Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

YCLNU2648_proof ■ 25 September 2015 ■ 1/9

Clinical Nutrition xxx (2015) 1e9

55 56 57 58 59 60 61 journal homepage: http://www.elsevier.com/locate/clnu 62 63 Original article 64 65 66 67 68 69 Marissa K. Caldow, Daniel J. Ham, Daniel P. Godeassi, Annabel Chee, Gordon S. Lynch, 70 71  Koopman* Rene 72 Basic and Clinical Myology Laboratory, Department of Physiology, The University of Melbourne, Melbourne, VIC 3010, Australia 73 74 75 a r t i c l e i n f o s u m m a r y 76 77 Article history: Background & aim: Calorie restriction (CR) reduces co-morbidities associated with obesity, but also re78 Received 1 April 2015 duces lean mass thereby predisposing people to weight regain. Since we demonstrated that glycine 79 Accepted 27 August 2015 supplementation can reduce inflammation and muscle wasting, we hypothesized that glycine supple80 mentation during CR would preserve muscle mass in mice. 81 Keywords: Methods: High-fat fed male C57BL/6 mice underwent 20 days CR (40% reduced calories) supplemented Muscle mass 82 with glycine (1 g/kg/day; n ¼ 15, GLY) or L-alanine (n ¼ 15, ALA). Body composition and glucose tolerance Glycine 83 were assessed and hindlimb skeletal muscles and epididymal fat were collected. Nutrition Results: Eight weeks of a high-fat diet (HFD) induced obesity and glucose intolerance. CR caused rapid 84 Calorie restriction weight loss (ALA: 20%, GLY: 21%, P < 0.01), reduced whole-body fat mass (ALA: 41%, GLY: 49% P < 0.01), 85 Fat mass and restored glucose tolerance to control values in ALA and GLY groups. GLY treated mice lost more 86 whole-body fat mass (14%, p < 0.05) and epididymal fat mass (26%, P < 0.05), less lean mass (27%, 87 P < 0.05), and had better preserved quadriceps muscle mass (4%, P < 0.01) than ALA treated mice after 88 20 d CR. Compared to the HFD group, pro-inflammatory genes were lower (P < 0.05), metabolic genes 89 higher (P < 0.05) and S6 protein phosphorylation lower after CR, but not different between ALA and GLY 90 groups. There were significant correlations between %initial fat mass (pre CR) and the mRNA expression 91 of genes involved in inflammation (r ¼ 0.51 to 0.68, P < 0.05), protein breakdown (r ¼ 0.66 to 0.37, 92 P < 0.05) and metabolism (r ¼ 0.59 to 0.47, P < 0.05) after CR. 93 Conclusion: Taken together, these findings suggest that glycine supplementation during CR may be 94 beneficial for preserving muscle mass and stimulating loss of adipose tissue. © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved. 95 96 97 98 99 100 101 1. Introduction 102 Obesity increases the risk of developing multiple pathological Q1 103 104 Abbreviations: ALA, alanine; Atf4, activating transcription factor 4; AUC, area conditions and is commonly associated with metabolic syndrome under the curve; Bnip3, BCL2/adenovirus E1B interacting protein 3; Ccl2, chemo105 (MetS), type 2 diabetes mellitus (T2DM), and cardiovascular disease kine(CeC motif) ligand 2; Ccl5, chemokine(CeC motif) ligand 5; CON, control; CR, 106 [1]. Weight loss is key to combat the comorbidities from obesity calorie restriction; eIF2a, eukaryotic translation initiation factor 2A; eIF3F, 107 and can have profound health benefits by improving metabolic eukaryotic translation initiation factor 3; F4/80, EGF-like module containing, 108 mucin-like, hormone receptor-like sequence 1; Foxo1, forkhead box O1; Foxo4, control [2]. Dietary modulation of energy balance through a 109 forkhead box O4; GAST, gastrocnemius muscle; GTT, glucose tolerance test; GLY, reduction in energy intake [calorie restriction (CR), defined as a glycine; HFD, high fat diet; Il-6, interleukin-6; LC3B, microtubule-associated protein 110 30e60% decrease in food intake without malnutrition] appears the 1 light chain 3 beta; LSM, least-squares method; mTOR, mechanistic target of 111 most effective strategy for managing weight [for review see [3]]. rapamycin; Murf1, muscle ring finger-1; NF, normalization factor; QUAD, quadri112 ceps muscle; PLAN, plantaris muscle; Ppara, peroxisome proliferator activated reWeight loss during CR is not due to loss of adipose tissue alone. 113 ceptor alpha; Ppard, peroxisome proliferator activated receptor delta; Pparg, An undesirable consequence of CR is the associated loss of fat-free peroxisome proliferator activated receptor gamma; SOL, soleus muscle; TA, tibialis 114 mass [4,5]. Up to 50% of the body weight lost through dieting (i.e. 3 anterior muscle; Tbp, tata-box binding protein; Tnfa, tumor necrosis factor alpha. 115 month period of reduced daily caloric intake by 400e800 kcal) is * Corresponding author. Tel.: þ61 3 8344 0243; fax: þ61 3 8344 5818. 116 attributed to the loss of fat free mass [6], particularly skeletal E-mail address: [email protected] (R. Koopman). 117 118 http://dx.doi.org/10.1016/j.clnu.2015.08.013 119 0261-5614/© 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved. Contents lists available at ScienceDirect

Clinical Nutrition

Q6 Q5

Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YCLNU2648_proof ■ 25 September 2015 ■ 2/9

