were isolated by culturing cells in presence of neomycin for 2 weeks. Western blotting. 1 3 106 cells were harvested and rinsed twice with phosphate-buffered saline (PBS). Cell extracts were prepared using lysing buffer (20 mM Tris-HCl [pH 7.5], 0.1% Triton X, 0.5% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride, 2.0 mg/mL aprotinin, and 2.0 mg/mL leupeptin) and centrifugation at 12,000g, 4oC. Total protein concentration was measured by the BCA assay. Cellular extracts containing 50 mg protein were subjected to 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), and the proteins were transferred electrophoretically to polyvinylidene difluoride (PVDF) membranes (Invitrogen). After blocking with PBS containing 0.2% casein for 1 hour at room temperature, membranes were incubated with 1 mg/ mL antibody in PBS containing 0.2% Tween-20 overnight at 4oC. The Vecstain ABC kit and DAB liquid substrate were used for chromogenic detection, according to the manufacturer’s instructions. The membranes were scanned, and the intensity of the bands were determined using Image Pro Plus 4.0 (Media Cybernetics, Silver Spring, Md). Zymography. 1 3 105 cells were plated onto wells of 24-well plates and allowed to adhere overnight in the presence of serum. The next day, media were replaced by 0.5 mL of serum-free medium per well. After 24 hours incubation, the conditioned media were harvested for zymography. Zymography was carried out as previously described.12 In brief, 25 mL of the conditioned medium for each sample was subjected to 10% SDS/PAGE with 1 mg/mL gelatin incorporated into the gel mixture. After electrophoresis, gels were soaked in 2.5% Triton X to remove SDS, rinsed with 10 mM Tris, pH 8.0, and transferred to a bath containing 50 mM Tris, pH 8.0, 5 mM CaCl2 and 2 mM ZnCl2 at 37oC for 17 hours. Then the gels were stained with 0.1% Coomassie blue in 45% methanol, 10% acetic acid. Quantification of MMP activity was performed by scanning gels

550 Ito et al

densitometrically and measuring the area of white bands, using Image Pro Plus 4.0 (Media Cybernetics). Luciferase assay. To assess the functional activity of the MMP-2 promoter, we conducted a luciferase-based promoter assay, as previously described.13 The human MMP-2 promoter was cloned from human placental DNA using PCR with primers specific for the human MMP-2 promoter (sense: 5#-CACACCCACCAGACAAGCCT-3#, anti-sense: 5#-AAGCCCCAGATGCGCAGCCT-3#) as previously described.14 The PCR product (the 1716bp DNA fragment covering positions –1659 to +57 relative to the MMP-2 transcription initiation site) was cloned into the pGL3 vector (Promega, Madison, Wis) containing a firefly luciferase gene (pGL3-MMP2). Correct insert orientation was confirmed by sequencing. The empty pGL3 vector (pGL3e) was used as the control. The cells were plated onto wells of 24-well cell culture plates at a concentration of 1 3 105 cells/ well and cultured for 12 hours in serum-containing medium. One microgram of pGL3-MMP2 or pGL3e was cotransfected with 0.1 mg of pRLCMV vector (Promega), which contains a cytomegalovirus promoter upstream of a renilla luciferase gene. After 24 hours, luciferase activity in lysates of the transfected cells was measured, according to the manufacturer’s recommended protocol (DualLuciferase Reporter Assay System, Promega). The activity of renilla luciferase was used to normalize any variation in transfection efficiencies. The promoter activity of each plasmid construct was calculated as the firefly-renilla luciferase activity ratio. Invasion and migration assays. The BD Biocoat Matrigel invasion chamber (BD Bioscience, Palo Alto, Calif) was used according to the manufacturer’s instructions. In brief, 5 3 104 cells in serumfree media were seeded onto the Matrigel-coated filters, and in the lower wells, 5% FBS was added as the chemoattractant. After 24 hours’ incubation, the filters were stained with the Diff-Quik kit (BD Bioscience), and the number of cells that had penetrated through the filter was counted under magnification (randomly selected high-power fields). The counting was performed for 3 fields in each sample, and the experiment was done 3 times. In additional experiments, anti-MMP-2 antibody (100 mg/mL or 400 mg/mL) was added to neutralize MMP-2 activity, as described previously.15 Cellular migration was assayed by using this same protocol, but omitting the Matrigel. Nude mouse xenograft model. Male athymic nu/nu mice 5 weeks of age, weighing 20 to 22 g and specific pathogen-free, were obtained from Charles

