- Email: [email protected]
Growth patterns of superficially elevated neoplasia in the large intestine
Growth patterns of superficially elevated neoplasia in the large intestine Kazuhiro Kaneko, MD, Toshinori Kurahashi, MD, Reiko Makino, PhD, Kazuo Konishi, MD, Keiji Mitamura, MD Tokyo, Japan
Background: The growth pattern and malignant potential of superficially elevated neoplastic lesions remain controversial. A flat adenoma is classified as a superficially elevated neoplasm that characteristically demonstrates high-grade dysplasia despite its small size. In contrast, a noduleaggregating (NA) tumor, which consists of multiple small aggregated nodules, can also be classified as superficially elevated neoplasia. Methods: In this prospective study, 2720 consecutive patients undergoing total colonoscopy were examined for superficially for elevated lesions. Clinicopathologic characteristics, Ki-ras mutational status, and overexpression of p53 protein were compared in 25 NA tumors and 55 flat adenomas without a central depression (flat tumor). Results: All flat tumors had a tubular pattern, whereas 21 of 25 NA tumors showed a villotubular or tubulovillous pattern. Ki-ras mutation was observed in 44% of NA tumors but in none of the flat tumors. Overexpression of p53 protein was found in 12% of NA tumors and 7% of flat tumors. Conclusions: NA tumors and flat tumors have different clinicopathologic and genetic characteristics, although both types of tumor are classified as superficially elevated lesions. (Gastrointest Endosc 2000;51:443-50.)
The adenoma-carcinoma sequence model, in which carcinoma develops from adenoma, has been proposed for colorectal polypoid tumors.1-3 Various oncogenes and tumor suppressor genes, including the APC, Ki-ras, p53, and DCC genes, have been shown to be involved in the carcinogenesis of colorectal neoplasia. According to the model of Vogelstein et al.,4,5 mutations of the Ki-ras gene are early events and mutations of the p53 gene are late events in the development of polypoid neoplasia. Flat adenomas, which appear as superficially elevated smooth tumors and are often accompanied by a shallow depression, can be distinguished macroscopically from polypoid-type tumors, which grow upward from the mucosal layer.6 Flat adenomas characteristically demonstrate high-grade dysplasia despite their small size.7-9 The frequency of Ki-ras gene mutations is extremely low in these neoplastic lesions,10 suggesting that the process of tumorigenesis for flat adenomas differs from that for polypoid adenomas. It has been suggested that flat adenomas develop into nonpolypoid carcinomas.10 Received March 5, 1999. For revision June 3, 1999. Accepted October 26, 1999. From the Second Department of Internal Medicine, Showa University School of Medicine, Tokyo, Japan. Reprint requests: Kazuhiro Kaneko, MD, Second Department of Internal Medicine, Showa University School of Medicine, 1-5-8, Hatanodai, Shinagawa-ku, Tokyo 142-8666, Japan. Copyright © 2000 by the American Society for Gastrointestinal Endoscopy 0016-5107/2000/$12.00 + 0 37/1/104047 doi:10.1067/mge.2000.104047 VOLUME 51, NO. 4, PART 1, 2000
In Japan, early carcinomas and adenomas are classified macroscopically as protruding, flat elevated, flat, and depressed according to the Japanese Research Society for Cancer of the Colon and Rectum (JRSCCR).11 Flat adenomas are considered to be superficially elevated lesions with a smooth surface; they often have a shallow depression.6 In contrast, Kudo et al.12 described a particular type of nonpolypoid lesion known as a “depressed” lesion, in which the tumor surface is lower than the adjacent normal mucosa. Most depressed lesions, which are found in about 1 of 140 Japanese patients, are smaller than 10 mm. Importantly, among depressed lesions 6 to 10 mm in size, 50% had malignant tissue invading the submucosa. Kudo et al. emphasized that depressed neoplasms show a specific growth pattern that differs from that of superficially elevated neoplasia. Conversely, the growth pattern and malignant potential of superficially elevated neoplasia remain controversial. In this prospective study, we investigated the risk of malignancy and the growth pattern in such superficially elevated neoplasia without a central depression. Furthermore, we have found other tumors that could also be classified as superficially elevated type. The surfaces of these tumors are rough with multiple small aggregated nodules. We refer to such tumors as nodule-aggregating (NA) tumors or laterally spreading tumors (LST).13 this prospective study, the clinicopathologic characteristics and genetic changes in NA tumors were compared with those in flat adenomas without a central depression. GASTROINTESTINAL ENDOSCOPY
443
K Kaneko, T Kurahashi, R Makino, et al.
Growth patterns of superficially elevated neoplasias
Figure 2. Histologic appearance at low magnification of an NA tumor, 17 mm in diameter, obtained by endoscopic mucosal resection (H&E, orig. mag. ×1).