2

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9

muscle. An excessive loss of skeletal muscle mass reduces the capacity for glucose uptake, thereby increasing the risk of developing metabolic diseases and weight regain [7]. Exercise in conjunction with CR attenuates, but does not completely prevent, the loss of fat free mass [5]. Therefore, strategies that can maintain skeletal muscle mass during states of negative energy balance are required, particularly for those who require rapid weight loss, but are unable to exercise. Ingestion of a high-protein (1.2e1.5 g/kg/day), low-fat diet can modulate skeletal muscle mass and attenuate muscle loss during CR [8e12]. Additional protein intake stimulates protein synthesis especially during conditions where daily protein intake is low [13]. Small elevations in plasma and/or muscle amino acid concentrations, particularly leucine, increases muscle protein synthesis, and stimulates the secretion of anabolic hormones. Therefore it has been suggested that supplementation with this specific amino acid could be effective in attenuating the loss of muscle mass. Interestingly, leucine administration during CR in rats did not attenuate muscle wasting [14]. Our recently published observations demonstrate that a specific non-essential amino acid, glycine, can preserve skeletal muscle mass and function during wasting conditions [15]. Glycine, is often considered biologically neutral, but recent studies from our laboratory show that glycine administration attenuates cancer-induced skeletal muscle wasting in mice by 50% [15]. In addition, glycine reduces muscle inflammation, macrophage infiltration and the production of reactive oxygen species in a mouse model of cancer cachexia. In this study, we investigated the effect of glycine supplementation on muscle mass of high-fat fed obese mice subjected to a period of CR (40% reduced calories). We tested the hypothesis that glycine supplementation during CR would preserve muscle mass.

loss or abnormal appearance). Control mice (CON, n ¼ 15) were fed standard-diet AIN93G and food intake was measured weekly to determine the amount of food to be given to the calorie restricted mice. 2.3. Diets To induce obesity during the first 8 weeks of the experiment, mice fed the high-fat diet were provided with ad libitum access to SF03-002 fat modified AIN93G (% by weight: 19.4% protein; 36% total fat; Specialty Feeds, WA, Australia). During the CR period, 15 mice were individually housed and provided with ad libitum access to standard AIN93G rodent diet (% by weight: 19.4% protein; 7% fat; Specialty Feeds) and served as controls (CON) for ALA and GLY groups. The diets for ALA and GLY groups during the 20 day CR period were based on the AIN93G diet and supplemented with additional trace minerals and vitamins and either additional Lalanine (SigmaeAldrich Co, Castle Hill, NSW, Australia) or glycine (SigmaeAldrich), respectively. Glycine and L-alanine were supplemented within the AIN93G feed at 1.9% by weight, so that the mice on the calorie restricted diets received 1 g/kg/day of the respective amino acid. Alanine and glycine groups were limited to 60% of the food intake of the CON group during the CR period. Extra vitamins and minerals were added to AIN93G diet during CR so that the CR mice still received normal amounts of these important nutrients. This was based on the assumption that calorie restricted mice received 60% of the expected 4 g/day of feed consumed by CON mice, as previously demonstrated [16]. The dose of glycine was based on a previous study that had shown it effective in attenuating muscle loss [15]. 2.4. Body composition and mass

2. Methods 2.1. Animals Sixteen week old male C57BL/6 mice (n ¼ 75) were used in this study. Mice were obtained from the Animal Resources Centre (Canning Vale, WA, Australia), and housed in the Biological Research Facility at The University of Melbourne under a 12-h light/ dark cycle with drinking water available ad libitum. All experiments were approved by the Animal Ethics Committee of The University of Melbourne and conducted in accordance with the Australian code of practice for the care and use of animals for scientific purposes as described by the National Health and Medical Research Council of Australia. 2.2. Experimental protocol To induce obesity, 16 week old mice received a high-fat diet (HFD, n ¼ 45). Mice were fed these respective diets for 8 weeks and weighed weekly to monitor weight gain. After the first 8 weeks, 15 (HFD) mice were assessed for body composition, and glucose tolerance to verify that the high-fat diet induced obesity. After these tests the mice were killed and tissues collected for further analysis. HFD mice (n ¼ 30) were allocated randomly into two groups of equal body mass (n ¼ 15/group; alanine [ALA] and glycine [GLY]) for 20 days of CR (40% reduced calories). Mice were housed individually during this time to ensure that each individual calorie restricted mouse (ALA and GLY) received their entire allocation of food. ALA and GLY groups were fed a 40% CR AIN93G diet supplemented with additional trace minerals and vitamins (Specialty Feeds, WA, Australia) supplemented with either L-alanine or glycine, respectively (1 g/kg/day). Mice were monitored closely every day for adverse signs or symptoms (such as excessive weight

Body mass was monitored throughout the study by weighing mice in an open container on an electronic balance (Ohaus, Port Melbourne, VIC, Australia). This was performed weekly for the first 8 weeks (HFD) and daily during the CR period. Body composition (fat and lean mass, free water, and total water) was assessed by an MRI scan (EchoMRI™-100, EchoMRI, Houston, Texas) during week 8 (day 0), at the midpoint of CR (day 10) and at the end of CR (day 20). Three scans were performed and the average of these scans used for analysis. 2.5. Glucose tolerance test Glucose tolerance tests were performed on mice after an overnight fast (16 h). Briefly, basal glucose levels were measured via blood collection from the tail vein by fine needle puncture using a glucometer (Accu-Chek Performa, Roche Diagnostics, Castle Hill, VIC, Australia). Mice were given an intraperitoneal injection (i.p.) of 1 g/kg body mass of 0.1 g/mL glucose (SigmaeAldrich) dissolved in sterilized saline, and blood glucose was measured at 15, 30, 60, 90 and 120 min post glucose injection [17]. 2.6. Tissue collection At the end of the intervention periods (8 weeks of HFD or 20 days of CR), mice were anesthetized with an i.p. injection of sodium pentobarbitone (Nembutal, 60 mg/kg, SigmaeAldrich) such that they were unresponsive. Epididymal fat and the tibialis anterior (TA), plantaris (PLAN), gastrocnemius (GAST), soleus (SOL) and quadriceps (QUAD) muscles were carefully excised, blotted on filter paper and weighed on an analytical balance (Ohaus, Port Melbourne, VIC, Australia). All frozen tissues were stored at 80  C for subsequent analyses.