Surgery September 2004

Fig 1. GLUT-1 and MMP-2 expression in pancreatic cancer cell lines under baseline conditions. Cell lysates containing 50 mg of total protein each were subjected to Western blotting. Actin was used as a loading control. MIAPaCa-2 and PANC-1 displayed high levels of GLUT1 and MMP-2 expression, CAPAN-2 displayed low levels of GLUT-1 and MMP-2 expression, and BXPC-3 displayed intermediate expression levels.

River Laboratories (Wilmington, Mass). Mice were housed in microisolator cages with autoclaved bedding in a specific pathogen-free facility with 12-hour light-dark cycles. They received water and food ad libitum. Animals were observed for signs of tumor growth, activity, feeding, and pain in accordance with the guidelines of the Harvard Medical Area Standing Committee on Animals. Surgical orthotopic implantation. Mice were anesthetized with intraperitoneal ketamine (200 mg/kg), (Abbott Laboratories, Chicago, Ill) and xylazine (10mg/kg), (Phoenix Pharmaceutical, St. Joseph, Mo). In a laminar flow hood, the abdomen was cleaned with isopropyl alcohol and a left upper transverse incision was made to and including the peritoneum. The pancreas was exposed and 1 3 106 cells suspended in 50 ml of PBS were slowly injected into the body of the pancreas. Five mice each received MIAPaCa-2 or PANC-1 cells transfected with empty p-silencer vector (control), and 5 each received those transfected with p-silencer vector containing scramble sequence cDNA or the short hairpin cDNA targeting GLUT-1. The pancreata were returned into their normal anatomic location, and the abdomens closed with 5-0 Vicryl (Somerville, NJ). Mice were observed for 6 weeks and killed by overdose of ketamine (400 mg/kg) and xylazine (50 mg/kg). Necropsy was performed, and the lungs and liver of each

Surgery Volume 136, Number 3

Ito et al 551

Fig 2. The effects of modulating GLUT-1 expression on MMP-2 expression. A, Western blotting was performed to assay GLUT-1 and MMP-2 expression in lysates of untransfected (control) CAPAN-2 cells, and CAPAN-2 cells transfected with empty vector (mock) or GLUT-1 expression vector (GLUT-1). Relative expression was quantified using densitometry. Forced overexpression of GLUT-1 induced an increase in MMP-2 expression in CAPAN-2 cells (*P < .05 vs corresponding control). B, Western blotting was performed to assay GLUT-1 and MMP-2 expression in lysates of MIAPaCa-2 and PANC-1 cells transfected with empty vector (mock), the vector containing the scrambled sequence oligonucleotide (scramble), or the GLUT1 RNAi-inducing vector (GLUT-1 RNAi). Relative expression was quantified using densitometry. GLUT-1 silencing induced suppression of MMP-2 expression in both MIAPaCa-2 and PANC-1 cells (*P < .05 vs mock).

animal were sectioned and examined for metastases, the presence of which were confirmed histologically. Statistical analysis. Differences between groups were analyzed using 2-sided t test or ANOVA, as appropriate, with P < .05 considered statistically significant. RESULTS Baseline expression of GLUT-1 and MMP-2. We assayed baseline GLUT-1 and MMP-2 expression in the pancreatic cancer cell lines using Western blotting. As shown in Fig 1, MIAPaCa-2 and

