- Email: [email protected]
Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule
Accepted Manuscript Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule Fang-fang Chen, Hai-bin Lin, Jin-chun Li, Yong Wang, Juan Li, Da-gan Zhang, Wei-yi Yu PII:
S1050-4648(17)30043-8
DOI:
10.1016/j.fsi.2017.01.030
Reference:
YFSIM 4407
To appear in:
Fish and Shellfish Immunology
Received Date: 26 September 2016 Revised Date:
22 December 2016
Accepted Date: 20 January 2017
Please cite this article as: Chen F-f, Lin H-b, Li J-c, Wang Y, Li J, Zhang D-g, Yu W-y, Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule, Fish and Shellfish Immunology (2017), doi: 10.1016/j.fsi.2017.01.030. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT
Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule Fang-fang Chen, Hai-bin Lin, Jin-chun Li, Yong Wang, Juan Li, Da-gan Zhang, Wei-yi Yu Key Laboratory of Zoonoses of Anhui Province, Anhui Agricultural University, Hefei Anhui,230036, China
RI PT
Corresponding author
AC C
EP
TE D
M AN U
SC
E-mail: [email protected]
ACCEPTED MANUSCRIPT 1 2 3 4 5
8
ABSTRACT
RI PT
7
Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule
6
The invariant chain (Ii) is an important immune molecule, as it assists major histocompatibility complex (MHC) class II molecules to present antigenic peptides. The relationship between the Ii and MHC molecules in teleosts remains poorly understood. This study focused on the molecular structure of grass carp Ii (gIi), its organ distribution, correlations with gene transcription, and the association with MHC. gIi cDNA was cloned using designed degenerate primers and the rapid amplification of cDNA ends method (RACE). The gIi sequence was 92%–96% similar to that of other teleosts, but only 52%–67% similar to that of mammals, respectively. The gIi gene was distributed in all 12 organs examined by PCR. The gIi gene transcription levels were markedly higher in organs enriched with immune cells than in other organs (P<0.01). Moreover, positive correlations were detected between transcription levels of the gIi and gMhcI or II genes in different organs (r = 8.415–8.523, P = 0.001). The gIi co-localized on endomembrane systems with either class I or II molecules in co-transfected cells observed by a laser confocal. Further testing confirmed that the gIi bound gMHCI and II molecules. Taken together, these results indicate that the gIi is associated with MHC class I and II molecules, suggesting homology of both MHC molecules.
22
Keywords: Grass carp, Invariant chain, MHC, Association, Co-localization
AC C
EP
TE D
M AN U
SC
9 10 11 12 13 14 15 16 17 18 19 20 21
1/9
ACCEPTED MANUSCRIPT 1. Introduction
24 25 26 27 28 29 30
The invariant chain (Ii) is a chaperone protein of major histocompatibility complex (MHC) class II molecules [1] that participates in molecular maturation and assembly [2]. The Ii also plays an important role presenting exogenous antigenic peptides [3]. The Ii-CLIP (class II-associated invariant chain peptide) occupies the groove in class II molecules and forms a trimer (αβIi) or nine polymers (αβIi)3 to avoid endogenous peptides [4,5]. The Ii also regulates migration of class II molecules in cells, transfers to the cellsurface [6,7,8], and affects molecules, such as cathepsin S [9] and myosin II [10], or acts as a chaperone for Toll-like receptors [11].
31 32 33 34 35 36 37 38 39 40 41
The mouse Ii binds either the α or β chain of class II molecules to form a dimer in vitro[12,13], whereas the quail Ii binds MHC class II molecules of other species [14]. Sugita and Brenner reported that human Ii associates with MHC class I molecules, and that the Ii/MHC I complex is reconstituted in Ii-negative cells [15]. Ii expression results in an increase in the number of cell surface human leukocyte antigen (HLA) class I molecules [16] and a vaccine-induced CD8+ T cell response [17]. An Ii-dependent MHC class I cross-presentation pathway was identified in dendritic cells based on the association between the Ii and MHC class I molecules. This pathway plays a major role in the generation of MHC class I-restricted, cytolytic T lymphocyte responses to viral protein- and cell-associated antigens [18]. Our previous study showed that chicken Ii binds B-F (class I) molecules in eukaryotic cells after their co-expression, presenting allele dependence [19]. This evidence was also confirmed by prokaryotic expression of both genes and in a pull-down assay to detect associated molecules [20].
42 43 44 45 46 47 48 49 50 51 52 53 54 55
The teleost Ii was first discovered in zebrafish (Danio rerio) [21], followed by rainbow trout (Oncorhynchus mykiss) [22], sea bass (Dicentrarchus labrax) [23], large yellow croaker (Pseudosciaena crocea) [24] and carp (Cyprinus carpio) [25]. The fish Ii is also expressed in immune cells [26] and is affected by several environmental factors [27]. The first classical teleost MHC sequence was reported in Atlantic salmon [28]. To date, the MHC genes have been isolated from more than 40 species of teleosts [29,30,31]. These gene sequences have been classified into various lineages using phylogenetic clustering [32]. The teleost MHC molecules have same structure with other vertebrates, briefly its class I and class II molecules are heterodimers of two polypeptide chains, α and β chains, in which Iβ and IIα chains are highly conserved, whereas the Iα and IIβ chains are highly polymorphic and localized in the peptide binding region domain [33,34,35]. However, the association between the teleost Ii and MHC class I or II molecules is unknown. Grass carp (Ctenopharyngodon idellus) is widely cultured in China. In the present study, the rapid amplification of cDNA ends (RACE) method was used to clone the grass carp Ii (gIi) gene, and eukaryotic expression and western blot assays were used to determine the relationship between the gIi and MHC molecules.
56
2. Materials and Methods
57
2.1 Materials
AC C
EP
TE D
M AN U
SC
RI PT
23
58 59
Anhui Province, China.
60
2.2 Cloning of the grass carp Ii gene
61 62 63 64
Two male and three female grass carps (about 2 kg, 2 years old) were obtained from fishing ground in
First total RNA was extracted from grass carp blood cells using the RNAiso plus (Takara, Dalian, China) following the manufacturer’s protocol. Then first-strand cDNA was synthesized from the RNA using a
reverse transcription-polymerase chain reaction (RT-PCR) kit (Takara, Dalian, China), according to the manufacturer’s instructions. Based on the highly conserved Ii sequences among teleosts (zebrafish, 2/9
ACCEPTED MANUSCRIPT CU468924.8; Cyprinuscarpio, AB098609; and D. rerio, BC065433.1), the gIi-d-f(164) and gIi-d-r(657) degenerate primers (Table 1and Fig. 1B) were used to amplify a segment of the gIi cDNA. PCR was carried out with Taq Mix (Takara) as follows: 1 min at 94ºC, 30 cycles of denaturation for 10 s at 98ºC, annealing for 30 s at 58ºC, extension for 1 min at 72ºC, and a final 6-min step at 72ºC. The PCR product was inserted into the pMD18-T vector (Takara). To obtain the 3′and 5′ends (Fig. 1B) of gIi cDNA, RACE was performed using the RACE core set ver. 2.0 (Takara) primers (Table 1), according to the manufacturer’s instructions. The PCR products were subcloned into the PMD18-T vector and sequenced. The complete gIi cDNA was amplified by PCR with the gIi-F-f and gIi-F-r(1116) primers (Table 1 and Fig. 1B), as follows: 1 min at 94ºC, 30 cycles of 1min at 98ºC, 45 s at 54ºC, 1 min at 72ºC, and a final 10 min step at 72ºC. All cloned genes were sequenced by Huada (Shanghai, China). A list of the primers used in this study is presented in Table 1.
76
2.3 qRT-PCR to detect gIi transcription levels in different organs
77 78 79 80 81 82 83 84 85 86 87
Quantitative RT-PCR was performed on an ABI 7300 Real-Time system (Applied Biosystems, Foster City, CA, USA). Gene-specific primers (Table 1) were designed using Primer Express 3.0 software (Applied Biosystems) to amplify the 90–107 bp PCR products. Each reaction contained 12.5µLof 2×SYBR Green premix Ex Taq™ II (Takara), 0.8 µg of diluted cDNA sample, and 0.8 M gene-specific primers in a final volume of 25 µL. The thermal cycling profile was as follows: 3 min at 94ºC, 40 cycles of 15 s at 94ºC, and 1 min at 60ºC. Measurements were carried out after the 60ºC extension phase. A melting curve was generated to determine primer specificity by increasing the temperature from 60 to 64ºC. Three technical replicates were performed for each gene. Blood gIi level was used as a reference for each reaction. Grass carp 18sRNA was used as an internal control. Relative transcription levels were calculated as 2-DDCt (DCT = CT, Target – CT, g18sRNA. DDCT = DCT, treatment –DCT, blood). The gIi relative blood transcription level (2-DDCt,blood) was defined as 1.
88
2.4 Cell culture, transfection and laser confocal microscopic observations
89 90 91 92 93 94 95 96 97 98 99
293T cells were grown at 37ºC in 5% CO2 and Dulbecco’s modified Eagle’s minimum essential medium (DMEM; Invitrogen, San Diego, CA, USA) with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). The 293T cells were seeded in a 24-well plate at a density of 104 cells/well and allowed to reach 80% confluence. All recombinant plasmids, such as pEGFP-C1-gIi, pmCherry-N1-gMhcIα, pmCherry-N1-gMhcIIβ and pEGFP-C1-F306 (peptide from the Newcastle disease virus fusion protein [36]) (Table 1), were freshly prepared before transfection, the complex plasmid suspensions (1µg/well) and Xfect (0.3µL /well) were mixed, and the medium in each well was exchanged for fresh serum-free DMEM. Complexes were added to wells with serum-free DMEM, and the cells were incubated with the complexes for 6 h. The medium was removed and replaced with complete medium. The cells were observed 24 h later using a confocal laser scanning microscope (FV1000; Olympus, Tokyo, Japan).