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YCLNU2648_proof ■ 25 September 2015 ■ 3/9

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9

2.7. RNA extraction and qPCR Total RNA was extracted from 10 to 20 mg of quadriceps muscle using a commercially available kit, according to the manufacturer's instructions (RNeasy Fibrous Tissue Mini Kit, Qiagen, VIC, Australia). RNA was transcribed into cDNA using the SuperScript™VILO cDNA Synthesis Kit (Life Technologies, VIC, Australia). qPCR was performed using the Bio-Rad CFX384 PCR system (BioRad Laboratories, NSW, Australia) and PCR performed in duplicate with reaction volumes of 10 ml, containing SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories), forward and reverse primers and cDNA template. The efficacy of Tata-box binding protein (Tbp) and b-actin as endogenous controls was examined using the equation 2DCq. A normalization factor (NF) was generated from the geometric mean of Tbp and b-actin expression. Data were analyzed using a comparative quantification cycle (Cq) method where the amount of target relative to NF is given by 2DDCq. Primers were designed using NCBI Primer BLAST from gene sequences obtained from GenBank and listed in Table 1 or described elsewhere [15]. 2.8. Protein extraction and immunoblotting Homogenization of approximately 20 mg of quadriceps muscle using 400 ml of RIPA lysis buffer (Merck Millipore, VIC Australia including protease and phosphatase inhibitor cocktails (SigmaeAldrich, Australia) was performed using the Precellys®24 (20 s, setting 5500 rpm) (Sapphire Bioscience, NSW, Australia) and metal bead lysing matrix (MP Biomedicals, NSW, Australia). The homogenate was rotated at 4  C for 1 h then centrifuged at 13,000 rpm at 4  C for 10 min and the supernatant collected. Protein content was determined using the Bio-Rad DC Protein Assay (Bio-Rad Laboratories) as per manufacturer's instructions. Protein (30 mg) was separated by 4e15% SDS-PAGE using Criterion™ TGX Stain-Free™ Precast Gels (Bio-Rad Laboratories). Protein was transferred onto a PVDF membrane (Trans-Blot® Turbo™ Transfer System, Bio-Rad Laboratories) and blocked in 5% (w/v) bovine serum albumin (BSA; SigmaeAldrich, Australia) in Tris Buffered Saline with 0.1% Tween 20 (TBST) for 2 h at room temperature. The membrane was cut according to protein size to allow maximum probing efficiency. Primary antibodies diluted in blocking buffer were applied and incubated overnight at 4  C; phospho-Akt (ser473), Akt, phosphoeIF2a, eIF2a, eIF3f, phospho-mTOR (ser2448), mTOR, pS6 (ser235/ 236), S6, p4EBP1 (thr37/46), 4EBP1 (Cell Signaling Technology Inc., Danvers, MA), LC3B (Rockland Immunochemicals, Gilbertsville, PA, USA) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (SigmaeAldrich, Australia). Membranes were subsequently washed with TBST and incubated for 1 h at room temperature with anti-

3

rabbit HRP-conjugated secondary antibodies (GE Healthcare, NSW, Australia) then diluted in blocking buffer before being washed again. Proteins were visualized by enhanced chemiluminescence (SuperSignal West Femto Chemiluminescent Substrate, Thermo-Fisher Scientific, VIC, Australia). Blot images were captured using the ChemiDoc™ MP Imaging System (Bio-Rad Laboratories) and band density quantified using Image Lab™ 4.1 software (Bio-Rad Laboratories, Hercules, CA). Membranes were stripped (Restore Western Blot Stripping Buffer, Thermo-Fisher Scientific, VIC, Australia) before being re-probed for GAPDH, Akt, mTOR, S6 and 4EBP1. 2.9. Statistical analysis All values are expressed as means ± SEM unless stated otherwise. Data were tested for outliers using the outlier labeling rule and Winsorized where appropriate within Microsoft Excel 2013 (Microsoft, Redmond, Washington, USA). All data were analyzed by SPSS v 21.0 (IMB Corp. Armonk, New York, USA) and plotted in GraphPad Prism v 6.0 (GraphPad Software, San Diego, California, USA). Briefly, data were tested for normality using a ShapiroeWilk's test and for homogeneity of variance using Levene's test. A one-way ANOVA with Tukey's post hoc test was used to compare between groups for end point measures (e.g. tissue mass, mRNA and protein expression etc.). A two-way repeated-measures ANOVA (time and treatment) with Fisher's LSD post hoc test was used to compare between groups across multiple time points (e.g. body mass, blood glucose, body composition) if it satisfied Mauchly's test of sphericity. Since starting %whole-body fat mass was a strong correlate of fat and lean tissue loss and body mass is a well-known correlate of muscle size, covariate adjustments for starting %whole-body fat mass and body mass were made using the least squares method [18]. An ANCOVA was used to assess main effects while controlling for an interacting source(s) of variation (covariate) only if a significant correlation between the covariate and dependent variable was found and homogeneity of regression was satisfied. Correlations between variables were assessed by Pearson's correlation coefficient and a two-tailed significance test. The significance level for all data was set at P < 0.05 and a Tukey's post hoc test was used to determine significant differences between individual groups. Trends (P < 0.1) have also been reported. 3. Results 3.1. Eight weeks of a high fat diet induces weight gain and impairs glucose tolerance. Body mass (13 ± 3%) and whole-body fat mass (29 ± 28%) were markedly higher in the HFD group than the CON group (P < 0.01,

Table 1 Details of primers used for qPCR analysis. Gene

GenBank accession number

Forward sequence (50 -30 )

Reverse sequence (50 -30 )

Atf4

NM_009716.2 NM_007393 NM_011333 NM_013653 NM_173395 NM_019739 NM_018789 NM_011144 NM_011145 NM_011146 NM_013684

GACCTGGAAACCATGCCAGA TACAGCTTCACCACCACAGC AGATGCAGTTAACGCCCCAC CCTCACCATATGGCTCGGAC CTACCTGCCCGAAGTTGAGG CTCCCGGTACTTCTCTGCTG CAAGAAGAAGCCGTCTGTCC TCTGTGGGCTCACTGTTCTG GACGGAGAGTGAGACCTTGC TTTTCAAGGGTGCCAGTTTC GTTGGGCTTCCCAGCTAAGT