Table 1. Japanese classification of colorectal lesions
A
Protruding lesions
Flat elevated lesions
Flat lesions Depressed lesions
B Figure 1. A, Colonoscopic appearance of an NA tumor; B, colonoscopic appearance of an NA tumor with dye spray technique. PATIENTS AND METHODS In this study, 2720 consecutive symptomatic patients attending from April 1995 to March 1998 for colonoscopy were evaluated for superficially elevated neoplasia. Of these 2720 patients, 2530 (93%) underwent total colonoscopy. Patients who had advanced colorectal carcinomas (85 patients), had undergone surgical treatment for colorectal carcinoma (15 patients), had a hereditary predisposition to colon carcinoma (1 patient), or had inflammatory bowel disease (32 patients) were excluded from this study. Furthermore, 12 patients with superficially elevated lesions with a central depression and 4 patients with depressed lesions infiltrating the mucosa or submucosa were excluded, because the carcinogenesis of such lesions with a depression might differ from that of superficially elevated lesions without a depression. The remaining 2381 patients had an average age of 62 years and a male/female ratio of 10:9. Of these 2381 patients, 80 with superficially elevated neoplasia, which was defined endoscopically and histologically, made up the final study group. Twenty-five NA tumors (1.0%) and 55 flat tumors 444
GASTROINTESTINAL ENDOSCOPY
Classification
Macroscopic appearance
Ip Isp Is IIa IIa+IIc
Pedunculated polyps Subpedunculated polyps Sessile polyps Flat elevation of mucosa Flat elevation with central depression Flat mucosa Mucosal depression Mucosal depression with raised edge
IIb IIc IIc+IIa
(2.3%) were obtained by endoscopic mucosal resection or by surgical resection at our hospital. We used a CF-200 Z magnifying colonoscope (Olympus Optical Co., Ltd., Tokyo, Japan) and alternatively standard colonoscopes (Olympus 200 I or 230 I). A magnifying colonoscope, together with spraying of indigo carmine dye (0.2%), allows detailed examination of the mucosal crypt pattern of lesions with flat erythematous or discolored mucosa that by their appearance raise a suspicion of neoplasia. The depth of infiltration and epithelial atypia were assessed by examining H&E-stained sections. The macroscopic classification was made according to JRSCCR criteria (Table 1).11 Histologically, adenomas were categorized as showing mild, moderate, or severe atypia, and carcinomas were classified as intramucosal or submucosal according to the JRSCCR criteria.11 However, neoplasms that had the features of either adenoma with severe atypia or intramucosal carcinoma were categorized as highgrade dysplasia (HGD). Furthermore, adenomas that had the features of mild to moderate atypia were categorized as low-grade dysplasia (LGD). The glandular structures of these tumors were also assessed histologically. The degree of villous involvement was classified into 4 subcategories: more than 75% involvement, villous; 51% to 75% involvement, villotubular; 26% to 50% involvement, tubulovillous; and 0% to 25% involvement, tubular. In the H&Estained sections the maximum height in millimeters of the intramucosal lesion above the muscularis mucosa was measured at 4 points on the marginal area and at 2 points at the center of the tumor. The ratio of the maximum tumor size in millimeters to the mean height at the margin and center of the lesion was defined as the ratio of size to height for each tumor. VOLUME 51, NO. 4, PART 1, 2000
Growth patterns of superficially elevated neoplasias
K Kaneko, T Kurahashi, R Makino, et al.
A
A
B
B Figure 3. A, Colonoscopic appearance of a flat tumor; B, colonoscopic appearance of a flat tumor with dye spray technique.