AC C
EP
TE D
M AN U
SC
RI PT
65 66 67 68 69 70 71 72 73 74 75
100
2.5 Immunoprecipitation
101 102 103 104 105 106 107
Immunoprecipitation was used to evaluate co-transfection of associated genes into 293T cells. The cells were seeded in 25-cm2 plates with the fusion genes (gIi/GFP and Myc/gMhcIα and gIi/GFP and Myc/gMhcIIβ. The cells were harvested 36 h post-transfection and lysed in 1 mL immunoprecipitation lysis buffer (50 mM Tris–HCl, 150 mM NaCl, 1% Nonidet P40, 0.5% sodium deoxycholate, and 1 protease inhibitor cocktail tablet) at 4ºC for 1 h. The cells were centrifuged at 12,000g and 4ºC for 1 h, 20 µL of Protein A/G Plus-Agarose beads (GE Healthcare, Piscataway, NJ, USA) was added to the supernatants, and the cells were incubate at 4ºC for 2 h. After centrifugation at 12,000g for 20 s at 4ºC, 2 µL anti-Myc 3/9
ACCEPTED MANUSCRIPT antibody (Zhongshan Golden Bridge Biotechnology, Beijing, China) was added to the supernatants and incubated for 2 h at 4ºC. The immune complexes were isolated using 50 µL Protein A/G Plus-Agarose beads over night at 4ºC. Centrifugation involved suspending the residue in 1 mL immunoprecipitation lysis buffer, buffer 2 (50 mM Tris-HCl, 500 mM NaCl, 0.1% Nonidet P40, and 0.05% sodium deoxycholate), and buffer 3 (50 mM Tris-HCl, 0.1% Nonidet P40, and 0.05% sodium deoxycholate) for 20 min and adding Protein A/G Plus-Agarose beads under the above conditions. After centrifugation at 12,000g for 20 s at 4ºC, the washed beads were further analyzed.
115
2.6 Western blot
116 117 118 119 120 121
The washed immune precipitates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride membrane (Millipore, Schwalbach, Germany). The blots were blocked with 10% (v/v) fetal calf serum for 1 h and probed for 1 h with a murine anti-GFP (Zhongshan Golden Bridge Biotechnology), followed by washing and incubation for 2 h with horseradish peroxidase-conjugated secondary goat anti-mouse IgG (Zhongshan Golden Bridge Biotechnology) and enhanced chemiluminescent detection reagents (Pierce, Rockford, IL, USA).
122
2.7 Statistics
123 124
Statistical analyses were performed using SDS software 1.3.1 (Applied Biosystems) using student's t test. All functional qRT-PCR assays were performed in triplicate. Significance was defined as P< 0.01.
125
3. Results
126
3.1. Cloning of the grass carp Ii cDNA
127 128 129 130 131 132 133 134
Based on known Ii gene sequences of other vertebrates, the degenerate primers (Table 1) were designed, and a 493 bp fragment was amplified from the cDNA obtained from grass carp spleen cell mRNA by RT-PCR (Fig. 1B and C, lane 5). Then, the 3′ and 5′ terminal fragments (542 and 703 bp) from RACE with new designed primers were obtained (Figs.1B and 2A, lanes 3 and 4). After analyzing the sequencing results, a pair of primers was designed, and the entire length of the gIi cDNA was amplified by PCR. The gIi cDNA was 1,116 bp (Fig. 2A, lane 1) and contained an open reading frame of 711 bp (Fig. 2A, lane 2) encoding 236 amino acids. We did not detect any others. The gIi cDNA sequence was deposited in the GenBank nucleotide sequence database with accession no. KM369885.
135
3.2 Characteristics of the grass carp Ii protein structure
136 137 138 139 140 141 142 143 144
Analysis of the grass carp Ii protein structure with those of other species (zebrafish, chicken, goose, human, and mouse) at the NCBI website (http://www.ncbi.nlm.nih.gov/Structure/cdd/ docs/cdd_search.html) showed that the gIi had cytosolic, transmembrane, luminal, and thyroid domains. Moreover, the isoform of different species were not identical in length, but their basic domain structures were highly similar (Fig. 2A). In particular, three or more residues and motifs located in the transmembrane domain were conserved between species and their helices were in the luminal domain (Fig. 2A). MEGA4.0 and GeneDoc software showed that the gIi was 92%–96% similar to other fish Iis, but only 52%–67% similar to mammals (Fig. 2B). These phylogenetic relationships reflect the divergence of Ii genes from common ancestral sequences.
145
3.gIi gene transcription levels are positively correlated with gMhcIα or gMhcIIβ
146 147
The Ii and MHC class I and II molecules are correlated immune factors. Transcription levels of the gli, gMhcIα, and gMhcIIβ genes were detected in different organs by qRT-PCR to determine their distribution
AC C
EP
TE D
M AN U
SC
RI PT
108 109 110 111 112 113 114
4/9
ACCEPTED MANUSCRIPT and relationships. The results showed that the genes were amplified in all of organs tested (Fig. 1A), and that the blood transcription level was lower than that in other organs, mesonephros, head kidney and (gIi and gMhcIIβ), spleen, and gills (gMhcIα) (P<0.01), which were enriched in immune cells, but higher than those in other organs (P<0.01) (Fig. 3B). Moreover, gIi transcription levels were positively correlated with those of gMhcIα (r = 8.42, P = 0.01) and gMhcIIβ (r = 8.53, P = 0.01).
153
3.4 Association between the gIi and gMHCIα or gMHCIIβ molecules in eukaryotic cells
154 155 156 157 158 159 160 161
Recombinant eukaryotic expression plasmids containing the gIi, gMhcIα, and gMhcIIβ genes (Table 1) were co-transfected into 293T cells to determine the association between gIi and gMHCIα or gMHCIIβ and their localization in eukaryotic cells. The results showed that the gIi co-localized with gMHCIα or gMHCIIβ in the cellular endomembrane system (Fig. 4A and B) because an orange color was observed in particular locations in co-transfected cells when the two target molecules were associated. No orange color was detected when there was no association, rather single green and red dots were observed in the same region in the control cells (gIi and F(306)) (Fig. 4C). This result indicates that the gIi associates with class I and II molecules.
162
3.5 Binding of the gIi with gMHCIIβ or gMHCIα molecules of eukaryotic expression
163 164 165 166 167 168 169 170 171 172 173 174
Immune co-precipitation and sequential western blot analyses were carried out to demonstrate binding of the gIi with gMHC molecules. The results showed that the gIi bound with gMHCIIβ and gMHCIα. The associated complexes in the immune co-precipitation, such as Myc/gMHCIα-GFP/gIi and Myc/gMHCIIβ-GFP/gIi, were collected by anti-Myc antibody, whereas the GFP/gIi in the complexes was dissociated by SDS-PAGE and recognized by a specific anti-GFP antibody on western blot (Fig. 5, lanes 1 and 2). As controls GFP was found in the cell lysis, in which GFP was co-expressed with Myc/gMHCIα or Myc/gMHCIIβ without treatment by anti Myc antibody (Fig. 5, lanes 3 and 4), but it was not found in the cell lysis, in which GFP was co-expressed with Myc/gMHCIα, Myc/gMHCIIβ or Myc and flowing treatment with anti-Myc antibody (Fig. 5, lanes 5, 6 and 7). The former (lanes 1-4) illustrated that GFP alone and as fusion protein were well expressed and recognized by specific antibody, and the latter excluded possible association between GFP and gMHCIα, gMHCIIβ or Myc. In short, the gIi could co-localize with gMHCIα or MHCIIβ in the endomembrane systems in eukaryotic cells.
175
4. Discussion
176 177 178 179 180 181 182 183 184 185 186 187 188 189 190
Teleosts, birds, and mammals have similar but distinctive adaptive and innate immune systems, and the immune tissues, organs, and molecules differ among them. Birds have the bursa of Fabricius, teleosts have a head kidney (Atlantic cod have lost the MHC II gene [25]), and mammals have sophisticated immunoglobulins. Additionally [37], some teleosts have two isoforms [38], as in birds, produced as a result of alternative splicing [37], but mammals have more than two isoforms [36,39]. However, similarities among them are also evident. The gIi sequence had 52%–67% similarity to birds and mammals, which demonstrates several points. First, the primary structures were highly similar, such as the main domains, key sites, and motifs of the gIi, and particularly the helix structures (Fig. 2A). Second, all Iis of birds [14], mammals [36, 40] and teleosts (Fig. 4) localize on the cellular endomembrane systems. Third, a strong correlation was detected between the Ii and MHC class II or I gene transcription levels (Fig.3), and the molecules were distributed mainly in organs rich in immune cells. Finally, the gIi and bird Ii co-localized and bound with class II molecules. Taken together, these results suggest that teleosts retained the basic immune structure of these molecules for resistance to pathogens. Moreover, the gIi also co-localized with class I molecules in co-transfected cells (Fig. 4), as reported in the chicken [38] and mouse [14,41], based on their binding (Fig. 5). The association between the Ii and
AC C
EP
TE D
M AN U
SC
RI PT
148 149 150 151 152
5/9
ACCEPTED MANUSCRIPT MHC class I molecules has rarely been reported; however, some immunoregulatory functions of the Ii have been reported more recently. The Ii quantitatively and qualitatively alters antigen presentation by increasing the number of cell surface HLA class I molecules and the proportion of unstable HLA class I molecules on the cell surface [16] and can up regulate the CD8+T cell response [17]. However, the Ii-CLIP binds to a wide variety of HLA-I molecules in leukemic cells [42]. The Ii actually participates in cross-presenting an antigen peptide mediated by a class I molecule [18]. Our previous study showed that mouse Ii co-localizes with MHC class I molecules and enhances secretion of particular cytokines by T cells in an Ii (vector)/T cell-restricted peptide [41]. We also reported that chicken Ii associates with class I molecules [19]. In the present study, we showed strong associations in the distribution (Fig. 3A), transcription levels (Fig. 3B), co-localization (Fig. 4), and binding of the grass carp Ii with the genes of class I molecules (Fig. 5). The high similarity in the relationships between the gIi and class I or II molecules reflects the evolution of these homogenous molecules to multipurpose complementary functions.
203
Acknowledgments
204 205
This study was financially supported by a grant from the National Natural Science Foundation of China, Beijing under award numbers 31572496; 31372417.
SC
RI PT
191 192 193 194 195 196 197 198 199 200 201 202
M AN U
206 References
208 209
[1] A. Jasanoff, G. Wagner, D.C. Wiley, Structure of a trimeric domain of the MHC class II-associated chaperonin and targeting protein Ii, EMBO J. 17 (1998) 6812-6818. DOI:10.1093/emboj/17.23.6812.
210 211
[2] M. Strubin, C. Berte, B. Mach, Alternative splicing and alternative initiation of translation explain the four forms of the Ia antigen-associated invariant chain, EMBO J. 5 (1986) 3483-3488.
212 213
[3] C. Gelin, I. Sloma, D. Charron, N. Mooney, Regulation of MHC II and CD1 antigen presentation: from ubiquity to security, J. Leukocyte Biol. 85 (2009) 215-224. DOI:10.1189/jlb.0308206.