TGGCCAATTGGGTTCACTGT AAGGAAGGCTGGAAAAGAGC GACCCATTCCTTCTTGGGGT ACGACTGCAAGATTGGAGCA GGTCGTGTTGGTCCCTTTCT GTGGTCGAGTTGGACTGGTT CTGACGGTGCTAGCATTTGA AACTACCTGCTCAGGGCTCA ACAGGAGGTGCTGAGGAGAA AATCCTTGGCCCTCTGAGAT CACAAGGCCTTCCAGCCTTA

b-actin Ccl2 Ccl5 Myonectin Foxo1 Foxo4 Ppara Ppard Pparg Tbp

Primer sequences were designed using NCBI Primer-BLAST using sequences accessed through GenBank and checked for specificity using NucleotideeNucleotide BLAST search. Atf4, activating transcription factor 4; Ccl2, chemokine(CeC motif) ligand 2; Ccl5, chemokine(CeC motif) ligand 5; Foxo1, forkhead box O1; Foxo4, forkhead box O4; Tbp, tatabox binding protein.

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YCLNU2648_proof ■ 25 September 2015 ■ 4/9

4

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9

Fig. 1A and B). Compared to the CON group, the blood glucose response during the GTT (expressed as area under the curve, AUC) was 24% higher (P < 0.001, Fig. 1C) in the HFD group. Blood glucose was higher in the HFD group under basal conditions and 30, 60, 90 and 120 min after administration of 1 g kg1 glucose (P < 0.05, Fig. 1D). 3.2. Calorie restriction induces rapid weight loss, restores normal glucose tolerance, improves mRNA expression of metabolic genes and reduces the expression inflammatory genes. Twenty days of CR resulted in rapid weight loss in both ALA and GLY treatment groups (Fig. 1A and E). Alanine supplemented mice lost 7.1 ± 0.4 g and glycine supplemented mice lost 7.5 ± 0.4 g of body mass and were both significantly lighter than the sham treated CON group after 20 d (P < 0.01). Whole-body fat mass, as determined via EchoMRI™ was reduced by CR in both ALA and GLY groups. Over the 20 d CR period, ALA mice lost 4.0 ± 0.5 g (P < 0.001) while glycine mice lost 4.7 ± 0.4 g of fat mass (P < 0.001, Fig. 1B). After the 20 d CR period, %whole-body fat mass was not different between CON, ALA and GLY groups. The blood glucose response to a glucose tolerance test and AUC were restored in both ALA and GLY groups and were not different from CON (Fig. 1C and D). CR reduced whole-body lean mass in both the ALA and GLY groups (P < 0.05, Fig. 1F). 3.3. Glycine increases the loss of fat and attenuates the loss of lean and muscle mass during calorie restriction. There was a reduction in %whole-body fat mass during CR, but after 20 d was not different between CON, ALA and GLY groups (Fig. 2A).There was a very strong positive correlation between %

whole-body fat mass immediately before the CR period (day 0) and the percentage of mass lost as fat during the first 10 d (ALA: R2 ¼ 0.79, GLY: R2 ¼ 0.81, P < 0.01, Fig. 2B) and over the full 20 d CR period (ALA: R2 ¼ 0.89, GLY: R2 ¼ 0.88, P < 0.01). Thus, mice with a higher initial body fat percentage lost a greater proportion of body mass as fat mass. For example, mice with a starting body fat% in the top 25% (mean d 0%whole-body fat mass: 31.1 ± 0.9%) lost 77.7 ± 3.0% of body mass as fat mass, while mice with an initial fat% in the bottom 25% (mean d 0%whole-body fat mass:11.4 ± 0.8%) lost just 36.6 ± 4.4% of body mass as fat mass across the 20 d of calorie restriction To account for this substantial source of variation, we normalized the %mass lost as fat during the CR period for day 0% whole-body fat mass using the least-squares method (LSM) (Fig. 2C). After normalization, the percentage of mass lost as fat was 9.8 ± 2.9% higher (P < 0.05) in the GLY group than the ALA group over the 20 d CR period. Further analysis revealed that the increased proportion of fat mass was limited to the first 10 d (Fig. 2C), with the %loss of fat mass 14 ± 4% higher in the GLY group than the ALA group (P < 0.05). End point analysis showed a significantly lower epididymal fat mass in the GLY group (P < 0.01) and a tendency for lower fat mass in the ALA group (P < 0.1) than the HFD group (Fig. 2D), and also when corrected for body mass (Fig. 2E). Consistent with whole-body measures of fat mass, once epididymal fat mass was normalized for %whole-body fat at day 0, the GLY group had 26 ± 5% less epididymal fat than the ALA group (P < 0.01, Fig. 2F). CR resulted in an increase in %whole-body lean mass (ALA: 10 ± 2%, GLY: 13 ± 2%, P < 0.01) in both ALA and GLY groups and was not different from CON after 20 d (Fig. 3A). There was a strong correlation between %fat mass immediately before the CR period (day 0) and the %mass lost as lean tissue during the first 10 d (ALA:

Fig. 1. Characterization of the model: calorie restriction induces rapid weight loss and restores normal glucose tolerance. Mice fed a high-fat diet (HFD) for 8 weeks had a higher body mass (A) and whole-body fat mass (B) than control mice (Con). The blood glucose response to a glucose challenge was higher in the HFD than the CON group (C, D) which was restored with CR. CR reduced body mass compared to CON (E) and reduced whole-body lean mass (F). Data are presented as means ± SEM (n ¼ 15/group). The symbols * and ** denote significant differences between groups at P < 0.05 and P < 0.01, respectively or * and the first letter of the group (P < 0.05) (for D).