Figure 4. Histologic appearance at low magnification of a flat tumor, 15 mm in diameter, obtained by endoscopic mucosal resection (H&E, orig. mag. × 1). All lesions were determined to be NA tumors or flat tumors on the basis of the following criteria. Tumors were classified as NA tumors if they had a uniformly rough surface with multiple small nodules (1 to 2 mm) and were only slightly elevated above the mucosal surface (Figs. 1 and 2). NA tumors with even 1 nodule over 5 mm in diameter were excluded. Flat tumors were defined as those in which the tumor was only slightly elevated without a central depression and with a smooth surface (Figs. 3 and 4). Analysis of Ki-ras gene mutations Cellular DNA was extracted from frozen biopsy specimens formalin-fixed and paraffin-embedded. The paraffinVOLUME 51, NO. 4, PART 1, 2000
Figure 5. A, After silver staining, Ki-ras mutations were visualized as shifted bands (arrow). N.C, Negative control; P.C, positive control; A, absence of Ki-ras mutation; P, presence of Kiras mutation. B, Nuclei of tumor cells strongly stained (overexpression of p53 immunohistochemistry, orig. mag. ×50). embedded tissues were cut into 10 µm thick sections and 2 to 4 of them were used for DNA extraction. Mutations of the Ki-ras gene were examined with polymerase chain reaction single-strand conformation polymorphism (PCRSSCP) analysis.14 DNA fragments that contained codons 12 and 13 of the Ki-ras gene were amplified with the following primers (Takara Inc., Tokyo, Japan): forward primer: 5´GACTGAATATAAACTTGTGG3´; reverse primer: 5´CTATTGTTGGATCATATTCG3´. PCR consisted of 40 cycles at 94°C for 30 seconds, 50°C for 2 minutes, and 72°C for 1 minute. PCR products were then analyzed by a nonisotopic SSCP technique and were visualized with silver staining (Bio-Rad, Hercules, Calif.) according to the protocol described by Orita et al.14 Briefly, PCR products were diluted 10-fold with 95% formamide and applied to a 12% polyacrylamide gel (3.3% cross linker) with Tris-glycine buffer. Electrophoresis was performed at 23°C. All codon 12 and 13 mutations of the Ki-ras gene were detectable under these SSCP conditions. After staining with silver, shifted bands were determined to be DNA fragments that had a mutation.15 As shown in Figure 5A, the shifted bands were visible after silver staining. Overexpression of p53 protein Overexpression of p53 protein was demonstrated by immunohistochemical staining of thin sections of formalin-fixed, paraffin-embedded tissues. Pab1801 (Oncogene Science, Cambridge, Mass.), a monoclonal antibody to p53 protein, was used, and the avidin-biotin-peroxidase GASTROINTESTINAL ENDOSCOPY
445
K Kaneko, T Kurahashi, R Makino, et al.
Growth patterns of superficially elevated neoplasias
Table 2. Clinicopathologic findings of NA and flat tumors NA tumor (n = 25) Mean age (yr) Male/female ratio Location Right colon Left colon Tumor size (mm) Mean Range < 10 mm ≥ 10 mm Glandular structure Tubular Tubulovillous Villotubular Grade of atypia HGD LGD Ratio of size to height Total HGD LGD
Flat tumor (n = 55)
p Value
61 1.9:1
NS NS
12 (48%) 13 (52%)
23 (42%) 32 (58%)
NS
22.6 8-55 2 (8%) 23 (92%)
10.1 4-25 36 (65%) 19 (35%)
< 0.02
4 (16%) 13 (52%) 8 (32%)
55 (100%) 0 (0%) 0 (0%)
< 0.0001
8 (32%) 17 (68%)
8* (15%) 47 (85%)
NS
19.1 23.3 18.1
NS
63 1.8:1
17.8 22.8 15.5
< 0.0001
NS, No significant difference between NA and flat tumors. *Includes 1 invasive carcinoma infiltrating the submucosa.
method was used.3 Tumor cells with strongly stained nuclei and diffusely or focally stained lesions were considered positive for p53 protein. A case was scored as positive for overexpression when more than 10% of the cells in the entire neoplastic component showed a positive nuclear reaction (Fig. 5B). Statistical analysis The significance of differences in variables was assessed with the chi-square test or the Mann-Whitney test. Differences with p values less than 0.05 were considered significant.
RESULTS Clinicopathologic characteristics of NA tumors Of the 25 NA tumors, 8 (32%) showed HGD and 17 (68%) LGD, including mild atypia in 6 cases and moderate atypia in 11 cases (Table 2). Twenty-one NA tumors included both villous and tubular structures; 8 tumors were villotubular and 13 were tubulovillous. The remaining 4 cases showed only tubular structures (Table 2). No tumors contained only villous components. High-grade NA tumors (mean size 36.2 mm) were significantly larger than low-grade NA tumors (16.4 mm) (p < 0.05). Furthermore, small nodules on the surface of the 25 NA tumors averaged 1.8 mm in diameter (range 0.8 to 3.5 mm). Comparison of NA tumors and flat tumors The clinicopathologic characteristics and genetic changes in the 25 NA tumors were compared with 446
GASTROINTESTINAL ENDOSCOPY
those in the 55 flat tumors. There were no significant differences in the mean age or male-female ratio between patients with NA and those with flat tumors (Table 2). The locations of the 25 NA tumors were as follows: 5 in the rectum (20%), 5 in the sigmoid colon (20%), 3 in the descending colon (12%), 2 in the transverse colon (8%), 2 in the ascending colon (8%), and 8 in the cecum (32%). In contrast, the locations of the 55 flat tumors were as follows: 25 in the sigmoid colon (45%), 8 in the descending colon (15%), 11 in the transverse colon (20%), and 11 in the ascending colon (20%). There was no significant difference between NA tumors (48%) and flat tumors (42%) with regard to the frequency with which they were located in the right colon. However, approximately half of the NA tumors were located in the rectum and cecum, whereas no flat tumors were found in the rectum or cecum. NA tumors were significantly larger than flat tumors (p < 0.02) (Table 2). In contrast, of the 36 flat tumors (65%) that were 10 mm or less in diameter, 35 (97%) showed LGD (Table 3). Conversely, only 2 NA tumors (8%) were less than 10 mm in diameter and both showed LGD. The prevalence of small lesions (less than 10 mm) differed significantly between the 2 groups (p < 0.0001) (Table 2). All 55 flat tumors had a tubular pattern, whereas most of the 25 NA tumors had a villotubular or tubulovillous pattern. The frequency of the tubular pattern was significantly higher in flat tumors (55 of 55, 100%) than in NA tumors (4 of 25, 16%) (p < VOLUME 51, NO. 4, PART 1, 2000
Growth patterns of superficially elevated neoplasias
K Kaneko, T Kurahashi, R Makino, et al.