PANC-1 cells displayed significantly greater GLUT-1 and MMP-2 expression levels than CAPAN-2 cells (P < .05). BXPC-3 cells displayed intermediate expression levels of GLUT-1 and MMP-2. Effects of modulating GLUT-1 expression on MMP-2 expression and activity. We determined the effects of altering the expression of GLUT-1 on MMP-2 expression. We transfected CAPAN-2 cells, which display low levels of GLUT-1 expression under baseline conditions, with the GLUT-1 expression vector to induce forced overexpression of GLUT-1. CAPAN-2 cells transfected with this vector displayed 3.5-fold greater GLUT-1 expression and

552 Ito et al

Fig 3. The effects of modulating GLUT-1 expression on MMP-2 activity. The activities of MMP-2 and MMP-9 secreted into the conditioned media were assayed by zymography conducted using 20 mL of conditioned media from CAPAN-2 untransfected (control), transfected with empty vector (mock), and GLUT-1 expression vector (GLUT-1), MIAPaCa-2 and PANC-1 transfected with empty vector (mock), the vector containing the scrambled sequence oligonucleotide (scramble), or the GLUT-1 RNAi-inducing vector (GLUT-1 RNAi). Forced overexpression of GLUT-1 induced an increase in MMP-2 gelatinolytic activity but not in MMP-9 activity. GLUT-1 gene silencing induced a suppression in MMP2 gelatinolytic activity but not in MMP-9 activity.

4.1-fold greater MMP-2 expression on Western blotting than untransfected (control) cells (P < .05, Fig 2, A). As an additional control, we tested cells transfected with empty (mock) vector: there were no significant differences in GLUT-1 and MMP-2 expression levels between untransfected cells and cells transfected with empty vector. Next, we transfected MIAPaCa-2 and PANC-1 cells, which express high levels of GLUT-1 under baseline conditions, with the GLUT-1 RNAi inducing vector to silence GLUT-1 expression. No significant differences were observed in cell viability or proliferation between the untransfected cells and the cells stably transfected with GLUT-1 RNAiinducing vector, as confirmed on trypan blue exclusion and MTT assay, respectively (data not shown). MIAPaCa-2 cells transfected with this vector displayed 76% and 86% reductions in GLUT-1 and MMP-2 expression, respectively, relative to cells transfected with mock vector (P < .05, Fig 2, B). Similarly PANC-1 cells transfected with the GLUT-1 RNAi-inducing vector displayed 77% and 89% reductions in GLUT-1 and MMP-2 expression, respectively, relative to cells transfected with mock vector (P < .05, Fig 2, B). There were no differences in GLUT-1 or MMP-2 expression levels between cells transfected with mock vector and those transfected with the scramble sequence oligonucleotide-bearing vector (scramble). GLUT-

Surgery September 2004

Fig 4. The effects of modulating GLUT-1 expression on MMP-2 promoter activity. CAPAN-2 cells with or without transfection of GLUT-1 expression vector, and MIAPaCa2 with or without GLUT-1 RNAi vector were cotransfected with pRL, containing the renilla luciferase gene, and with pGL3e (empty firefly luciferase vector) or pGL3-MMP2, containing the full sequence MMP-2 promoter. Twenty-four hours after transfection, luciferase activity in cell lysates was assayed. The induced firefly luciferase activity was normalized to the renilla luciferase activity. Forced overexpression of GLUT-1 induced an increase in MMP-2 promoter activity in CAPAN-2 cells, whereas GLUT-1 silencing suppressed MMP-2 promoter activity in MIAPaCa-2 cells. (*P < .05 vs control for CAPAN-2, and vs mock for MIAPaCa-2).