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YCLNU2648_proof ■ 25 September 2015 ■ 5/9

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9

5

Fig. 2. Calorie restriction induces loss of fat mass which is augmented with glycine supplementation. Calorie restriction rapidly reduced %whole-body fat mass (A). %mass lost as fat during CR was strongly correlated with %fat mass before CR (day 0) (B). %mass lost as fat normalized for day 0%fat mass using the LSM across the full 20 day CR period and for the first and last 10 d of CR (C). Epididymal fat mass un-corrected and (D), corrected for body mass (E) and LSM normalized for day 0%fat mass (F). Data are presented as means ± SEM (n ¼ 15/group). Significant differences between groups is denoted by * or ** (at P < 0.05 and P < 0.01, respectively) while # represents a trend (P < 0.1).

R2 ¼ 0.79, GLY: R2 ¼ 0.81, P < 0.01, Fig. 3B) and over the full 20 d CR period (ALA: R2 ¼ 0.72, GLY: R2 ¼ 0.70, P < 0.01). After normalization using the LSM, the percentage of mass lost as lean mass tended to be lower (P < 0.1) in the GLY group than the ALA group over the 20 d CR period. Consistent with whole-body fat mass, further analysis revealed that the protection of lean mass lost was localized to the first 10 d (Fig. 3C), with the %loss of lean mass 27 ± 7% lower in the GLY group than the ALA group (P < 0.05). The mass of QUAD, GAST, PLAN and SOL muscles were also lower in both ALA and GLY groups than the HFD group (Fig. 3D). When corrected for body mass, there was greater QUAD (P ¼ 0.08) and GAST (P ¼ 0.01) mass in the GLY group, and greater TA mass in both the ALA and GLY groups compared to HFD (both P ¼ 0.01, Fig. 3F). Once normalized for body mass using the LSM, QUAD muscle mass was 4.4 ± 0.8% higher in the GLY group than the ALA group (P < 0.01, Fig. 3F). 3.4. Calorie restriction regulates genes associated with dietary stress, inflammation and muscle protein breakdown and markedly reduces the phosphorylation status of ribosomal protein S6. Compared to the HFD group, mRNA expression of the ubiquitin proteasome muscle protein breakdown system genes Atrogin-1 (ALA: 96%, GLY: 65%) and forkhead box O1 (Foxo1; ALA: 104%, GLY: 87%) were significantly increased in both ALA and GLY groups (P < 0.05, Fig. 4A). Similarly, alterations in the mRNA expression of factors known to play a role in fasting/re-feeding induced muscle wasting and changes in metabolism were altered by CR. Although

the mRNA expression of genes involved in autophagic muscle protein breakdown were not altered after 20 days of CR, the ratio of lipidated (II) to non-lipidated (I) LC3B (microtubule-associated protein 1 light chain 3 beta) was significantly higher, indicating increased autophagosome number, in the ALA group (42%, P < 0.05), but not different to HFD or ALA in the GLY group (Fig. 5A). Compared with the HFD group, mRNA expression of p21 (ALA: 157%, GLY: 182%) and activating transcription factor 4 (Atf4; ALA: 55%, GLY: 33%) were significantly higher in both ALA and GLY groups (P < 0.05, Fig. 4A). In contrast, compared with the HFD group, Myonectin mRNA expression was significantly lower in the ALA group (33%), but there was no difference between GLY and the ALA or HFD groups. There were no differences in Murf-1 or Bnip3 mRNA expression (Fig. 4A), or in eIF3f protein expression (Fig. 5B). Compared to the HFD group, the mRNA expression of proinflammatory genes were significantly lower (Tnfa, ALA: 67%, GLY: 50%; Ccl2, ALA: 60%, GLY: 54%; Ccl5, ALA: 52%, GLY: 54%; and F4/80, ALA: 61%, GLY: 50%; P < 0.05, Fig. 4B) and the expression of metabolic genes were significantly higher (Ppara, ALA: 102%, GLY 92% and Pparg, ALA: 58%, GLY: 53%; P < 0.05, Fig. 4C) in both ALA and GLY groups. Ppard was higher only in the GLY group compared to the HFD group (47%, P < 0.05). Consistent with the loss of skeletal muscle with CR, the phosphorylation status or ribosomal protein S6 (ser235/236) was markedly lower (P < 0.05) in both ALA (64%) and GLY (62%) groups, but not different between ALA and GLY (Fig. 5E). No alterations in the phosphorylation status of other proteins associated with Akt/mTOR signaling pathway including: Akt

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 Q2 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YCLNU2648_proof ■ 25 September 2015 ■ 6/9

6

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9

Fig. 3. Glycine attenuates the loss of lean mass and muscle mass during calorie restriction. Changes in %whole-body lean mass for ALA and GLY groups across the 20 d CR period compared to the ad libitum fed CON group (A). %mass lost as lean mass during CR was strongly correlated with %fat mass before (day 0) CR (B). %mass lost as lean mass normalized for day 0%fat mass using the LSM across the full 20 day CR period and for the first and last 10 d of CR (C). Hindlimb skeletal muscle mass uncorrected (D) and corrected for body mass (E). Quad mass LSM normalized for day 0%fat mass was high in the GLY group than the ALA group (F). Data are presented as means ± SEM (n ¼ 15/group). The symbols * and ** denote significant differences between groups at the P < 0.05 and P < 0.01, respectively, while # represents a trend (P < 0.1). Different letters denote differences between groups (for D).

(ser473); mechanistic target of rapamycin [mTOR] (ser2448), 4EBP1, or eukaryotic translation initiation factor 2A [eIF2a] (ser51) (Fig. 5C, D, F and G) were observed between HFD, ALA and GLY groups. 3.5. Starting body fat percentage correlates with inflammatory, muscle breakdown, dietary stress and metabolic mRNA expression after calorie restriction. Since we observed very strong correlations between body fat percentage immediately prior to the CR period and the composition of body mass (i.e. fat and lean) lost during CR, we investigated whether starting body fat percentage was also correlated with

mRNA expression of inflammatory, atrophic and metabolic genes in skeletal muscle. Starting body fat percentage was positively correlated with the mRNA expression of inflammatory genes (Tnfa, Ccl5, Ccl2 and F4/80) indicating that a higher starting body fat percentage was associated with higher inflammatory gene expression (Table 2). In contrast, starting body fat percentage was negatively correlated with the mRNA expression of muscle breakdown genes (Atrogin-1, Lc3b, Bnip, Foxo4 and Foxo1) and dietary stress and metabolic genes (Atf4, Myonectin, p21 and Ppard); i.e. a higher starting body fat percentage was associated with lower muscle breakdown, dietary stress and metabolic alterations in skeletal muscle. It is important to note that body fat percentage immediately before CR was also strongly correlated with weight

Fig. 4. Muscle breakdown, protein synthetic, inflammatory and metabolic signaling. The mRNA expression of genes involved in ubiquitin proteasome system muscle protein breakdown signaling (A), inflammation (B) and dietary stress (C) were altered by CR. Data are presented as means ± SEM (n ¼ 11/group). * denotes a significant difference (P < 0.05) from HFD.