Table 3. Tumor size and grade of histologic atypia Tumor size (mm)
Flat tumor (n = 55) LGD (n = 47) HGD (n = 8) NA tumor (n = 25) LGD (n = 17) HGD (n = 8)
≤4
5-9
10-19
20-29
30-39
≥40
10 —
25 1
12 4
— 3*
— —
— —
— —
2 —
10 1
4 3
1 1
— 3
Three cases containing 1 invasive carcinoma infiltrating the submucosa.
Table 4. Analysis of Ki-ras mutations and p53 protein overexpression Ki-ras gene mutations Flat tumor (n = 55) LGD (n = 47) HGD* (n = 8) NA tumor (n = 25) LGD (n = 17) HGD (n = 8)
0 0 0 11 7 4
(0%) (0%) (0%) (44%)‡ (41%) (50%)
p53 protein overexpression 4 0 4 3 0 3
(7%) (0%) (50%)† (12%) (0%) (38%)†
*Eight flat tumors including 1 invasive carcinoma infiltrating the submucosa. †Significantly different from LGD lesions. ‡Significantly different from flat tumors.
0.0001). The prevalence of HGD did not differ significantly between flat tumors (8 of 55, 15%) and NA tumors (8 of 25, 32%) (Table 3). The mean ratio of size to height did not differ significantly between NA tumors (17.8, range 7.2 to 28.2) and flat tumors (19.1, range 10.0 to 30.0). Furthermore, this ratio did not differ significantly between LGD and HGD lesions among either NA tumors (15.5 vs. 22.8) or flat tumors (18.1 vs. 23.3) (Table 3). Two patients with NA tumors underwent surgical resection with lymph node dissection, because their tumors were believed, on the basis of their large size (50 mm or larger), to have infiltrated the submucosa. Histologic examination of the resection specimens from these 2 patients revealed intramucosal lesions with HGD, but lymph node metastasis was not found after surgery. In contrast, 1 of 8 flat tumors with HGD had infiltrated the submucosa. Although this tumor was 20 mm in diameter, invasive carcinoma was diagnosed on the basis of the results of EUS and of crypt patterns observed with a magnifying colonoscope. Surgical resection with lymph node dissection was performed, and no metastatic lymph nodes were found. Analysis of Ki-ras mutations and p53 overexpression Mutation of Ki-ras gene was found in none of the flat tumors and in 44% of NA tumors (Table 4). This difference was significant (p < 0.0001). Of 11 NA VOLUME 51, NO. 4, PART 1, 2000
tumors with mutations of Ki-ras gene, 7 exhibited LGD and 4 HGD. The frequency of Ki-ras mutation did not differ significantly between NA tumors with LGD (7 of 17, 41%) and those with HGD (4 of 8, 50%) (Table 4). Furthermore, the incidence of Ki-ras mutation was not correlated with tumor size. The frequency of overexpression of p53 protein did not differ significantly between NA tumors (3 of 25, 12%) and flat tumors (4 of 55, 7%). The frequency of p53 overexpression was significantly higher in HGD lesions than in LGD lesions among both NA tumors (38% vs. 0%, p < 0.01) and flat tumors (50% vs. 0%, p < 0.0001) (Table 4). Although most NA tumors and flat tumors were intramucosal, a similar percentage (38% and 50%) of HGD lesions in the 2 groups showed p53 overexpression. In contrast, the frequency of Ki-ras mutation differed markedly between NA and flat tumors. DISCUSSION Recent studies in Japan have found a high incidence of flat or depressed colorectal carcinomas.6,8,9,16,17 In contrast, such lesions have been rarely noted in Western countries, perhaps because of different histologic criteria or population differences. Because the incidence of these types of tumors in the United Kingdom and Japan is similar when patients are studied with the Japanese colonoscopic technique described by Fujii et al.,18 the lower frequency in the West is probably due to flat and depressed neoplasia being mistaken for flat eryGASTROINTESTINAL ENDOSCOPY
447
K Kaneko, T Kurahashi, R Makino, et al.