1 gene suppression in the stably transfected cells was sustained for more than 6 weeks (data not shown). The gelatinolytic activity of secreted MMPs in the conditioned media was assayed using zymography. As shown in Fig 3, forced overexpression of GLUT-1 in CAPAN-2 cells enhanced MMP-2 activity, whereas GLUT-1 silencing in MIAPaCa-2 and PANC-1 cells suppressed MMP-2 activity. In serumfree conditions, all 3 pancreatic cancer cells tested only secreted the latent form of MMP-2 (72kDa). Induction of active MMP-2 (69kDa) was not observed even in cells that overexpressed GLUT-1. This finding suggests that GLUT-1 expression affects MMP-2 expression but not activation. Neither forced overexpression nor silencing of GLUT-1 induced any detectable changes in MMP9 activity.

Surgery Volume 136, Number 3

Ito et al 553

Fig 5. The effects of modulating GLUT-1 expression on cellular invasiveness. A, Cellular invasiveness through Matrigel by untransfected CAPAN-2 cells (control) and CAPAN-2 cells transfected with empty vector (mock) or the GLUT-1 expression vector (GLUT-1) was assayed using Boyden chambers, as described in the Material and Methods section. Cellular migration was assayed using Boyden chambers without Matrigel. The experiment was performed in triplicate. Forced expression of GLUT-1 induced an increase in cellular invasion through Matrigel without altering cellular migration in CAPAN-2 cells (*P < .05, vs control). B, MIAPaCa-2 and PANC-1 cells were transfected with the empty vector (mock), the vector containing the scrambled sequence oligonucleotide (scramble), or the GLUT-1 RNAi-inducing vector (GLUT-1 RNAi). Cellular invasiveness was assayed using Matrigel Boyden chamber, as described in the Material and Methods section. The experiment was performed in triplicate (*P < .05, vs mock). GLUT-1 gene silencing suppressed cellular invasion through Matrigel in MIAPaCa-2 and PANC-1 cells. C, Cellular invasiveness through Matrigel by untransfected CAPAN-2 cells (control) and CAPAN-2 cells transfected with GLUT-1 expression vector (GLUT-1) was assayed using Matrigel Boyden Chambers in the presence of anti-MMP-2 antibody or control IgG. GLUT-1 overexpressioninduced increase in cellular invasiveness was abolished by anti-MMP-2 antibody, but not by control IgG.

Effect of modulating GLUT-1 expression on MMP-2 promoter activity. Given the observed relationship between GLUT-1 and MMP-2 expression levels, we next determined the effects of modulating GLUT-1 expression levels on MMP-2 promoter activity using a luciferase-based promoter assay. We subcloned the full-length MMP-2 promoter into pGL3e and transfected this vector (pGL3-MMP2) along with pRL-CMV into CAPAN-2 and MIAPaCa-2 cells. The resulting luciferase activities were assayed 24 hours subsequently. Cells transfected with empty pGL3e displayed a very low level of firefly luciferase activity. As shown in Fig 4, forced overexpression of GLUT-1 induced a 3.7-fold in-

crease in MMP-2 promoter activity in CAPAN-2 cells, relative to untransfected cells (P < .05). Further GLUT-1 gene silencing induced a 79% reduction in MMP-2 promoter activity in MIAPaCa2 cells, relative to cells transfected with mock vector (P < .05). These results suggest that modulating GLUT-1 expression induces alterations in MMP-2 promoter activity. Effect of modulating GLUT-1 expression on cellular invasiveness. As MMP-2 activity is known to be associated with pancreatic cancer invasiveness,16 we tested the effects of GLUT-1 forced overexpression or silencing on cellular invasiveness. Forced overexpression of GLUT-1 in CAPAN-2 cells

554 Ito et al

Surgery September 2004

Table. MIAPaCa-2 Groups (n = 5 each) Mock Scramble GLUT-1 PANC-1 Groups (n = 5 each) Mock Scramble GLUT-1

Size of primary tumor (mm) 20 ± 5 20 ± 5 16 ± 5

No of mice with metastasis 5 5 0*

Median # of liver metastasis 3 (range, 1-5) 2 (range, 1-3) 0

Size of primary tumor (mm) 19 ± 3 20 ± 4 15 ± 4

No of mice with metastasis 4 5 1*

Median # of liver metastasis 3 (range, 0-5) 3 (range, 2-4) 0 (range, 0-1)