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YCLNU2648_proof ■ 25 September 2015 ■ 7/9

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9

7

Fig. 5. Muscle breakdown and protein synthetic signaling. Western blot data for the ratio of (A) LC3BII to LC3BI, a marker of autophagosome number, eIF3f, a target of Atrogin-1 (B), and the phosphorylation status of members of the AKT/mTOR signaling pathway (CeG). Representative images of blots are shown in (H). Data are presented as means ± SEM (n ¼ 11/group). * denotes a significant difference (P < 0.05) from HFD.

gain during the 8 week of high-fat diet (r ¼ 0.86, P < 0.01) and body fat % after the 20 d CR period (r ¼ 0.94, P < 0.01). 4. Discussion Calorie restriction is a common lifestyle intervention effective in combating obesity and the associated risk of metabolic diseases. CR in the obese reduces visceral fat, insulin resistance and oxidative stress [19]. However, CR is also associated with the loss of fat free mass. Therefore, strategies that preserve skeletal muscle in states of negative energy balance are required. We hypothesized that glycine supplementation during a period of CR in HFD-induced obese mice would attenuate skeletal muscle wasting. We demonstrated that mice supplemented with glycine during CR had reduced adiposity (whole-body and epididymal fat mass) and a preservation of lean mass and muscle mass compared to alanine fed control mice. Therefore, results from our study indicate that glycine supplementation represents an effective nutritional intervention that improves the loss of fat mass and may spare skeletal muscle during CR. To test the efficacy of glycine during CR we first induced obesity in C57BL/6 mice by feeding them a HFD for eight weeks. In line with previously published work [20e22], eight weeks of a HFD resulted in significant weight gain, increased adiposity and impaired glucose tolerance. The extent of weight gain by the mice in our study is very similar to that in previous reports using a similar diet. Indeed, a 40% reduction in energy intake in obese mice rapidly reduces body weight and fat mass to that of control mice within 15 days [23]. Consistent with these observations we demonstrated that, in general, CR in HFD-induced obese mice reduced body weight by ~7 g and fat mass by 4e5 g within 20 days. These favorable changes in

body composition improved glucose tolerance, elevated mRNA expression of PPARs and reduced expression of inflammatory genes in skeletal muscle, indicative of improvements in insulin sensitivity and fatty acid metabolism and reduced inflammation. Enhanced Table 2 Percentage whole-body fat mass (measured using MRI) before CR correlates with the mRNA expression of genes involved in muscle inflammatory, breakdown and metabolism after CR. Gene

r

P value

Tnfa

0.56*

P ¼ 0.01

Ccl5

0.44*

P < 0.05

F4/80

0.68**

P ¼ 0.001

Ccl2

0.51*

P < 0.05

Atrogin

0.62**

P < 0.01

Lc3b

0.53*

P < 0.05

Bnip3

0.37

P ¼ 0.10

Foxo4

0.44*

P < 0.05

Foxo1

0.66**

P < 0.01

Atf4

0.59**

P < 0.01

Myonectin

0.47*

P < 0.05

P21

0.50*

P < 0.05

Ppard

0.48*

P < 0.05

Inflammatory

Muscle breakdown

Dietary stress & metabolism

Pearsons r and the associated p value are presented for each correlation; *P < 0.05, **P < 0.01.

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YCLNU2648_proof ■ 25 September 2015 ■ 8/9

8

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9

insulin sensitivity following CR has been demonstrated for mice [24] and humans [25], with pronounced improvements for insulinstimulated glucose uptake in skeletal muscle [26]. In addition, increased free fatty acid oxidation and reduced inflammation further improve insulin-mediated glucose uptake and glucose handling in obese mice, obese humans and patients with type 2 diabetes. As we have previously shown that glycine supplementation can reduce cancer-induced inflammation we hypothesized that glycine treatment would further enhance metabolism. We did not observe further improvements in glucose tolerance, which seems to contradict previous observations in diabetic rats [27]. However, we did observe positive effects of glycine supplementation on adipose tissue. Glycine treated mice lost a greater amount of fat mass during the initial 10 days of CR and had significantly less epididymal fat mass at the end of the CR period compared with alanine treated mice. Our results are consistent with work suggesting that glycine may have therapeutic applications for weight loss. Previous reports have shown that glycine intake reduced adipose cell size in sucrose-fed obese rats [28] and improved insulin resistance in glutamate fed obese mice [29]. Also in cultured adipocytes, glycine administration modulates the expression of metabolic and inflammatory adipokines; Adiponectin, Resistin, Il-6 and Tnfa [30]. In the present study we measured mRNA expression of factors involved in metabolism and inflammation in skeletal muscle after 20 days of CR and in contrast to our previous observations in cancer cachexia [31], we did not observe substantial differences in mRNA expression of genes involved in inflammation and metabolism. However, as glycine enhanced fat loss primarily in the first 10 days of CR in our study it is not surprising that gene expression in skeletal muscle was not different between glycine and alanine treated mice at the end of the CR period. Further studies are warranted to determine how glycine enhances the loss of adipose tissue during CR. A well-documented side effect of drastic reductions in food intake is a loss of lean mass, which in extreme cases can account for up to 50% of total body weight loss [6]. Similarly, our CR protocol caused a significant loss of muscle mass compared to high-fat fed mice. We observed strong correlations between body fat percentage immediately prior to the CR period and the composition of body mass (i.e. fat and lean) lost during CR. Strikingly, animals within the top 25% of starting % fat mass lost more than double the amount of body mass as fat during CR compared to those that started CR in the bottom 25%. This is consistent with the negative correlations we observed between body fat percentage immediately prior to the CR period and mRNA expression of genes involved in protein breakdown, dietary stress and metabolism. We accounted for this large source of variation using an ANCOVA with starting body fat % as a covariate. A more definitive conclusion regarding the effectiveness of glycine to increase fat loss and attenuate muscle loss could be made by only including mice that gained substantial fat mass during the HFD (high-responders). However, this would require even higher animal numbers than the already high number used in this study. Nevertheless, using our well validated statistical approach [18], we show a consistent positive effect of glycine supplementation across the full range of starting fat mass (Figs. 2B and 3B). Based on our previous observations in cancer cachexia, we hypothesized that glycine treatment during CR would reduce muscle wasting. Indeed in the present study we found that glycine treated mice lost a smaller proportion of body mass as lean mass during the first 10 days of CR and had modestly larger quadriceps muscles at the end of CR than alanine treated mice. The mechanism by which glycine exerts its protective effects on skeletal muscle during CR is not clear but it is likely to include reduced inflammatory cell activation and subsequent production of cytokines and free radicals