thematous or discolored mucosa during colonoscopy. Recently, however, flat and depressed lesions have also been found in the West.18,19 In our prospective study, 2381 consecutive patients undergoing total colonoscopy were evaluated for flat and depressed neoplasia for 3 years, and such lesions were found in 80 (3.3%) and 16 (0.7%) patients, respectively. According to retrospective studies from Japan, 12% to 40% of adenomas and early colorectal carcinomas are flat rather than polypoid.20,21 Outside Japan, there have also been reports of small, flat neoplastic lesions. Lanspa et al.22 have concluded that flat adenomas are as prevalent as other adenomas and have suggested that flat adenomas represent an early stage of adenoma formation. Lynch et al.23 examined the clinical and pathologic features of 4 extended kindreds with hereditary flat adenoma syndrome and suggested that this condition is a variant of familial adenomatous polyposis. Some evidence suggests that flat elevated lesions have a higher malignant potential than polypoid lesions. Studies by Muto et al.24 have shown a much higher frequency of aneuploidy in flat elevated adenomas than in polypoid adenomas. Wolber and Owen25 have reported that small flat adenomas were 10 times more likely to contain HGD than were polypoid adenomas. Rubio et al.26 recently reported that 24.8% of a series of 141 resected flat adenomas in Japanese patients contained severe dysplasia compared with 13.3% of 90 lesions in Swedish patients. Our present study suggests that the risk of malignancy in flat tumors (14.5%) is similar to that reported previously. However, only 1 of 36 small flat tumors (less than 10 mm in diameter) showed HGD (2.8%) and the remaining 35 tumors showed LGD. Mitooka et al.27 reported severe atypia in 1.3% of diminutive polypoid adenomas. The risk of malignancy in small flat tumors may be the same as that in diminutive polypoid lesions. In contrast, 7 of 19 (37%) large flat tumors (10 mm or greater in diameter) showed HGD, including 1 invasive carcinoma (Dukes A). These results suggest that flat tumors without a central depression have enhanced malignant potential when they are 10 mm in diameter and larger. Imai et al.28 report that superficially elevated neoplasms, especially those more than 1 cm in diameter, with greater marginal irregularity had greater malignant potential. We propose that the malignant potential of small flat tumors without a central depression is lower than that of so-called flat adenomas, which are defined as small, flat elevated tumors, often with a shallow depression. One possible explanation for this discrepancy is that previous studies may have considered depressed or flat lesions with a central depression to be flat adeno448
GASTROINTESTINAL ENDOSCOPY
Growth patterns of superficially elevated neoplasias
mas. Kudo et al.12 have also reported that the incidence of severe dysplasia in small depressed lesions (6 to 10 mm) (50%) is higher than that in flat elevated neoplasia (2.4%). Fujii et al.18 report that 96% of flat lesions in English patients exhibited moderate dysplasia and the remaining 4% severe dysplasia that included a central depression. Furthermore, depressed lesions exhibited either severe dysplasia or invasive carcinoma. We suggest that the malignant potential of small flat lesions without a central depression is different from that of depressed lesions or flat lesions with a central depression. In the present study, clinicopathologic characteristics and genetic changes in NA tumors were compared with those in flat tumors. We found that NA tumors were significantly larger than flat tumors. Most (84%) NA tumors showed a tubulovillous or villotubular pattern, whereas all flat tumors demonstrated a tubular pattern. Furthermore, the frequency of Ki-ras mutations in the 25 NA tumors was 44%, whereas this mutation was not found in any of the 55 flat tumors. NA tumors and flat tumors differed greatly in size, glandular structure, and the incidence of Ki-ras mutation. According to the adenoma-carcinoma sequence model proposed by Vogelstein et al.,4,5 the Ki-ras gene makes adenomas larger and more severely dysplastic as an early event and the p53 gene is related to malignant transformation as a late event in the development of polypoid neoplasia. It is reasonable to speculate that the genetic pathway of NA tumors differs from that of flat tumors in the early events of carcinogenesis, because the incidence of Ki-ras mutation differed greatly between the 2 types of tumors and the frequency of p53 overexpression in NA tumors did not. Villotubular or tubulovillous glandular structures might play a greater role in the growth