214 215 216
[4] P. Romagnoli, R.N. Germain, The CLIP region of invariant chain plays a critical role in regulating major histocompatibility complex class II folding, transport, and peptide occupancy, J. Exp. Med. 180 (1994) 1107-1113.
217 218 219
[5] A.M. Dixon, B.J. Stanley, E.E. Matthews, J.P. Dawson, D.M. Engelman, Invariant chain transmembrane domain trimerization: a step in MHC class II assembly, Biochemistry 45 (2006) 5228-5234. DOI:10.1021/bi052112e
220 221 222 223 224
[6] P.A. Warmerdam, E.O. Long, P.A. Roche, Isoforms of the invariant chain regulate transport of MHC class II molecules to antigen processing compartments, J. Cell. Biol. 133 (1996) 281-291. [7] F.C. Sillé, C. Martin, P. Jayaraman, A. Rothchild, S. Fortune, Requirement for invariant chain in macrophages for Mycobacterium tuberculosis replication and CD1d antigen presentation, Infect Immun. 79 (2011) 3053-3063. DOI:10.1128/IAI.01108-10
225 226 227
[8] I. Karakikes, I.E. Morrison, P. O'Toole, G. Metodieva, C.V. Navarrete, Interaction of HLA-DR and CD74 at the cell surface of antigen-presenting cells by single particle image analysis, FASEB J. 26 (2012) 4886-4896. DOI:10.1128/IAI.01108-10
228 229 230
[9] Q. Li, J. Ao, Y. Mu, Z. Yang, T. Li, X. Zhang, X. Chen, Cathepsin S, but not cathepsin L, participates in the MHC class II-associated invariant chain processing in large yellow croaker (Larimichthyscrocea), Fish. Shellfish Immunol. 47 (2015) 743-750. DOI:10.1016/j.fsi.2015.10.009
231 232 233
[10] M. Chabaud, M.L. Heuzé, M. Bretou, P. Vargas, P. Maiuri, P. Solanes, M. Maurin et al. Cell migration and antigen capture are antagonistic processes coupled by myosin II in dendritic cells, Nat. Commun. 6 (2015) 7526. DOI:10.1038/ncomms8526
234 235
[11] M. Tohmé, B. Manoury, Invariant chain is a new chaperone for TLR7 in B cells, Mol. Immunol. 68 (2015) 102-105. DOI:10.1016/j.molimm.2015.06.012
AC C
EP
TE D
207
6/9
ACCEPTED MANUSCRIPT [12] L.S. Arneson, J. Miller, Efficient endosomal localization of major histocompatibility complex class II-invariant chain complexes requires multimerization of the invariant chain targeting sequence, J. Cell. Biol. 129 (1995) 1217-1228.
239 240
[13] P.A. Roche, P. Cresswell, Proteolysis of the class II-associated invariant chain generates a peptide binding site in intracellular HLA-DR molecules, J. Immunol. 187 (2011) 1076-1080.
241 242 243
[14] F.F. Chen, C. Wu, l. Pan, F.Z. Xu, X.L. Liu, W.Y. Yu, Cross-species association of quail invariant chain with chicken and mouse MHC II molecules, Dev. Comp. Immunol. 40 (2013) 20-27. DOI:10.1016/j.dci.2013.01.002
244 245
[15] M. Sugita, M.B. Brenner, Association of the invariant chain with major histocompatibility complex class I molecules directs trafficking to endocytic compartments, J. Biol. Chem. 270 (1995) 1443-1448.
246 247 248 249
[16] X. Lin, X. Wang, H.L. Capek, L.C. Simone, A. Tuli, C.R. Morris, A.J. Reber, J.C. Solheim, Effect of invariant chain on major histocompatibility complex class I molecule expression and stability on human breast tumor cell lines, Cancer Immunol. Immunother. 58 (2009) 729-736. DOI:10.1007/s00262-008-0595-1
250 251 252
[17] A.J. Spencer, M.G. Cottingham, J.A. Jenks, R.J. Longley, S. Capone, S. Colloca, A. Folqori, et al. Enhanced vaccine-induced CD8+ T cell responses to malaria antigen ME-TRAP by fusion to MHC class II invariant chain, PLoS One 9 (2014) e100538. DOI:10.1371/journal.pone.0100538
253 254
[18] G. Basha, K. Omilusik, A. Chavez-Steenbock, A.T. Reinicke, N. Lack, A CD74-dependent MHC class I endolysosomal cross-presentation pathway, Nat. Immunol. 13 (2012) 237-245. DOI:10.1038/ni.2225
255 256 257
[19] F.F. Chen, L. Pan, J.G. Zhang, X.H. Zhou, J. Li, W.Y. Yu, Allele-dependent association of chicken MHC class I molecules with the invariant chain, Vet. Immunol. Immunopathol. 160 (2014) 273-280. DOI:10.1016/j.vetimm.2014.05.013
258 259 260
[20] L.F. Luo, W.Y. Yu, F.F Chen, Characters of the location in cells and binding activity of chicken Ii and B-L gene expressed products, Chinese J. Immunol. 31 (2015) 879-83. DOI:10.3969/j.issn.1000-484X. 2015.07.003 (in Chinese)
261 262
[21] J.A. Yoder, R.N. Haire, G.W. Litman, Cloning of two zebrafish cDNAs that share domains with the MHC class II-associated invariant chain, Immunogenetics 50 (1999) 84-88.
263 264
[22] J.M. Dijkstra, I.K. Kiryu, B. llner, Y. Yoshiura, M. Ototake, MHC class II invariant chain homologues in rainbow trout (Oncorhynchusmykiss). Fish. Shellfish Immunol. 15 (2003) 91-105.
265 266 267 268 269 270 271
[23] D.S. Silva, M.I. Reis, D.S. Nascimento, A. do Val, P.J. Pereira, N.M. dos Santos, Sea bass (Dicentrarchuslabrax) invariant chain and class II major histocompatibility complex: sequencing and structural analysis using 3D homology modelling, Mol. Immunol. 44 (2007) 3758-3776. DOI:10.1016/j.molimm.2007.03.025 [24] W. Zheng, G. Liu, J. Ao, X. Chen, Expression analysis of immune-relevant genes in the spleen of large yellow croaker (Pseudosciaena crocea) stimulated with poly I:C. Fish Shellfish Immunol. 21 (2006) 414-430. DOI:10.1016/j.fsi.2006.01.006
272 273
[25] M. Sakai, T. Kono, R. Savan, Identification of expressed genes in carp (Cyprinuscarpio) head kidney cells after in vitro treatment with immunostimulants, Dev.Biol. (Basel) 121 (2005) 45-51.
274 275 276
[26] G. Lugo-Villarino, K.M. Balla, D.L. Stachura, K. Bañuelos, M.B Werneck, D. Traver,. Identification of dendritic antigen-presenting cells in the zebrafish, Proc. Natl. Acad. Sci. USA 107 (2010) 15850-15855. DOI:10.1073/pnas.1000494107
277 278 279 280
[27] I.A. Johnston, H.T. Lee, D.J. Macqueen, K. Paranthaman, C. Kawashima, A. Anwar, J.R. Kinghorn, T. Dalmay, Embryonic temperature affects muscle fibre recruitment in adult zebrafish: genome-wide changes in gene and microRNA expression associated with the transition from hyperplastic to hypertrophic growth phenotypes, J. Exp. Biol. 212 (2009) 1781-193. DOI:10.1242/jeb.029918
281 282 283
[28] U. Grimholt, I. Hordvik, V.M. Fosse, I. Olsaker, C. Endresen, O. Lie, Molecular cloning of major histocompatibility complex class I cDNAs from Atlantic salmon (Salmo salar). Immunogenetics 37 (1993) 469-473.
AC C
EP
TE D
M AN U
SC
RI PT
236 237 238
7/9
ACCEPTED MANUSCRIPT [29] H.R. Juul-Madsen, J. Glamann, H.O. Madsen, M. Simonsen, MHC class II betachain expression in the rainbow trout, Scand. J. Immunol. 35 (1992) 687-694. [30] D.S. Silva, M.I. Reis, D.S. Nascimento, A. do Vale, P. J. Pereira, N. M. dos Santos, Sea bass (Dicentrarchus labrax) invariant chain and class II major histocompatibility complex: sequencing and structural analysis using 3D homology modeling, Mol. Immunol. 44 (2007) 3758-3776. DOI:10.1016/j.molimm.2007.03.025 [31] K.L. Rakus, G.F. Wiegertjes, M. Adamek, V. Bekh, R.J. Stet, I. Irnazarow, Application of PCR-RF-SSCP to study major histocompatibility class IIB polymorphism in common carp (Cyprinus carpio L.), Fish Shellfish Immun. 24 (2008) 734-744. DOI:10.1016/j.fsi.2007.11.015 [32] U. Grimholt, MHC and Evolution in Teleosts. Biology (Basel) 5 (2016) pii: E6. DOI: 10.3390/biology5010006
295 296
[33] Y. Dai, F.F. Chen, X.L. Liu, X. Wang. cDNA cloning and antigen-binding sites of the MHC class I in Chinese native chicken (Qingyuan Partridge chicken), JFAE 8 (2010) 91-97.
297 298
[34] F.F. Chen, L. Pan, C. Wu, Y. Dai, W.Y. Yu, Character of chicken polymorphic MHC class II alleles of three Chinese local breeds, Poultry Sci. 91 (2012) 1097-1104. DOI:10.3382/ps.2011-02007
299 300 301
[35] A.S Mona, B. Crestanello, S. Bankhead-Dronnet, E. Pecchioli, S. Ingrosso, Disentangling the effects of recombination, selection, and demography on the genetic variation at a major histocompatibility complex class II gene in the alpine chamois, Mol. Ecol. 17 (2008) 4053-4067.