Mice in each group were implanted with 1 3 105 cells transfected with empty vector (mock), vector containing scramble oligonucleotide (scramble), or GLUT-1 RNAi vector (GLUT-1), as described in the Material and Methods section. Mice were killed at 6 weeks and examined for presence of liver metastasis. *P < .05 vs mock and vs scramble.

induced a 2.5-fold increase in cellular invasiveness through Matrigel, relative to untransfected cells (Fig 5, A, P < .05). However, forced overexpression of GLUT-1 in CAPAN-2 cells had no effect on cellular migration. GLUT-1 silencing induced 74% and 79% reductions in cellular invasiveness through Matrigel in MIAPaCa-2 and PANC-1, respectively, relative to corresponding controls (Fig 5, B, P < .05). To examine the relationship between observed alterations in invasiveness and in MMP-2 expression, Matrigel invasion assays were conducted in the presence of MMP-2-neutralizing antibody. GLUT-1 overexpression–mediated increase in CAPAN-2 cellular invasiveness through Matrigel was abrogated by anti-MMP-2 antibody but not by control immunoglobulin-G (IgG) (Fig 5, C). These results suggest that GLUT-1–mediated effects on pancreatic cancer cellular invasiveness through Matrigel are, at least in part, MMP-2 dependent. Effect of GLUT-1 gene silencing on metastatic potential in vivo. Given our findings on the relationship between GLUT-1 expression levels and cellular invasiveness, we tested the effects of GLUT-1 gene silencing on pancreatic cancer metastatic potential in vivo. Six weeks after implantation with MIAPaCa-2 or PANC-1 cells treated with mock vector, 5 out of 5 and 4 of 5 mice, respectively, developed gross liver metastases, which were confirmed histologically. No lung metastases were detected except in 1 mouse implanted with PANC-1 cells. Similarly, 100% of mice implanted with MIAPaCa-2 or PANC-1 cells (n = 5 for each) treated with vector containing the scramble sequence oligonucleotide developed gross liver metastases. Of the 5 mice each that received MIAPaCa-2 or PANC-1 cells transfected with GLUT-1 RNAi-inducing vectors, none devel-

oped metastases (Table, P < .05). GLUT-1 gene silencing had no observable effect on the size of primary tumors. DISCUSSION Our findings suggest that GLUT-1 promotes cellular invasiveness in pancreatic cancer, a disease in which this process is so aggressive. Although GLUT-1 overexpression previously has been reported to be present in tissues derived from numerous human cancers,2,4-8,17 including pancreatic cancer,9 and in pancreatic cancer cell lines,18 mechanistic data on the role of GLUT-1 in cellular invasiveness have been limited. Previously reported studies on the role of GLUT1 in promoting malignant cellular behavior have focused on factors inducing its expression, such as local hypoxia,19 and oncogenes, such as Ras, Src,20 or Myc.21 In other reports, forced overexpression of GLUT-1 has been correlated with increased cellular glucose uptake and glycolytic metabolism and with increased rates of cellular proliferation.2,17 Our study suggests increased cellular invasiveness as an additional mechanism by which GLUT-1 promotes pancreatic cancer progression. Our study also suggests that GLUT-1--induced cellular invasiveness is MMP-2--dependent, with MMP-2 being transcriptionally activated by increased GLUT-1 levels. These findings are consistent with those reported by Ito and colleagues, who demonstrated that GLUT-1 and MMP-2 are coexpressed in many cancers and that forced overexpression of GLUT-1 in sarcoma cells resulted in an increase in MMP-2 expression and cellular invasiveness.13 The mechanisms by which GLUT-1 regulates MMP-2 expression will require further study. In the