pattern of NA tumors. Furthermore, the villous component in NA tumors may be associated with tumor enlargement, because villous adenomas are often large. We suggest that the Ki-ras gene is related not only to the carcinogenesis of colorectal neoplasia but also to the proliferative ability of cells that grow in a villous pattern. The clinicopathologic and genetic characteristics of NA tumors differ from those of flat tumors in an early stage of carcinogenesis, although both NA tumors and flat tumors are macroscopically classified as superficially elevated. In contrast, the grade of histologic atypia tended to increase in both NA tumors and flat tumors as their size increased. Imai et al.28 also report that the histologic grade of atypia of superficially elevated neoplasms increases as their size increases. In a previous study, we assumed that polypoid neoplasia and depressed neoplasia would develop mostly VOLUME 51, NO. 4, PART 1, 2000
Growth patterns of superficially elevated neoplasias
upward and downward from the normal mucosa, respectively.29 However, we observed that these NA tumors and flat tumors spread horizontally along the mucosal layer and progressed neither upward nor downward at the center of the lesion. The mean ratio of size to height suggests that NA tumors and flat tumors should grow laterally along the mucosal layer, in as much as this ratio increases with atypia. We previously reported that 5% to 14% of invasive colorectal carcinomas have a laterally spreading growth pattern and that the genetic pathway in such carcinomas is different from that in polypoid or nonpolypoid growth-type tumors.30,31 We conclude that some superficially elevated neoplasms progress laterally along the mucosal surface. Most flat lesions may be difficult to detect at colonoscopy, and those in the present series only appeared as faint patches of mucosal hyperemia or discolored mucosa. Furthermore, 42% of flat tumors and 48% of NA tumors were located in the right colon and NA tumors were frequently found in the cecum (32%). To detect such lesions, we recommend total colonoscopy with indigo carmine dye spraying. Sigmoidoscopy is likely to miss flat lesions and cannot detect the 32% found in the proximal colon. If suspicious lesions are not sprayed with indigo carmine dye, their size and shape cannot be characterized accurately. Superficially elevated neoplasia without central depression can be classified into at least 2 groups that have different pathways for the development of colorectal cancers: flat adenomas with a smooth surface and NA tumors with a uniformly rough appearance and multiple small nodules. These tumors can be characterized by their growth patterns, i.e., superficial horizontal spread along the mucosal layer. We have reported a new growth pattern for colorectal tumors designated as NA tumors.
K Kaneko, T Kurahashi, R Makino, et al.
5. 6.
7. 8.
9.
10.
11.
12.
13.
14.
15.
16. 17.
18.
19.
ACKNOWLEDGMENT We thank Professor Mitsuo Kusano of the Second Department of Surgery, Showa University School of Medicine, for donating materials used in this study.
20.
21.
REFERENCES 1. Baker S, Preisinger AC, Jessup JM. p53 gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 1990;50:7717-22. 2. Kawasaki Y, Monden T, Morimoto H. Immunohistochemical study of p53 expression in microwave-fixed paraffin embedded sections of colorectal carcinoma and adenoma. Am J Clin Pathol 1992;97:244-9. 3. Levi E, Stryker SJ, Rao MS. p53 protein overexpression in colorectal tumors from patients with familial adenomatous polyposis: is it an early or late event? Am J Gastroenterol 1996;91:11-4. 4. Vogelstein B, Fearson ER, Hamilton SR, Kern SE, Preisinger VOLUME 51, NO. 4, PART 1, 2000
22.
23.
24. 25. 26.
AC, Leppert M, et al. Genetic alterations during colorectal tumor development. N Engl J Med 1988;319:525-32. Fearson ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 1990;61:759-67. Muto T, Kamiya J, Sawada T, Konishi F, Sugihara K, Kubota Y, et al. Small “flat adenoma” of the large bowel with special reference to its clinico-pathologic features. Dis Colon Rectum 1985;28:847-51. Robert A, Wolber MD, David A, Owen MB. Flat adenoma of the colon. Hum Pathol 1991;22:70-4. Tada S, Yao T, Iida M, Koga H, Hizawa K, Fujishima M. A clinicopathologic study of small flat colorectal carcinoma. Cancer 1994;74:2430-5. Matsumoto T, Iida M, Yao T, Fujishima M. Role of non-polypoid neoplastic lesions in the pathogenesis of colorectal cancer. Dis Colon Rectum 1994;37:450-5. Yamagata S, Muto T, Uchida Y, Masaki T, Higuchi Y, Sawada T, et al. Polypoid growth and K-ras codon 12 mutation in colorectal cancer. Cancer 1995;75:953-7. Japanese Research Society for Cancer of the Colon and Rectum. General rules for clinical and pathological studies on cancer of the colon, rectum and anus. Jpn J Surg 1983;13:557-73. Kudo S, Tamura T, Nakajima S, Sano Y, Yamano H, Serizawa M, et al. Depressed type of colorectal cancer. Endoscopy 1995;27:54-7. Kudo S. Endoscopic mucosal resection of flat adenoma and depressed types of early colorectal cancer. Endoscopy 1993;25:455-61. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-9. Sugano K, Kyogoku A, Fukuyama N, Ohkura H, Shimosato Y, Sekiya T, et al. Methods in laboratory investigation: rapid and simple detection of c-Ki-ras 2 gene codon 12 mutations by nonradioisotopic single-strand conformation polymorphism analysis. Lab Invest 1993;68:361-6. Kuramoto S, Ohara T. Minute cancers arising de novo in the human large intestine. Cancer 1988;61:829-34. Bedenne L, Faivre J, Boutron MC, Piard F, Cauvin JM, Hillon P. Adenoma-carcinoma sequence of “de novo” carcinogenesis? Cancer 1992;69:883-8. Fujii T, Rembacken BJ, Dixon MF, Yoshida S, Axon ATR. Flat adenomas in the United Kingdom: are treatable cancers being missed? Endoscopy 1998;30:437-43. Hart AR, Kudo S, Mackay EH, Atkin WS. Flat adenomas exist in asymptomatic people: important implications for colorectal cancer screening programmes. Gut 1998;43:229-31. Yokota T, Sugihara K, Yokoyama T, Kondo H, Oka M, Shirao K, et al. Small depressed cancer of the large bowel: report of three cases. Am J Gastroenterol 1995;90:134-6. Kudo S, Tamura S, Hirota Y, Sano Y, Yamano H, Serizawa M, et al. The problem of de novo colorectal carcinoma. Eur J Cancer 1995;31:1118-20. Lanspa SJ, Rouse J, Smyrk T, Watson P, Jenkins JX, Lynch HT. Epidemiological characteristics of the flat adenoma of Muto: a prospective study. Dis Colon Rectum 1992;35:543-6. Lynch HT, Smyrk TC, Watson P, Lanspa SJ, Lynch PM, Jenkins JX, et al. Hereditary flat adenoma syndrome: a variant of familial adenomatous polyposis? Dis Colon Rectum 1992;35:411-21. Muto T, Masaki T, Suzuki K. DNA ploidy pattern of flat adenomas of the large bowel. Dis Colon Rectum 1991;34:696-8. Wolber RA, Owen DA. Flat adenoma of the colon. Hum Pathol 1991;34:981-6. Rubio C, Watanabe T, Masaki T, Muto T. Histological differGASTROINTESTINAL ENDOSCOPY
449
K Kaneko, T Kurahashi, R Makino, et al.
ences between flat tubular colorectal neoplasia in Japan and Sweden. In Vivo 1997;11:93-4. 27. Mitooka H, Fujimori T, Maeda S. Minute flat depressed neoplastic lesions of the colon detected by contrast chromoscopy using an indigo carmine capsule. Gastrointest Endosc 1995; 41:453-9. 28. Imai Y, Terai T, Miwa H, Ohno Y, Ogihara T, Sato N. Marginal irregularity of flat elevated type of colorectal tumor as a marker of malignant potential. Gastrointest Endosc 1998; 48:263-6. 29. Kaneko K, Fujii T, Kato S, Boku N, Oda Y, Koba I, et al.
450
GASTROINTESTINAL ENDOSCOPY
Growth patterns of superficially elevated neoplasias
Growth patterns and genetic changes of colorectal carcinoma. Jpn J Clin Oncol 1998;28:196-201. 30. Kurahashi T, Kaneko K, Akita Y, Yoshikawa N, Yamada H, Nishikawa J, et al. Growth pattern and genetic pathway of colorectal carcinoma [abstract]. Gastroenterology 1997;113: A597. 31. Kaneko K, Kurahashi T, Makino R, Akita Y, Yoshikawa N, Mitamura K. Involvement of mutations of APC, Ki-ras and p53 genes to growth pattern of colorectal carcinomas [abstract]. Gut 1997;41:A252.
VOLUME 51, NO. 4, PART 1, 2000
Background: The growth pattern and malignant potential of superficially elevated neoplastic lesions remain controversial. A flat adenoma is classified as a superficially elevated neoplasm that characteristically demonstrates high-grade dysplasia despite its small size. In contrast, a noduleaggregating (NA) tumor, which consists of multiple small aggregated nodules, can also be classified as superficially elevated neoplasia. Methods: In this prospective study, 2720 consecutive patients undergoing total colonoscopy were examined for superficially for elevated lesions. Clinicopathologic characteristics, Ki-ras mutational status, and overexpression of p53 protein were compared in 25 NA tumors and 55 flat adenomas without a central depression (flat tumor). Results: All flat tumors had a tubular pattern, whereas 21 of 25 NA tumors showed a villotubular or tubulovillous pattern. Ki-ras mutation was observed in 44% of NA tumors but in none of the flat tumors. Overexpression of p53 protein was found in 12% of NA tumors and 7% of flat tumors. Conclusions: NA tumors and flat tumors have different clinicopathologic and genetic characteristics, although both types of tumor are classified as superficially elevated lesions. (Gastrointest Endosc 2000;51:443-50.)