302 303 304
[36] F.F. Chen, F.T. Meng, L. Pan, F.Z. Xu, X.L. Liu, W.Y. Yu, Boosting immune response with the invariant chain segments via associating to non PBR of MHC II class molecule, BMC Immunol. 13 (2012) 55. DOI:10.1186/1471-2172-13-55
305 306 307
[37] D.L. Zhong, W.Y. Yu, Y.H. Liu, J. Liu, J.N. Li, Molecular cloning and expression of two chicken invariant chain isoforms produced by alternative splicing, Immunogenetics 56 (2004) 650-656. DOI:10.1007/s00251-004-0726-6
308 309 310
[38] M.F. Criscitiello, Y. Ohta, M.D. Graham, J.O. Eubanks, P.L. Chen, M.F. Flajnik, Shark class II invariant chain reveals ancient conserved relationships with cathepsins and MHC class II, Dev. Comp. Immunol. 36 (2012) 521-533. DOI:10.1016/j.dci.2011.09.008
311 312 313 314
[39] M. Cloutier, C. Gauthier, J.S. Fortin, L. Genève, K. Kim, S. Gruenheid, J. Kim, J. Thibodeau, ER egress of invariant chain isoform p35 requires direct binding to MHCII molecules and is inhibited by the NleA virulence factor of enterohaemorrhagic Escherichia coli, Hum. Immunol. 76 (2015) 292-296. DOI:10.1016/j.humimm.2015.02.002
315 316 317
[40] M. Cloutier, C. Gauthier, J.S. Fortin, J. Thibodeau, The invariant chain p35 isoform promotes formation of nonameric complexes with MHC II molecules, Immunol. Cell. Biol. 92 (2014) 553-556. DOI:10.1038/icb.2014.17
318 319 320 321 322 323 324
[41] C. Wu, D.G. Zhang, F.F. Chen, X.L. Liu, W.Y. Yu, The N-terminal functional region of the invariant chain efficiently targets a CTL epitope to MHC class I in cross-presentation, Genet. Mol. Res. 13 (2014) 2438-2450. DOI:10.4238/2014.April.3.16 [42] M.M. van Luijn, A.A. van de Loosdrecht, M.H. Lampen, P.A. van Veelen, A. Zevenbergen, M.G. Keste, A.H. de Ru, G.J. Ossenkoppele, et al. Promiscuous binding of invariant chain-derived CLIP peptide to distinct HLA-I molecules revealed in leukemic cells, PLoS One 7 (2012) e34649. DOI:10.1371/journal.pone.0034649.
325
Captions
326 327 328 329 330
Fig. 1. Schematic diagram of the structure of the grass carp invariant chain (gIi), the fragments amplified, and the polymerase chain reaction (PCR) primers used. (A) Entire gIi structure. Cyt, cytosolic domain; TM, transmembrane domain; Lum, luminal domain; CLIP, class II-associated invariant chain peptide; Tri, trimerization region; Thyr, thyroglobulin domain. (B) gIi gene fragments and primers used for the rapid amplification of cDNA ends method. Arrows and solid lines indicate the primer sites and amplified
AC C
EP
TE D
M AN U
SC
RI PT
284 285 286 287 288 289 290 291 292 293 294
8/9
ACCEPTED MANUSCRIPT fragments. (C) Amplified gIi and its fragments determined by PCR. M, DNA marker; 1, whole gIi; 2, 1–711bp fragment; 3, 313–1116bp; 4, 1–642bp; 5, 164–657bp.
333 334 335 336 337 338 339 340 341 342 343 344 345 346 347
Fig. 2. Comparison of the grass carp invariant chain (gIi) structure with that of other vertebrates. (A) Alignment of the predicted Ii translation products from grass carp and five other vertebrates. Sequence alignment was performed with Align software at the Clustal W network server (http://www.ebi.ac.uk/Tools/msa/). Residues within the cytosolic, transmembrane, luminal, and thyroglobulin domains are shaded; helices a–c are indicated by a single underline. Identical (asterisks) and similar (dots) amino acid residues are indicated. (B) Genetic relationships of the Ii sequences from 12 species in the phylogenetic tree. The tree was generated with the CLUSTAL software package (ver. 1.81) using a neighbor-joining algorithm and edited with MEGA 4.1 software. The tree was rooted using the midpoint method. Horizontal distances are proportional to the minimum number of nucleotide differences required to join nodes. The Ii sequences of the species were classified into different lineages, and the grass carp and sliver carp Iis belonged to the same lineage. Bar represents branch length, which is proportional to genetic distance. The Ii sequences of duck (AAX47310), goose (HM208131), pigeon (AAX47311), quail (AAX47311), chicken (AAT3634), mouse (NP_034675), cattle (NP_001029907), human (AAA36304), rainbow trout (AY081776), common carp (AB098609), zebrafish (CU468924.8), grass carp (KM369885), and sliver carp (JQ278011) were referenced from GenBank (https://www.ncbi.nlm.nih.gov/genbank/).
348 349 350 351 352 353 354 355 356
Fig. 3. Transcription levels of the grass carp invariant chain (gIi), grass carp major histocompatibility complex Iα (gMhcIα), and gMhcIIβ and genes in different organs. (A) Distribution of gIi, gMhcIα, and gMhcIIβ genes in different organs. Transcription product lengths were 132bp (gIi), 91bp (gMhcIα), 107 bp (gMhcIIβ), and 90bp (18 sRNA, endogenous control). (B) Relative gIi, gMhcIα, and gMhcIIβ gene transcription levels in different organs. Bars represents mean ± SD values obtained from experiments performed three times (technical replicates). 1, Blood cells; 2, liver; 3, spleen; 4, mesonephros; 5, head kidney; 6, heart; 7, brain; 8, skin; 9, gill; 10, intestines; 11, red muscle; 12, swim bladder. The t test showed statistical significance (P<0.01) between the blood cells and the other organs, except gill (gIi), heart, brain, intestines and red muscle (gMhcIα).
357 358 359 360 361 362 363 364
Fig. 4. Co-localization of the grass carp invariant chain (gIi) with grass carp major histocompatibility complex Iα (gMhcIα) and gMhcIIβ in 293T cells. The cells were transiently co-transfected (A) with pEGFP-C1-gIi expressing GFP/gIi and pmCherry-N1-gMhcIα expressing RFP/gMHCIα, (B) with pEGFP-C1-gIi and gMHCIIβ, or (C) with pEGFP-C1-gIi and pmCherry-N1-F(306) as controls. The cells were observed 24 h later under a confocal laser scanning microscope with a 60×oil objective. The molecules were visualized as green or red (C) respectively, and co-localization of the gIi with GFP/gIi-RFP/gMHCIα or RFP/gMHCIIβ was visualized in the transfected cells as a dispersed yellow-orange color in the merged image. Bar, 50µm.
365 366 367 368 369 370 371 372
Fig. 5. Binding of the grass carp invariant chain (gIi) with grass carp major histocompatibility complex Iα (gMhcIα) and gMhcIIβ detected on Western blot. 293T cells were co-transfected (1) with GFP/gIi and Myc/gMhcIα or (2) with GFP/gIi and Myc/gMhcIIβ. The cells were transfected (3) (5) with GFP and Myc/gMhcIα, (4) (6) GFP and Myc/gMhcIIβ, (7) GFP/gIi and Myc ( as control). The cells were lysed after 24 h and immunoprecipitated (IP) with the anti-Myc antibody (1) (2) (5) (6) (7). Subsequently, the immune complex and cell lysis (3) (4) as control were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and GFP was detected by western blot with anti-GFP antibody. The GFP/gIi fusion protein had a molecular weight of 53.7 kDa (molecular weight of GFP is 27kDa). +, done, -, not done.
AC C
EP
TE D
M AN U
SC
RI PT
331 332
373 9/9
ACCEPTED MANUSCRIPT Table 1 Primer sequences and recombinant plasmids Recombinant plasmids (Accession No. in GenBank ) Degenerate primer
name
Sequences(5'-3')
gIi-d-f(164) gIi-d-r(657)
5′ gacaggcgctgaccgcakaca 3′ 5′ gcagtayccsgkkctgtgcca 3′
gIi-5′R(542) gIi-3′F(413) gIi-F-f gIi-F-r(1116) gIi-F-r(711) gIi-q-f gIi-q-r
5′ tcacacagagcagtgatgga 3′ 5′ cccgaattcgatggacgagcatcaaaacg 3′ 5'ccgctcgagttactctgagccaca 3' 5'cccgaattcgatggacgagcatcaaa 3' 5'ccgctcgagttactctgagccaca 3' 5'gaagatctagatggacgagcatcaaa 3' 5'ccgctcgagttactctgagccaca 3'
In RACE
gIα-q-f gIα-q-r
5'cagagttcactgtggttggtc 3' 5'atccactctgtcttcggcac 3'
For gMhcIα in qRT-PCR
gIIβ-q-f gIIβ-q-r
5'acgacttctaccctcaaccaat 3' 5'gtagtaccagtctccgttaagca 3'
For gMhcIIβ in qRT-PCR
18sRNA-q-f 18sRNA-q-r
5'atttccgacacggagagg3' 5'catgggtttaggatacgctc 3'
gIi-f gIi-r
5' cccgaattcgatggacgagcatcaaaacg 3' 5'gcgtcgacttactctgagccacactg 3'
For pEGFP-C1-gIi (KM369885)
gIα-f gIα-r
5'cccgaattcacatgcgatctgtagtgc 3' 5'gcgtcgacacaacaggtttaaagcct 3'
For pmCherry-N1-gMhcIα (AB540144)
gIIβ-f gIIβ-r
5'cccgaattcacatgtctgtgttaaagc 3' 5'gcgtcgacacctacagacctgttgat 3'
For pmCherry-N1-gMhcIIβ (JF436931)
F306-f F306-r
5' ccgctcgagatatg ctcccaaatatgc 3' 5' gcgtcgacttcactca ataaataccaggag 3'
For pmCherry-N1-F306
gIi-IP-f gIi-IP-r
5'gaagatctagatggacgagcatcaaa 3' 5'ccgctcgagttactctgagccaca 3'
For pCMV-Myc-gIi (KM369885)
gIα-IP-f gIα-IP-r
5'gaagatctagatgcgatctgtagtgc 3' 5'ccgctcgagaacaggtttaaagcct 3'
For pCMV-Myc-gMhcIα (KM369885)
gIIβ-IP-f gIIβ-IP-r
5'gaagatctagatgtctgtgttaaag 3' 5'ccgctcgagctacagacctgttgat 3'
For pCMV-Myc-gMhcIIβ (JF436931)
RI PT
For full length gIi
SC
For gIi in qRT-PCR
AC C
EP
TE D
M AN U
For g18sRNA in qRT-PCR (EU047719)
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
ACCEPTED MANUSCRIPT Highlights • • •
AC C
EP
TE D
M AN U
SC
RI PT
•
The grass carp Ii (gIi) cDNA was cloned using designed degenerate primers and the rapid amplification of cDNA ends method (RACE). The gIi gene transcription levels are positively correlated with gMhcIα or gMhcIIβ. The gIi associates gMHCIα or gMHCIIβ molecules in eukaryotic cells. The gIi binds with gMHCIIβ or gMHCIα molecules of prokaryotic expression.