[15], particularly during the initial period of CR. Our observation that the expression of pro-inflammatory genes was not different between glycine and alanine treated mice after 20 days of CR, suggests that changes in mRNA expression may have occurred earlier (i.e. during the first 10 days of CR) or that glycine exerts its effects via other, as yet unidentified signaling pathways. The reductions in fat free mass that occur during CR may be due to a suppression of protein synthetic machinery and an upregulation of catabolic signaling pathways [32]. We tested whether glycine supplementation modulated the Akt/mTOR signaling pathway since glycine can stimulate mTOR signaling via its receptor [33]. While there was a significant reduction in ribosomal S6 phosphorylation during CR compared with HFD, we did not detect any differences in the phosphorylation status of Akt, mTOR, S6 or 4EBP1 between ALA and GLY groups. Similarly, we did not detect differences in the expression of genes associated with muscle protein breakdown or any other factor that could explain the protective effect of glycine supplementation on skeletal muscle during CR. Since MRI measures of body composition showed that the increase in fat loss and attenuated loss of lean mass occurred within the first 10 d of treatment, it is likely that any alteration in signaling was no longer detectable after 20 d of CR. In the present study, we demonstrated that mice supplemented with glycine during CR had reduced adiposity (whole-body and epididymal fat mass) with a preservation of lean and muscle mass compared to alanine fed control mice. Thus, glycine supplementation represents an effective nutritional intervention that improves the loss of fat mass and may spare skeletal muscle during CR. Author contributions MKC: conception and design of the study; acquisition of data, analysis and interpretation; drafting and revising of the manuscript; DJH: conception and design of the study; acquisition of data, analysis and interpretation; drafting and revising of the manuscript; DPG: acquisition of data, analysis and interpretation; drafting and revising of the manuscript; AC: acquisition of data, analysis and interpretation; GSL: drafting and revising of the manuscript; RK: conception and design of the study; analysis and interpretation, drafting, revising and final approval of the manuscript. Funding disclosure MKC was supported by a Research Fellowship from The European Society for Clinical Nutrition and Metabolism (ESPEN) and a McKenzie Research Fellowship from The University of Melbourne. DJH is supported by a Research Fellowship from ESPEN. Conflict of interest MK Caldow, DJ Ham, DP Godeassi, A Chee, GS Lynch, and R Koopman, no conflicts of interest. References [1] Hawley JA, Holloszy JO. Exercise: it's the real thing! Nutr Rev 2009;67(3): 172e8. [2] Dixon JB, O'Brien PE. Changes in comorbidities and improvements in quality of life after LAP-BAND placement. Am J Surg 2002;184(6B):51Se4S. [3] Mercken EM, Carboneau BA, Krzysik-Walker SM, de Cabo R. Of mice and men: the benefits of caloric restriction, exercise, and mimetics. Ageing Res Rev 2012;11(3):390e8. [4] Weinheimer EM, Sands LP, Campbell WW. A systematic review of the separate and combined effects of energy restriction and exercise on fat-free mass in middle-aged and older adults: implications for sarcopenic obesity. Nutr Rev 2010;68(7):375e88.