Surgery Volume 136, Number 3

study reported by Ito and colleagues, GLUT-1 was observed to induce MMP-2 expression via p53 activation.13 However, given the high prevalence of p53 mutations in pancreatic cancer, including in the PANC-1 and MIAPaCa-2 cells used in our study,22 and the fact that these mutated p53s are reported to have no binding activity on the MMP-2 promoter,14 this mechanism may not be applicable to pancreatic cancer. Other potential mechanisms through which GLUT-1 may modulate MMP-2 expression include the JNK-MEKK123 and PI3-Akt signaling pathways.24 These pathways are known to be relevant in the regulation of MMP-2 expression;25,26 further, they transduce signals related to GLUT-1 expression and cellular glycolytic activity. Although our study was designed to provide mechanistic insights into the progression of pancreatic cancer, the therapeutic implications of our findings are significant. Given that GLUT-1 is overexpressed in cancerous cells, including pancreatic cancer cells, and its role in promoting invasive and metastatic potential, GLUT-1 represents a rational molecular therapeutic target. Our approach to silencing GLUT-1 expression, transfecting cells with RNAi-inducing vector ex vivo, may not be applicable as a therapeutic strategy for patients with established pancreatic cancer. However, the feasibility of tumoral gene silencing induced by the delivery of therapeutic siRNA in vivo has already been demonstrated.27,28 Technologic advances, such as the development of improved delivery systems for siRNAs, will facilitate this approach. In summary, our findings suggest that GLUT-1 promotes pancreatic cancer cellular invasive and metastatic potential. Our findings also indicate that GLUT-1 represents a potential therapeutic target for strategies designed to inhibit the progression of pancreatic cancer.

REFERENCES 1. Isselbacher KJ. Sugar and amino acid transport by cells in culture–differences between normal and malignant cells. N Engl J Med 1972;286:929-33. 2. Haber RS, Rathan A, Weiser KR, Pritsker A, Itzkowitz SH, Bodian C, et al. GLUT1 glucose transporter expression in colorectal carcinoma: a marker for poor prognosis. Cancer 1998;83:34-40. 3. Ito T, Noguchi Y, Satoh S, Hayashi H, Inayama Y, Kitamura H. Expression of facilitative glucose transporter isoforms in lung carcinomas: its relation to histologic type, differentiation grade, and tumor stage. Mod Pathol 1998;11:437-43. 4. Haber RS, Weiser KR, Pritsker A, Reder I, Burstein DE. GLUT1 glucose transporter expression in benign and malignant thyroid nodules. Thyroid 1997;7:363-7.