S1050-4648(17)30043-8
DOI:
10.1016/j.fsi.2017.01.030
Reference:
YFSIM 4407
To appear in:
Fish and Shellfish Immunology
Received Date: 26 September 2016 Revised Date:
22 December 2016
Accepted Date: 20 January 2017
Please cite this article as: Chen F-f, Lin H-b, Li J-c, Wang Y, Li J, Zhang D-g, Yu W-y, Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule, Fish and Shellfish Immunology (2017), doi: 10.1016/j.fsi.2017.01.030. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT
Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule Fang-fang Chen, Hai-bin Lin, Jin-chun Li, Yong Wang, Juan Li, Da-gan Zhang, Wei-yi Yu Key Laboratory of Zoonoses of Anhui Province, Anhui Agricultural University, Hefei Anhui,230036, China
RI PT
Corresponding author
AC C
EP
TE D
M AN U
SC
E-mail: [email protected]
ACCEPTED MANUSCRIPT 1 2 3 4 5
8
ABSTRACT
RI PT
7
Grass carp (Ctenopharyngodon idellus) invariant chain of the MHC class II chaperone protein associates with the class I molecule
6
The invariant chain (Ii) is an important immune molecule, as it assists major histocompatibility complex (MHC) class II molecules to present antigenic peptides. The relationship between the Ii and MHC molecules in teleosts remains poorly understood. This study focused on the molecular structure of grass carp Ii (gIi), its organ distribution, correlations with gene transcription, and the association with MHC. gIi cDNA was cloned using designed degenerate primers and the rapid amplification of cDNA ends method (RACE). The gIi sequence was 92%–96% similar to that of other teleosts, but only 52%–67% similar to that of mammals, respectively. The gIi gene was distributed in all 12 organs examined by PCR. The gIi gene transcription levels were markedly higher in organs enriched with immune cells than in other organs (P<0.01). Moreover, positive correlations were detected between transcription levels of the gIi and gMhcI or II genes in different organs (r = 8.415–8.523, P = 0.001). The gIi co-localized on endomembrane systems with either class I or II molecules in co-transfected cells observed by a laser confocal. Further testing confirmed that the gIi bound gMHCI and II molecules. Taken together, these results indicate that the gIi is associated with MHC class I and II molecules, suggesting homology of both MHC molecules.
22
Keywords: Grass carp, Invariant chain, MHC, Association, Co-localization
AC C
EP
TE D
M AN U
SC
9 10 11 12 13 14 15 16 17 18 19 20 21
1/9
ACCEPTED MANUSCRIPT 1. Introduction
24 25 26 27 28 29 30
The invariant chain (Ii) is a chaperone protein of major histocompatibility complex (MHC) class II molecules [1] that participates in molecular maturation and assembly [2]. The Ii also plays an important role presenting exogenous antigenic peptides [3]. The Ii-CLIP (class II-associated invariant chain peptide) occupies the groove in class II molecules and forms a trimer (αβIi) or nine polymers (αβIi)3 to avoid endogenous peptides [4,5]. The Ii also regulates migration of class II molecules in cells, transfers to the cellsurface [6,7,8], and affects molecules, such as cathepsin S [9] and myosin II [10], or acts as a chaperone for Toll-like receptors [11].
31 32 33 34 35 36 37 38 39 40 41
The mouse Ii binds either the α or β chain of class II molecules to form a dimer in vitro[12,13], whereas the quail Ii binds MHC class II molecules of other species [14]. Sugita and Brenner reported that human Ii associates with MHC class I molecules, and that the Ii/MHC I complex is reconstituted in Ii-negative cells [15]. Ii expression results in an increase in the number of cell surface human leukocyte antigen (HLA) class I molecules [16] and a vaccine-induced CD8+ T cell response [17]. An Ii-dependent MHC class I cross-presentation pathway was identified in dendritic cells based on the association between the Ii and MHC class I molecules. This pathway plays a major role in the generation of MHC class I-restricted, cytolytic T lymphocyte responses to viral protein- and cell-associated antigens [18]. Our previous study showed that chicken Ii binds B-F (class I) molecules in eukaryotic cells after their co-expression, presenting allele dependence [19]. This evidence was also confirmed by prokaryotic expression of both genes and in a pull-down assay to detect associated molecules [20].
42 43 44 45 46 47 48 49 50 51 52 53 54 55
The teleost Ii was first discovered in zebrafish (Danio rerio) [21], followed by rainbow trout (Oncorhynchus mykiss) [22], sea bass (Dicentrarchus labrax) [23], large yellow croaker (Pseudosciaena crocea) [24] and carp (Cyprinus carpio) [25]. The fish Ii is also expressed in immune cells [26] and is affected by several environmental factors [27]. The first classical teleost MHC sequence was reported in Atlantic salmon [28]. To date, the MHC genes have been isolated from more than 40 species of teleosts [29,30,31]. These gene sequences have been classified into various lineages using phylogenetic clustering [32]. The teleost MHC molecules have same structure with other vertebrates, briefly its class I and class II molecules are heterodimers of two polypeptide chains, α and β chains, in which Iβ and IIα chains are highly conserved, whereas the Iα and IIβ chains are highly polymorphic and localized in the peptide binding region domain [33,34,35]. However, the association between the teleost Ii and MHC class I or II molecules is unknown. Grass carp (Ctenopharyngodon idellus) is widely cultured in China. In the present study, the rapid amplification of cDNA ends (RACE) method was used to clone the grass carp Ii (gIi) gene, and eukaryotic expression and western blot assays were used to determine the relationship between the gIi and MHC molecules.
56
2. Materials and Methods
57
2.1 Materials
AC C
EP
TE D
M AN U
SC
RI PT
23
58 59
Anhui Province, China.
60
2.2 Cloning of the grass carp Ii gene
61 62 63 64
Two male and three female grass carps (about 2 kg, 2 years old) were obtained from fishing ground in
First total RNA was extracted from grass carp blood cells using the RNAiso plus (Takara, Dalian, China) following the manufacturer’s protocol. Then first-strand cDNA was synthesized from the RNA using a
reverse transcription-polymerase chain reaction (RT-PCR) kit (Takara, Dalian, China), according to the manufacturer’s instructions. Based on the highly conserved Ii sequences among teleosts (zebrafish, 2/9
ACCEPTED MANUSCRIPT CU468924.8; Cyprinuscarpio, AB098609; and D. rerio, BC065433.1), the gIi-d-f(164) and gIi-d-r(657) degenerate primers (Table 1and Fig. 1B) were used to amplify a segment of the gIi cDNA. PCR was carried out with Taq Mix (Takara) as follows: 1 min at 94ºC, 30 cycles of denaturation for 10 s at 98ºC, annealing for 30 s at 58ºC, extension for 1 min at 72ºC, and a final 6-min step at 72ºC. The PCR product was inserted into the pMD18-T vector (Takara). To obtain the 3′and 5′ends (Fig. 1B) of gIi cDNA, RACE was performed using the RACE core set ver. 2.0 (Takara) primers (Table 1), according to the manufacturer’s instructions. The PCR products were subcloned into the PMD18-T vector and sequenced. The complete gIi cDNA was amplified by PCR with the gIi-F-f and gIi-F-r(1116) primers (Table 1 and Fig. 1B), as follows: 1 min at 94ºC, 30 cycles of 1min at 98ºC, 45 s at 54ºC, 1 min at 72ºC, and a final 10 min step at 72ºC. All cloned genes were sequenced by Huada (Shanghai, China). A list of the primers used in this study is presented in Table 1.
76
2.3 qRT-PCR to detect gIi transcription levels in different organs
77 78 79 80 81 82 83 84 85 86 87
Quantitative RT-PCR was performed on an ABI 7300 Real-Time system (Applied Biosystems, Foster City, CA, USA). Gene-specific primers (Table 1) were designed using Primer Express 3.0 software (Applied Biosystems) to amplify the 90–107 bp PCR products. Each reaction contained 12.5µLof 2×SYBR Green premix Ex Taq™ II (Takara), 0.8 µg of diluted cDNA sample, and 0.8 M gene-specific primers in a final volume of 25 µL. The thermal cycling profile was as follows: 3 min at 94ºC, 40 cycles of 15 s at 94ºC, and 1 min at 60ºC. Measurements were carried out after the 60ºC extension phase. A melting curve was generated to determine primer specificity by increasing the temperature from 60 to 64ºC. Three technical replicates were performed for each gene. Blood gIi level was used as a reference for each reaction. Grass carp 18sRNA was used as an internal control. Relative transcription levels were calculated as 2-DDCt (DCT = CT, Target – CT, g18sRNA. DDCT = DCT, treatment –DCT, blood). The gIi relative blood transcription level (2-DDCt,blood) was defined as 1.
88
2.4 Cell culture, transfection and laser confocal microscopic observations
89 90 91 92 93 94 95 96 97 98 99
293T cells were grown at 37ºC in 5% CO2 and Dulbecco’s modified Eagle’s minimum essential medium (DMEM; Invitrogen, San Diego, CA, USA) with 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). The 293T cells were seeded in a 24-well plate at a density of 104 cells/well and allowed to reach 80% confluence. All recombinant plasmids, such as pEGFP-C1-gIi, pmCherry-N1-gMhcIα, pmCherry-N1-gMhcIIβ and pEGFP-C1-F306 (peptide from the Newcastle disease virus fusion protein [36]) (Table 1), were freshly prepared before transfection, the complex plasmid suspensions (1µg/well) and Xfect (0.3µL /well) were mixed, and the medium in each well was exchanged for fresh serum-free DMEM. Complexes were added to wells with serum-free DMEM, and the cells were incubated with the complexes for 6 h. The medium was removed and replaced with complete medium. The cells were observed 24 h later using a confocal laser scanning microscope (FV1000; Olympus, Tokyo, Japan).