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

Q3

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39

YCLNU2648_proof ■ 25 September 2015 ■ 9/9

M.K. Caldow et al. / Clinical Nutrition xxx (2015) 1e9 [5] Ballor DL, Katch VL, Becque MD, Marks CR. Resistance weight training during caloric restriction enhances lean body weight maintenance. Am J Clin Nutr 1988;47(1):19e25. [6] Mazzali G, Di Francesco V, Zoico E, Fantin F, Zamboni G, Benati C, et al. Interrelations between fat distribution, muscle lipid content, adipocytokines, and insulin resistance: effect of moderate weight loss in older women. Am J Clin Nutr 2006;84(5):1193e9. [7] Wolfe RR. The underappreciated role of muscle in health and disease. Am J Clin Nutr 2006;84(3):475e82. [8] Leidy HJ, Carnell NS, Mattes RD, Campbell WW. Higher protein intake preserves lean mass and satiety with weight loss in pre-obese and obese women. Obes (Silver Spring) 2007;15(2):421e9. [9] Josse AR, Atkinson SA, Tarnopolsky MA, Phillips SM. Increased consumption of dairy foods and protein during diet- and exercise-induced weight loss promotes fat mass loss and lean mass gain in overweight and obese premenopausal women. J Nutr 2011;141(9):1626e34. [10] Mojtahedi MC, Thorpe MP, Karampinos DC, Johnson CL, Layman DK, Georgiadis JG, et al. The effects of a higher protein intake during energy restriction on changes in body composition and physical function in older women. J Gerontol A Biol Sci Med Sci 2011;66(11):1218e25. [11] Layman DK, Boileau RA, Erickson DJ, Painter JE, Shiue H, Sather C, et al. A reduced ratio of dietary carbohydrate to protein improves body composition and blood lipid profiles during weight loss in adult women. J Nutr 2003;133(2):411e7. [12] Westerterp-Plantenga MS, Lejeune MP, Nijs I, van Ooijen M, Kovacs EM. High protein intake sustains weight maintenance after body weight loss in humans. Int J Obes Relat Metab Disord 2004;28(1):57e64. [13] Pennings B, Groen B, de Lange A, Gijsen AP, Zorenc AH, Senden JM, et al. Amino acid absorption and subsequent muscle protein accretion following graded intakes of whey protein in elderly men. Am J Physiol Endocrinol Metab 2012;302(8). p. E992-9. [14] Ventura G, Noirez P, Breuille D, Godin JP, Pinaud S, Cleroux M, et al. Effect of citrulline on muscle functions during moderate dietary restriction in healthy adult rats. Amino Acids 2013;45(5):1123e31. [15] Ham DJ, Murphy KT, Chee A, Lynch GS, Koopman R. Glycine administration attenuates skeletal muscle wasting in a mouse model of cancer cachexia. Clin Nutr 2014;33(3):448e58. [16] Brochmann Murray EJ, Beamer WG, Duarte ME, Behnam K, Grisanti MS, Murray SS. Effects of dietary restriction on appendicular bone in the SENCAR mouse. Metabolism 2001;50(4):436e42. [17] Stapleton DI, Lau X, Flores M, Trieu J, Gehrig SM, Chee A, et al. Dysfunctional muscle and liver glycogen metabolism in mdx dystrophic mice. PLoS One 2014;9(3). p. e91514. [18] Assmann SF, Pocock SJ, Enos LE, Kasten LE. Subgroup analysis and other (mis) uses of baseline data in clinical trials. Lancet 2000;355(9209):1064e9. [19] Fontana L. Calorie restriction and cardiometabolic health. Eur J Cardiovasc Prev Rehabil 2008;15(1):3e9.

9

[20] Montgomery MK, Hallahan NL, Brown SH, Liu M, Mitchell TW, Cooney GJ, et al. Mouse strain-dependent variation in obesity and glucose homeostasis in response to high-fat feeding. Diabetologia 2013;56(5):1129e39. [21] Turner N, Kowalski GM, Leslie SJ, Risis S, Yang C, Lee-Young RS, et al. Distinct patterns of tissue-specific lipid accumulation during the induction of insulin resistance in mice by high-fat feeding. Diabetologia 2013;56(7):1638e48. [22] Williams LM, Campbell FM, Drew JE, Koch C, Hoggard N, Rees WD, et al. The development of diet-induced obesity and glucose intolerance in C57BL/6 mice on a high-fat diet consists of distinct phases. PLoS One 2014;9(8). p. e106159. [23] Briggs DI, Lockie SH, Wu Q, Lemus MB, Stark R, Andrews ZB. Calorie-restricted weight loss reverses high-fat diet-induced ghrelin resistance, which contributes to rebound weight gain in a ghrelin-dependent manner. Endocrinology 2013;154(2):709e17. [24] Gazdag AC, Dumke CL, Kahn CR, Cartee GD. Calorie restriction increases insulin-stimulated glucose transport in skeletal muscle from IRS-1 knockout mice. Diabetes 1999;48(10):1930e6. [25] Arciero PJ, Vukovich MD, Holloszy JO, Racette SB, Kohrt WM. Comparison of short-term diet and exercise on insulin action in individuals with abnormal glucose tolerance. J Appl Physiol (1985) 1999;86(6):1930e5. [26] Sharma N, Arias EB, Bhat AD, Sequea DA, Ho S, Croff KK, et al. Mechanisms for increased insulin-stimulated Akt phosphorylation and glucose uptake in fastand slow-twitch skeletal muscles of calorie-restricted rats. Am J Physiol Endocrinol Metab 2011;300(6). p. E966-78. [27] Alvarado-Vasquez N, Zamudio P, Ceron E, Vanda B, Zenteno E, CarvajalSandoval G. Effect of glycine in streptozotocin-induced diabetic rats. Comp Biochem Physiol C Toxicol Pharmacol 2003;134(4):521e7. [28] El Hafidi M, Perez I, Zamora J, Soto V, Carvajal-Sandoval G, Banos G. Glycine intake decreases plasma free fatty acids, adipose cell size, and blood pressure in sucrose-fed rats. Am J Physiol Regul Integr Comp Physiol 2004;287(6). p. R1387-93. [29] Alarcon-Aguilar FJ, Almanza-Perez J, Blancas G, Angeles S, Garcia-Macedo R, Roman R, et al. Glycine regulates the production of pro-inflammatory cytokines in lean and monosodium glutamate-obese mice. Eur J Pharmacol 2008;599(1e3):152e8. [30] Garcia-Macedo R, Sanchez-Munoz F, Almanza-Perez JC, Duran-Reyes G, Alarcon-Aguilar F, Cruz M. Glycine increases mRNA adiponectin and diminishes pro-inflammatory adipokines expression in 3T3-L1 cells. Eur J Pharmacol 2008;587(1e3):317e21. [31] Ham DJ, Caldow MK, Lynch GS, Koopman R. Arginine protects muscle cells from wasting in vitro in an mTORC1-dependent and NO-independent manner. Amino Acids 2014. Q4 [32] Mercken EM, Crosby SD, Lamming DW, JeBailey L, Krzysik-Walker S, Villareal DT, et al. Calorie restriction in humans inhibits the PI3K/AKT pathway and induces a younger transcription profile. Aging Cell 2013;12(4):645e51. [33] Sabatini DM, Barrow RK, Blackshaw S, Burnett PE, Lai MM, Field ME, et al. Interaction of RAFT1 with gephyrin required for rapamycin-sensitive signaling. Science 1999;284(5417):1161e4.

Please cite this article in press as: Caldow MK, et al., Glycine supplementation during calorie restriction accelerates fat loss and protects against further muscle loss in obese mice, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.08.013

40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78