Ito et al 555

5. Kalir T, Wang BY, Goldfischer M, Haber RS, Reder I, Demopoulos R, et al. Immunohistochemical staining of GLUT1 in benign, borderline, and malignant ovarian epithelia. Cancer 2002;94:1078-82. 6. Younes M, Brown RW, Mody DR, Fernandez L, Laucirica R. GLUT1 expression in human breast carcinoma: correlation with known prognostic markers. Anticancer Res 1995;15: 2895-8. 7. Chandler JD, Williams ED, Slavin JL, Best JD, Rogers S. Expression and localization of GLUT1 and GLUT12 in prostate carcinoma. Cancer 2003;97:2035-42. 8. Kawamura T, Kusakabe T, Sugino T, Watanabe K, Fukuda T, Nashimoto A, et al. Expression of glucose transporter-1 in human gastric carcinoma: association with tumor aggressiveness, metastasis, and patient survival. Cancer 2001; 92:634-41. 9. Reske SN, Grillenberger KG, Glatting G, Port M, Hildebrandt M, Gansauge F, et al. Overexpression of glucose transporter 1 and increased FDG uptake in pancreatic carcinoma. J Nucl Med 1997;38:1344-8. 10. Gardner-Thorpe J, Ito H, Ashley SW, Whang EE. Differential display of expressed genes in pancreatic cancer cells. Biochem Biophys Res Commun 2002;293:391-5. 11. Yu JY, DeRuiter SL, Turner DL. RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci U S A 2002;99: 6047-52. 12. Herron GS, Werb Z, Dwyer K, Banda MJ. Secretion of metalloproteinases by stimulated capillary endothelial cells. I. Production of procollagenase and prostromelysin exceeds expression of proteolytic activity. J Biol Chem 1986;261: 2810-3. 13. Ito S, Fukusato T, Nemoto T, Sekihara H, Seyama Y, Kubota S. Coexpression of glucose transporter 1 and matrix metalloproteinase-2 in human cancers. J Natl Cancer Inst 2002; 94:1080-91. 14. Bian J, Sun Y. Transcriptional activation by p53 of the human type IV collagenase (gelatinase A or matrix metalloproteinase 2) promoter. Mol Cell Biol 1997;17: 6330-8. 15. Kubota S, Ito H, Ishibashi Y, Seyama Y. Anti-alpha3 integrin antibody induces the activated form of matrix metalloprotease-2 (MMP-2) with concomitant stimulation of invasion through Matrigel by human rhabdomyosarcoma cells. Int J Cancer 1977;70:106-11. 16. Yang X, Staren ED, Howard JM, Iwamura T, Bartsch JE, Appert HE. Invasiveness and MMP expression in pancreatic carcinoma. J Surg Res 2001;98:33-9. 17. Younes M, Lechago LV, Somoano JR, Mosharaf M, Lechago J. Wide expression of the human erythrocyte glucose transporter Glut1 in human cancers. Cancer Res 1996;56: 1164-7. 18. Yamamoto T, Seino Y, Fukumoto H, Koh G, Yano H, Inagaki N, et al. Over-expression of facilitative glucose transporter genes in human cancer. Biochem Biophys Res Commun 1990;170:223-30. 19. Behrooz A, Ismail-Beigi F. Dual control of glut1 glucose transporter gene expression by hypoxia and by inhibition of oxidative phosphorylation. J Biol Chem 1997;272:5555-62. 20. Flier JS, Mueckler MM, Usher P, Lodish HF. Elevated levels of glucose transport and transporter messenger RNA are induced by ras or src oncogenes. Science 1987;235: 1492-5. 21. Osthus RC, Shim H, Kim S, Li Q, Reddy R, Mukherjee M, et al. Deregulation of glucose transporter 1 and

556 Ito et al

glycolytic gene expression by c-Myc. J Biol Chem 2003; 275:21797-800. 22. Moore PS, Sipos B, Orlandini S, Sorio C, Real FX, Lemoine NR, et al. Genetic profile of 22 pancreatic carcinoma cell lines. Analysis of K-ras, p53, p16 and DPC4/Smad4. Virchows Arch 2001;439:798-802. 23. Lin Z, Weinberg JM, Malhotra R, Merritt SE, Holzman LB, Brosius FC. 3rd. GLUT-1 reduces hypoxia-induced apoptosis and JNK pathway activation. Am J Physiol Endocrinol Metab 2000;278:E958-66. 24. Srinivasan S, Bernal-Mizrachi E, Ohsugi M, Permutt MA. Glucose promotes pancreatic islet beta-cell survival through a PI 3-kinase/Akt-signaling pathway. Am J Physiol Endocrinol Metab283.

Surgery September 2004

25. Hauck CR, Hsia DA, Puente XS, Cheresh DA, Schlaepfer DD. FRNK blocks v-Src-stimulated invasion and experimental metastases without effects on cell motility or growth. Embo J 2002;21:6289-302. 26. Liao J, Wolfman JC, Wolfman A. K-ras regulates the steady-state expression of matrix metalloproteinase 2 in fibroblasts. J Biol Chem 2003;278:31871-8. 27. Duxbury MS, Ito H, Zinner MJ, Ashley SW, Whang EE. RNA interference targeting the M2 subunit of ribonucleotide reductase enhances pancreatic adenocarcinoma chemosensitivity to gemcitabine. Oncogene 2003;23: 1539-48. 28. Wall NR, Shi Y. Small. RNA: Can RNA interference be exploited for therapy? Lancet 2003;362:1401-3.