AC C
EP
TE D
M AN U
SC
RI PT
65 66 67 68 69 70 71 72 73 74 75
100
2.5 Immunoprecipitation
101 102 103 104 105 106 107
Immunoprecipitation was used to evaluate co-transfection of associated genes into 293T cells. The cells were seeded in 25-cm2 plates with the fusion genes (gIi/GFP and Myc/gMhcIα and gIi/GFP and Myc/gMhcIIβ. The cells were harvested 36 h post-transfection and lysed in 1 mL immunoprecipitation lysis buffer (50 mM Tris–HCl, 150 mM NaCl, 1% Nonidet P40, 0.5% sodium deoxycholate, and 1 protease inhibitor cocktail tablet) at 4ºC for 1 h. The cells were centrifuged at 12,000g and 4ºC for 1 h, 20 µL of Protein A/G Plus-Agarose beads (GE Healthcare, Piscataway, NJ, USA) was added to the supernatants, and the cells were incubate at 4ºC for 2 h. After centrifugation at 12,000g for 20 s at 4ºC, 2 µL anti-Myc 3/9
ACCEPTED MANUSCRIPT antibody (Zhongshan Golden Bridge Biotechnology, Beijing, China) was added to the supernatants and incubated for 2 h at 4ºC. The immune complexes were isolated using 50 µL Protein A/G Plus-Agarose beads over night at 4ºC. Centrifugation involved suspending the residue in 1 mL immunoprecipitation lysis buffer, buffer 2 (50 mM Tris-HCl, 500 mM NaCl, 0.1% Nonidet P40, and 0.05% sodium deoxycholate), and buffer 3 (50 mM Tris-HCl, 0.1% Nonidet P40, and 0.05% sodium deoxycholate) for 20 min and adding Protein A/G Plus-Agarose beads under the above conditions. After centrifugation at 12,000g for 20 s at 4ºC, the washed beads were further analyzed.
115
2.6 Western blot
116 117 118 119 120 121
The washed immune precipitates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride membrane (Millipore, Schwalbach, Germany). The blots were blocked with 10% (v/v) fetal calf serum for 1 h and probed for 1 h with a murine anti-GFP (Zhongshan Golden Bridge Biotechnology), followed by washing and incubation for 2 h with horseradish peroxidase-conjugated secondary goat anti-mouse IgG (Zhongshan Golden Bridge Biotechnology) and enhanced chemiluminescent detection reagents (Pierce, Rockford, IL, USA).
122
2.7 Statistics
123 124
Statistical analyses were performed using SDS software 1.3.1 (Applied Biosystems) using student's t test. All functional qRT-PCR assays were performed in triplicate. Significance was defined as P< 0.01.
125
3. Results
126
3.1. Cloning of the grass carp Ii cDNA
127 128 129 130 131 132 133 134
Based on known Ii gene sequences of other vertebrates, the degenerate primers (Table 1) were designed, and a 493 bp fragment was amplified from the cDNA obtained from grass carp spleen cell mRNA by RT-PCR (Fig. 1B and C, lane 5). Then, the 3′ and 5′ terminal fragments (542 and 703 bp) from RACE with new designed primers were obtained (Figs.1B and 2A, lanes 3 and 4). After analyzing the sequencing results, a pair of primers was designed, and the entire length of the gIi cDNA was amplified by PCR. The gIi cDNA was 1,116 bp (Fig. 2A, lane 1) and contained an open reading frame of 711 bp (Fig. 2A, lane 2) encoding 236 amino acids. We did not detect any others. The gIi cDNA sequence was deposited in the GenBank nucleotide sequence database with accession no. KM369885.
135
3.2 Characteristics of the grass carp Ii protein structure
136 137 138 139 140 141 142 143 144
Analysis of the grass carp Ii protein structure with those of other species (zebrafish, chicken, goose, human, and mouse) at the NCBI website (http://www.ncbi.nlm.nih.gov/Structure/cdd/ docs/cdd_search.html) showed that the gIi had cytosolic, transmembrane, luminal, and thyroid domains. Moreover, the isoform of different species were not identical in length, but their basic domain structures were highly similar (Fig. 2A). In particular, three or more residues and motifs located in the transmembrane domain were conserved between species and their helices were in the luminal domain (Fig. 2A). MEGA4.0 and GeneDoc software showed that the gIi was 92%–96% similar to other fish Iis, but only 52%–67% similar to mammals (Fig. 2B). These phylogenetic relationships reflect the divergence of Ii genes from common ancestral sequences.
145
3.gIi gene transcription levels are positively correlated with gMhcIα or gMhcIIβ
146 147
The Ii and MHC class I and II molecules are correlated immune factors. Transcription levels of the gli, gMhcIα, and gMhcIIβ genes were detected in different organs by qRT-PCR to determine their distribution
AC C
EP
TE D
M AN U
SC
RI PT
108 109 110 111 112 113 114
4/9
ACCEPTED MANUSCRIPT and relationships. The results showed that the genes were amplified in all of organs tested (Fig. 1A), and that the blood transcription level was lower than that in other organs, mesonephros, head kidney and (gIi and gMhcIIβ), spleen, and gills (gMhcIα) (P<0.01), which were enriched in immune cells, but higher than those in other organs (P<0.01) (Fig. 3B). Moreover, gIi transcription levels were positively correlated with those of gMhcIα (r = 8.42, P = 0.01) and gMhcIIβ (r = 8.53, P = 0.01).
153
3.4 Association between the gIi and gMHCIα or gMHCIIβ molecules in eukaryotic cells
154 155 156 157 158 159 160 161
Recombinant eukaryotic expression plasmids containing the gIi, gMhcIα, and gMhcIIβ genes (Table 1) were co-transfected into 293T cells to determine the association between gIi and gMHCIα or gMHCIIβ and their localization in eukaryotic cells. The results showed that the gIi co-localized with gMHCIα or gMHCIIβ in the cellular endomembrane system (Fig. 4A and B) because an orange color was observed in particular locations in co-transfected cells when the two target molecules were associated. No orange color was detected when there was no association, rather single green and red dots were observed in the same region in the control cells (gIi and F(306)) (Fig. 4C). This result indicates that the gIi associates with class I and II molecules.
162
3.5 Binding of the gIi with gMHCIIβ or gMHCIα molecules of eukaryotic expression
163 164 165 166 167 168 169 170 171 172 173 174
Immune co-precipitation and sequential western blot analyses were carried out to demonstrate binding of the gIi with gMHC molecules. The results showed that the gIi bound with gMHCIIβ and gMHCIα. The associated complexes in the immune co-precipitation, such as Myc/gMHCIα-GFP/gIi and Myc/gMHCIIβ-GFP/gIi, were collected by anti-Myc antibody, whereas the GFP/gIi in the complexes was dissociated by SDS-PAGE and recognized by a specific anti-GFP antibody on western blot (Fig. 5, lanes 1 and 2). As controls GFP was found in the cell lysis, in which GFP was co-expressed with Myc/gMHCIα or Myc/gMHCIIβ without treatment by anti Myc antibody (Fig. 5, lanes 3 and 4), but it was not found in the cell lysis, in which GFP was co-expressed with Myc/gMHCIα, Myc/gMHCIIβ or Myc and flowing treatment with anti-Myc antibody (Fig. 5, lanes 5, 6 and 7). The former (lanes 1-4) illustrated that GFP alone and as fusion protein were well expressed and recognized by specific antibody, and the latter excluded possible association between GFP and gMHCIα, gMHCIIβ or Myc. In short, the gIi could co-localize with gMHCIα or MHCIIβ in the endomembrane systems in eukaryotic cells.
175
4. Discussion
176 177 178 179 180 181 182 183 184 185 186 187 188 189 190
Teleosts, birds, and mammals have similar but distinctive adaptive and innate immune systems, and the immune tissues, organs, and molecules differ among them. Birds have the bursa of Fabricius, teleosts have a head kidney (Atlantic cod have lost the MHC II gene [25]), and mammals have sophisticated immunoglobulins. Additionally [37], some teleosts have two isoforms [38], as in birds, produced as a result of alternative splicing [37], but mammals have more than two isoforms [36,39]. However, similarities among them are also evident. The gIi sequence had 52%–67% similarity to birds and mammals, which demonstrates several points. First, the primary structures were highly similar, such as the main domains, key sites, and motifs of the gIi, and particularly the helix structures (Fig. 2A). Second, all Iis of birds [14], mammals [36, 40] and teleosts (Fig. 4) localize on the cellular endomembrane systems. Third, a strong correlation was detected between the Ii and MHC class II or I gene transcription levels (Fig.3), and the molecules were distributed mainly in organs rich in immune cells. Finally, the gIi and bird Ii co-localized and bound with class II molecules. Taken together, these results suggest that teleosts retained the basic immune structure of these molecules for resistance to pathogens. Moreover, the gIi also co-localized with class I molecules in co-transfected cells (Fig. 4), as reported in the chicken [38] and mouse [14,41], based on their binding (Fig. 5). The association between the Ii and
AC C
EP
TE D
M AN U
SC
RI PT
148 149 150 151 152
5/9
ACCEPTED MANUSCRIPT MHC class I molecules has rarely been reported; however, some immunoregulatory functions of the Ii have been reported more recently. The Ii quantitatively and qualitatively alters antigen presentation by increasing the number of cell surface HLA class I molecules and the proportion of unstable HLA class I molecules on the cell surface [16] and can up regulate the CD8+T cell response [17]. However, the Ii-CLIP binds to a wide variety of HLA-I molecules in leukemic cells [42]. The Ii actually participates in cross-presenting an antigen peptide mediated by a class I molecule [18]. Our previous study showed that mouse Ii co-localizes with MHC class I molecules and enhances secretion of particular cytokines by T cells in an Ii (vector)/T cell-restricted peptide [41]. We also reported that chicken Ii associates with class I molecules [19]. In the present study, we showed strong associations in the distribution (Fig. 3A), transcription levels (Fig. 3B), co-localization (Fig. 4), and binding of the grass carp Ii with the genes of class I molecules (Fig. 5). The high similarity in the relationships between the gIi and class I or II molecules reflects the evolution of these homogenous molecules to multipurpose complementary functions.
203
Acknowledgments
204 205
This study was financially supported by a grant from the National Natural Science Foundation of China, Beijing under award numbers 31572496; 31372417.
SC
RI PT
191 192 193 194 195 196 197 198 199 200 201 202
M AN U
206 References
208 209
[1] A. Jasanoff, G. Wagner, D.C. Wiley, Structure of a trimeric domain of the MHC class II-associated chaperonin and targeting protein Ii, EMBO J. 17 (1998) 6812-6818. DOI:10.1093/emboj/17.23.6812.
210 211
[2] M. Strubin, C. Berte, B. Mach, Alternative splicing and alternative initiation of translation explain the four forms of the Ia antigen-associated invariant chain, EMBO J. 5 (1986) 3483-3488.
212 213
[3] C. Gelin, I. Sloma, D. Charron, N. Mooney, Regulation of MHC II and CD1 antigen presentation: from ubiquity to security, J. Leukocyte Biol. 85 (2009) 215-224. DOI:10.1189/jlb.0308206.
214 215 216
[4] P. Romagnoli, R.N. Germain, The CLIP region of invariant chain plays a critical role in regulating major histocompatibility complex class II folding, transport, and peptide occupancy, J. Exp. Med. 180 (1994) 1107-1113.
217 218 219
[5] A.M. Dixon, B.J. Stanley, E.E. Matthews, J.P. Dawson, D.M. Engelman, Invariant chain transmembrane domain trimerization: a step in MHC class II assembly, Biochemistry 45 (2006) 5228-5234. DOI:10.1021/bi052112e
220 221 222 223 224
[6] P.A. Warmerdam, E.O. Long, P.A. Roche, Isoforms of the invariant chain regulate transport of MHC class II molecules to antigen processing compartments, J. Cell. Biol. 133 (1996) 281-291. [7] F.C. Sillé, C. Martin, P. Jayaraman, A. Rothchild, S. Fortune, Requirement for invariant chain in macrophages for Mycobacterium tuberculosis replication and CD1d antigen presentation, Infect Immun. 79 (2011) 3053-3063. DOI:10.1128/IAI.01108-10
225 226 227
[8] I. Karakikes, I.E. Morrison, P. O'Toole, G. Metodieva, C.V. Navarrete, Interaction of HLA-DR and CD74 at the cell surface of antigen-presenting cells by single particle image analysis, FASEB J. 26 (2012) 4886-4896. DOI:10.1128/IAI.01108-10
228 229 230
[9] Q. Li, J. Ao, Y. Mu, Z. Yang, T. Li, X. Zhang, X. Chen, Cathepsin S, but not cathepsin L, participates in the MHC class II-associated invariant chain processing in large yellow croaker (Larimichthyscrocea), Fish. Shellfish Immunol. 47 (2015) 743-750. DOI:10.1016/j.fsi.2015.10.009
231 232 233
[10] M. Chabaud, M.L. Heuzé, M. Bretou, P. Vargas, P. Maiuri, P. Solanes, M. Maurin et al. Cell migration and antigen capture are antagonistic processes coupled by myosin II in dendritic cells, Nat. Commun. 6 (2015) 7526. DOI:10.1038/ncomms8526
234 235
[11] M. Tohmé, B. Manoury, Invariant chain is a new chaperone for TLR7 in B cells, Mol. Immunol. 68 (2015) 102-105. DOI:10.1016/j.molimm.2015.06.012
AC C
EP
TE D
207
6/9
ACCEPTED MANUSCRIPT [12] L.S. Arneson, J. Miller, Efficient endosomal localization of major histocompatibility complex class II-invariant chain complexes requires multimerization of the invariant chain targeting sequence, J. Cell. Biol. 129 (1995) 1217-1228.
239 240
[13] P.A. Roche, P. Cresswell, Proteolysis of the class II-associated invariant chain generates a peptide binding site in intracellular HLA-DR molecules, J. Immunol. 187 (2011) 1076-1080.
241 242 243
[14] F.F. Chen, C. Wu, l. Pan, F.Z. Xu, X.L. Liu, W.Y. Yu, Cross-species association of quail invariant chain with chicken and mouse MHC II molecules, Dev. Comp. Immunol. 40 (2013) 20-27. DOI:10.1016/j.dci.2013.01.002
244 245
[15] M. Sugita, M.B. Brenner, Association of the invariant chain with major histocompatibility complex class I molecules directs trafficking to endocytic compartments, J. Biol. Chem. 270 (1995) 1443-1448.
246 247 248 249
[16] X. Lin, X. Wang, H.L. Capek, L.C. Simone, A. Tuli, C.R. Morris, A.J. Reber, J.C. Solheim, Effect of invariant chain on major histocompatibility complex class I molecule expression and stability on human breast tumor cell lines, Cancer Immunol. Immunother. 58 (2009) 729-736. DOI:10.1007/s00262-008-0595-1
250 251 252
[17] A.J. Spencer, M.G. Cottingham, J.A. Jenks, R.J. Longley, S. Capone, S. Colloca, A. Folqori, et al. Enhanced vaccine-induced CD8+ T cell responses to malaria antigen ME-TRAP by fusion to MHC class II invariant chain, PLoS One 9 (2014) e100538. DOI:10.1371/journal.pone.0100538
253 254
[18] G. Basha, K. Omilusik, A. Chavez-Steenbock, A.T. Reinicke, N. Lack, A CD74-dependent MHC class I endolysosomal cross-presentation pathway, Nat. Immunol. 13 (2012) 237-245. DOI:10.1038/ni.2225
255 256 257
[19] F.F. Chen, L. Pan, J.G. Zhang, X.H. Zhou, J. Li, W.Y. Yu, Allele-dependent association of chicken MHC class I molecules with the invariant chain, Vet. Immunol. Immunopathol. 160 (2014) 273-280. DOI:10.1016/j.vetimm.2014.05.013
258 259 260
[20] L.F. Luo, W.Y. Yu, F.F Chen, Characters of the location in cells and binding activity of chicken Ii and B-L gene expressed products, Chinese J. Immunol. 31 (2015) 879-83. DOI:10.3969/j.issn.1000-484X. 2015.07.003 (in Chinese)
261 262
[21] J.A. Yoder, R.N. Haire, G.W. Litman, Cloning of two zebrafish cDNAs that share domains with the MHC class II-associated invariant chain, Immunogenetics 50 (1999) 84-88.
263 264
[22] J.M. Dijkstra, I.K. Kiryu, B. llner, Y. Yoshiura, M. Ototake, MHC class II invariant chain homologues in rainbow trout (Oncorhynchusmykiss). Fish. Shellfish Immunol. 15 (2003) 91-105.
265 266 267 268 269 270 271
[23] D.S. Silva, M.I. Reis, D.S. Nascimento, A. do Val, P.J. Pereira, N.M. dos Santos, Sea bass (Dicentrarchuslabrax) invariant chain and class II major histocompatibility complex: sequencing and structural analysis using 3D homology modelling, Mol. Immunol. 44 (2007) 3758-3776. DOI:10.1016/j.molimm.2007.03.025 [24] W. Zheng, G. Liu, J. Ao, X. Chen, Expression analysis of immune-relevant genes in the spleen of large yellow croaker (Pseudosciaena crocea) stimulated with poly I:C. Fish Shellfish Immunol. 21 (2006) 414-430. DOI:10.1016/j.fsi.2006.01.006
272 273
[25] M. Sakai, T. Kono, R. Savan, Identification of expressed genes in carp (Cyprinuscarpio) head kidney cells after in vitro treatment with immunostimulants, Dev.Biol. (Basel) 121 (2005) 45-51.
274 275 276
[26] G. Lugo-Villarino, K.M. Balla, D.L. Stachura, K. Bañuelos, M.B Werneck, D. Traver,. Identification of dendritic antigen-presenting cells in the zebrafish, Proc. Natl. Acad. Sci. USA 107 (2010) 15850-15855. DOI:10.1073/pnas.1000494107
277 278 279 280
[27] I.A. Johnston, H.T. Lee, D.J. Macqueen, K. Paranthaman, C. Kawashima, A. Anwar, J.R. Kinghorn, T. Dalmay, Embryonic temperature affects muscle fibre recruitment in adult zebrafish: genome-wide changes in gene and microRNA expression associated with the transition from hyperplastic to hypertrophic growth phenotypes, J. Exp. Biol. 212 (2009) 1781-193. DOI:10.1242/jeb.029918
281 282 283
[28] U. Grimholt, I. Hordvik, V.M. Fosse, I. Olsaker, C. Endresen, O. Lie, Molecular cloning of major histocompatibility complex class I cDNAs from Atlantic salmon (Salmo salar). Immunogenetics 37 (1993) 469-473.
AC C
EP
TE D
M AN U
SC
RI PT
236 237 238
7/9
ACCEPTED MANUSCRIPT [29] H.R. Juul-Madsen, J. Glamann, H.O. Madsen, M. Simonsen, MHC class II betachain expression in the rainbow trout, Scand. J. Immunol. 35 (1992) 687-694. [30] D.S. Silva, M.I. Reis, D.S. Nascimento, A. do Vale, P. J. Pereira, N. M. dos Santos, Sea bass (Dicentrarchus labrax) invariant chain and class II major histocompatibility complex: sequencing and structural analysis using 3D homology modeling, Mol. Immunol. 44 (2007) 3758-3776. DOI:10.1016/j.molimm.2007.03.025 [31] K.L. Rakus, G.F. Wiegertjes, M. Adamek, V. Bekh, R.J. Stet, I. Irnazarow, Application of PCR-RF-SSCP to study major histocompatibility class IIB polymorphism in common carp (Cyprinus carpio L.), Fish Shellfish Immun. 24 (2008) 734-744. DOI:10.1016/j.fsi.2007.11.015 [32] U. Grimholt, MHC and Evolution in Teleosts. Biology (Basel) 5 (2016) pii: E6. DOI: 10.3390/biology5010006
295 296
[33] Y. Dai, F.F. Chen, X.L. Liu, X. Wang. cDNA cloning and antigen-binding sites of the MHC class I in Chinese native chicken (Qingyuan Partridge chicken), JFAE 8 (2010) 91-97.
297 298
[34] F.F. Chen, L. Pan, C. Wu, Y. Dai, W.Y. Yu, Character of chicken polymorphic MHC class II alleles of three Chinese local breeds, Poultry Sci. 91 (2012) 1097-1104. DOI:10.3382/ps.2011-02007
299 300 301
[35] A.S Mona, B. Crestanello, S. Bankhead-Dronnet, E. Pecchioli, S. Ingrosso, Disentangling the effects of recombination, selection, and demography on the genetic variation at a major histocompatibility complex class II gene in the alpine chamois, Mol. Ecol. 17 (2008) 4053-4067.
302 303 304
[36] F.F. Chen, F.T. Meng, L. Pan, F.Z. Xu, X.L. Liu, W.Y. Yu, Boosting immune response with the invariant chain segments via associating to non PBR of MHC II class molecule, BMC Immunol. 13 (2012) 55. DOI:10.1186/1471-2172-13-55
305 306 307
[37] D.L. Zhong, W.Y. Yu, Y.H. Liu, J. Liu, J.N. Li, Molecular cloning and expression of two chicken invariant chain isoforms produced by alternative splicing, Immunogenetics 56 (2004) 650-656. DOI:10.1007/s00251-004-0726-6
308 309 310
[38] M.F. Criscitiello, Y. Ohta, M.D. Graham, J.O. Eubanks, P.L. Chen, M.F. Flajnik, Shark class II invariant chain reveals ancient conserved relationships with cathepsins and MHC class II, Dev. Comp. Immunol. 36 (2012) 521-533. DOI:10.1016/j.dci.2011.09.008
311 312 313 314
[39] M. Cloutier, C. Gauthier, J.S. Fortin, L. Genève, K. Kim, S. Gruenheid, J. Kim, J. Thibodeau, ER egress of invariant chain isoform p35 requires direct binding to MHCII molecules and is inhibited by the NleA virulence factor of enterohaemorrhagic Escherichia coli, Hum. Immunol. 76 (2015) 292-296. DOI:10.1016/j.humimm.2015.02.002
315 316 317
[40] M. Cloutier, C. Gauthier, J.S. Fortin, J. Thibodeau, The invariant chain p35 isoform promotes formation of nonameric complexes with MHC II molecules, Immunol. Cell. Biol. 92 (2014) 553-556. DOI:10.1038/icb.2014.17
318 319 320 321 322 323 324
[41] C. Wu, D.G. Zhang, F.F. Chen, X.L. Liu, W.Y. Yu, The N-terminal functional region of the invariant chain efficiently targets a CTL epitope to MHC class I in cross-presentation, Genet. Mol. Res. 13 (2014) 2438-2450. DOI:10.4238/2014.April.3.16 [42] M.M. van Luijn, A.A. van de Loosdrecht, M.H. Lampen, P.A. van Veelen, A. Zevenbergen, M.G. Keste, A.H. de Ru, G.J. Ossenkoppele, et al. Promiscuous binding of invariant chain-derived CLIP peptide to distinct HLA-I molecules revealed in leukemic cells, PLoS One 7 (2012) e34649. DOI:10.1371/journal.pone.0034649.
325
Captions
326 327 328 329 330
Fig. 1. Schematic diagram of the structure of the grass carp invariant chain (gIi), the fragments amplified, and the polymerase chain reaction (PCR) primers used. (A) Entire gIi structure. Cyt, cytosolic domain; TM, transmembrane domain; Lum, luminal domain; CLIP, class II-associated invariant chain peptide; Tri, trimerization region; Thyr, thyroglobulin domain. (B) gIi gene fragments and primers used for the rapid amplification of cDNA ends method. Arrows and solid lines indicate the primer sites and amplified
AC C
EP
TE D
M AN U
SC
RI PT
284 285 286 287 288 289 290 291 292 293 294
8/9
ACCEPTED MANUSCRIPT fragments. (C) Amplified gIi and its fragments determined by PCR. M, DNA marker; 1, whole gIi; 2, 1–711bp fragment; 3, 313–1116bp; 4, 1–642bp; 5, 164–657bp.
333 334 335 336 337 338 339 340 341 342 343 344 345 346 347
Fig. 2. Comparison of the grass carp invariant chain (gIi) structure with that of other vertebrates. (A) Alignment of the predicted Ii translation products from grass carp and five other vertebrates. Sequence alignment was performed with Align software at the Clustal W network server (http://www.ebi.ac.uk/Tools/msa/). Residues within the cytosolic, transmembrane, luminal, and thyroglobulin domains are shaded; helices a–c are indicated by a single underline. Identical (asterisks) and similar (dots) amino acid residues are indicated. (B) Genetic relationships of the Ii sequences from 12 species in the phylogenetic tree. The tree was generated with the CLUSTAL software package (ver. 1.81) using a neighbor-joining algorithm and edited with MEGA 4.1 software. The tree was rooted using the midpoint method. Horizontal distances are proportional to the minimum number of nucleotide differences required to join nodes. The Ii sequences of the species were classified into different lineages, and the grass carp and sliver carp Iis belonged to the same lineage. Bar represents branch length, which is proportional to genetic distance. The Ii sequences of duck (AAX47310), goose (HM208131), pigeon (AAX47311), quail (AAX47311), chicken (AAT3634), mouse (NP_034675), cattle (NP_001029907), human (AAA36304), rainbow trout (AY081776), common carp (AB098609), zebrafish (CU468924.8), grass carp (KM369885), and sliver carp (JQ278011) were referenced from GenBank (https://www.ncbi.nlm.nih.gov/genbank/).
348 349 350 351 352 353 354 355 356
Fig. 3. Transcription levels of the grass carp invariant chain (gIi), grass carp major histocompatibility complex Iα (gMhcIα), and gMhcIIβ and genes in different organs. (A) Distribution of gIi, gMhcIα, and gMhcIIβ genes in different organs. Transcription product lengths were 132bp (gIi), 91bp (gMhcIα), 107 bp (gMhcIIβ), and 90bp (18 sRNA, endogenous control). (B) Relative gIi, gMhcIα, and gMhcIIβ gene transcription levels in different organs. Bars represents mean ± SD values obtained from experiments performed three times (technical replicates). 1, Blood cells; 2, liver; 3, spleen; 4, mesonephros; 5, head kidney; 6, heart; 7, brain; 8, skin; 9, gill; 10, intestines; 11, red muscle; 12, swim bladder. The t test showed statistical significance (P<0.01) between the blood cells and the other organs, except gill (gIi), heart, brain, intestines and red muscle (gMhcIα).
357 358 359 360 361 362 363 364
Fig. 4. Co-localization of the grass carp invariant chain (gIi) with grass carp major histocompatibility complex Iα (gMhcIα) and gMhcIIβ in 293T cells. The cells were transiently co-transfected (A) with pEGFP-C1-gIi expressing GFP/gIi and pmCherry-N1-gMhcIα expressing RFP/gMHCIα, (B) with pEGFP-C1-gIi and gMHCIIβ, or (C) with pEGFP-C1-gIi and pmCherry-N1-F(306) as controls. The cells were observed 24 h later under a confocal laser scanning microscope with a 60×oil objective. The molecules were visualized as green or red (C) respectively, and co-localization of the gIi with GFP/gIi-RFP/gMHCIα or RFP/gMHCIIβ was visualized in the transfected cells as a dispersed yellow-orange color in the merged image. Bar, 50µm.
365 366 367 368 369 370 371 372
Fig. 5. Binding of the grass carp invariant chain (gIi) with grass carp major histocompatibility complex Iα (gMhcIα) and gMhcIIβ detected on Western blot. 293T cells were co-transfected (1) with GFP/gIi and Myc/gMhcIα or (2) with GFP/gIi and Myc/gMhcIIβ. The cells were transfected (3) (5) with GFP and Myc/gMhcIα, (4) (6) GFP and Myc/gMhcIIβ, (7) GFP/gIi and Myc ( as control). The cells were lysed after 24 h and immunoprecipitated (IP) with the anti-Myc antibody (1) (2) (5) (6) (7). Subsequently, the immune complex and cell lysis (3) (4) as control were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and GFP was detected by western blot with anti-GFP antibody. The GFP/gIi fusion protein had a molecular weight of 53.7 kDa (molecular weight of GFP is 27kDa). +, done, -, not done.
AC C
EP
TE D
M AN U
SC
RI PT
331 332
373 9/9
ACCEPTED MANUSCRIPT Table 1 Primer sequences and recombinant plasmids Recombinant plasmids (Accession No. in GenBank ) Degenerate primer
name
Sequences(5'-3')
gIi-d-f(164) gIi-d-r(657)
5′ gacaggcgctgaccgcakaca 3′ 5′ gcagtayccsgkkctgtgcca 3′
gIi-5′R(542) gIi-3′F(413) gIi-F-f gIi-F-r(1116) gIi-F-r(711) gIi-q-f gIi-q-r
5′ tcacacagagcagtgatgga 3′ 5′ cccgaattcgatggacgagcatcaaaacg 3′ 5'ccgctcgagttactctgagccaca 3' 5'cccgaattcgatggacgagcatcaaa 3' 5'ccgctcgagttactctgagccaca 3' 5'gaagatctagatggacgagcatcaaa 3' 5'ccgctcgagttactctgagccaca 3'
In RACE
gIα-q-f gIα-q-r
5'cagagttcactgtggttggtc 3' 5'atccactctgtcttcggcac 3'
For gMhcIα in qRT-PCR
gIIβ-q-f gIIβ-q-r
5'acgacttctaccctcaaccaat 3' 5'gtagtaccagtctccgttaagca 3'
For gMhcIIβ in qRT-PCR
18sRNA-q-f 18sRNA-q-r
5'atttccgacacggagagg3' 5'catgggtttaggatacgctc 3'
gIi-f gIi-r
5' cccgaattcgatggacgagcatcaaaacg 3' 5'gcgtcgacttactctgagccacactg 3'
For pEGFP-C1-gIi (KM369885)
gIα-f gIα-r
5'cccgaattcacatgcgatctgtagtgc 3' 5'gcgtcgacacaacaggtttaaagcct 3'
For pmCherry-N1-gMhcIα (AB540144)
gIIβ-f gIIβ-r
5'cccgaattcacatgtctgtgttaaagc 3' 5'gcgtcgacacctacagacctgttgat 3'
For pmCherry-N1-gMhcIIβ (JF436931)
F306-f F306-r
5' ccgctcgagatatg ctcccaaatatgc 3' 5' gcgtcgacttcactca ataaataccaggag 3'
For pmCherry-N1-F306
gIi-IP-f gIi-IP-r
5'gaagatctagatggacgagcatcaaa 3' 5'ccgctcgagttactctgagccaca 3'
For pCMV-Myc-gIi (KM369885)
gIα-IP-f gIα-IP-r
5'gaagatctagatgcgatctgtagtgc 3' 5'ccgctcgagaacaggtttaaagcct 3'
For pCMV-Myc-gMhcIα (KM369885)
gIIβ-IP-f gIIβ-IP-r
5'gaagatctagatgtctgtgttaaag 3' 5'ccgctcgagctacagacctgttgat 3'
For pCMV-Myc-gMhcIIβ (JF436931)
RI PT
For full length gIi
SC
For gIi in qRT-PCR
AC C
EP
TE D
M AN U
For g18sRNA in qRT-PCR (EU047719)
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
AC C
EP
TE D
M AN U
SC
RI PT
ACCEPTED MANUSCRIPT
ACCEPTED MANUSCRIPT Highlights • • •
AC C
EP
TE D
M AN U
SC
RI PT
•
The grass carp Ii (gIi) cDNA was cloned using designed degenerate primers and the rapid amplification of cDNA ends method (RACE). The gIi gene transcription levels are positively correlated with gMhcIα or gMhcIIβ. The gIi associates gMHCIα or gMHCIIβ molecules in eukaryotic cells. The gIi binds with gMHCIIβ or gMHCIα molecules of prokaryotic expression.