The adenoma-carcinoma sequence model, in which carcinoma develops from adenoma, has been proposed for colorectal polypoid tumors.1-3 Various oncogenes and tumor suppressor genes, including the APC, Ki-ras, p53, and DCC genes, have been shown to be involved in the carcinogenesis of colorectal neoplasia. According to the model of Vogelstein et al.,4,5 mutations of the Ki-ras gene are early events and mutations of the p53 gene are late events in the development of polypoid neoplasia. Flat adenomas, which appear as superficially elevated smooth tumors and are often accompanied by a shallow depression, can be distinguished macroscopically from polypoid-type tumors, which grow upward from the mucosal layer.6 Flat adenomas characteristically demonstrate high-grade dysplasia despite their small size.7-9 The frequency of Ki-ras gene mutations is extremely low in these neoplastic lesions,10 suggesting that the process of tumorigenesis for flat adenomas differs from that for polypoid adenomas. It has been suggested that flat adenomas develop into nonpolypoid carcinomas.10 Received March 5, 1999. For revision June 3, 1999. Accepted October 26, 1999. From the Second Department of Internal Medicine, Showa University School of Medicine, Tokyo, Japan. Reprint requests: Kazuhiro Kaneko, MD, Second Department of Internal Medicine, Showa University School of Medicine, 1-5-8, Hatanodai, Shinagawa-ku, Tokyo 142-8666, Japan. Copyright © 2000 by the American Society for Gastrointestinal Endoscopy 0016-5107/2000/$12.00 + 0 37/1/104047 doi:10.1067/mge.2000.104047 VOLUME 51, NO. 4, PART 1, 2000
In Japan, early carcinomas and adenomas are classified macroscopically as protruding, flat elevated, flat, and depressed according to the Japanese Research Society for Cancer of the Colon and Rectum (JRSCCR).11 Flat adenomas are considered to be superficially elevated lesions with a smooth surface; they often have a shallow depression.6 In contrast, Kudo et al.12 described a particular type of nonpolypoid lesion known as a “depressed” lesion, in which the tumor surface is lower than the adjacent normal mucosa. Most depressed lesions, which are found in about 1 of 140 Japanese patients, are smaller than 10 mm. Importantly, among depressed lesions 6 to 10 mm in size, 50% had malignant tissue invading the submucosa. Kudo et al. emphasized that depressed neoplasms show a specific growth pattern that differs from that of superficially elevated neoplasia. Conversely, the growth pattern and malignant potential of superficially elevated neoplasia remain controversial. In this prospective study, we investigated the risk of malignancy and the growth pattern in such superficially elevated neoplasia without a central depression. Furthermore, we have found other tumors that could also be classified as superficially elevated type. The surfaces of these tumors are rough with multiple small aggregated nodules. We refer to such tumors as nodule-aggregating (NA) tumors or laterally spreading tumors (LST).13 this prospective study, the clinicopathologic characteristics and genetic changes in NA tumors were compared with those in flat adenomas without a central depression. GASTROINTESTINAL ENDOSCOPY
443
K Kaneko, T Kurahashi, R Makino, et al.
Growth patterns of superficially elevated neoplasias
Figure 2. Histologic appearance at low magnification of an NA tumor, 17 mm in diameter, obtained by endoscopic mucosal resection (H&E, orig. mag. ×1).
Table 1. Japanese classification of colorectal lesions
A
Protruding lesions
Flat elevated lesions
Flat lesions Depressed lesions
B Figure 1. A, Colonoscopic appearance of an NA tumor; B, colonoscopic appearance of an NA tumor with dye spray technique. PATIENTS AND METHODS In this study, 2720 consecutive symptomatic patients attending from April 1995 to March 1998 for colonoscopy were evaluated for superficially elevated neoplasia. Of these 2720 patients, 2530 (93%) underwent total colonoscopy. Patients who had advanced colorectal carcinomas (85 patients), had undergone surgical treatment for colorectal carcinoma (15 patients), had a hereditary predisposition to colon carcinoma (1 patient), or had inflammatory bowel disease (32 patients) were excluded from this study. Furthermore, 12 patients with superficially elevated lesions with a central depression and 4 patients with depressed lesions infiltrating the mucosa or submucosa were excluded, because the carcinogenesis of such lesions with a depression might differ from that of superficially elevated lesions without a depression. The remaining 2381 patients had an average age of 62 years and a male/female ratio of 10:9. Of these 2381 patients, 80 with superficially elevated neoplasia, which was defined endoscopically and histologically, made up the final study group. Twenty-five NA tumors (1.0%) and 55 flat tumors 444
GASTROINTESTINAL ENDOSCOPY
Classification
Macroscopic appearance
Ip Isp Is IIa IIa+IIc
Pedunculated polyps Subpedunculated polyps Sessile polyps Flat elevation of mucosa Flat elevation with central depression Flat mucosa Mucosal depression Mucosal depression with raised edge
IIb IIc IIc+IIa
(2.3%) were obtained by endoscopic mucosal resection or by surgical resection at our hospital. We used a CF-200 Z magnifying colonoscope (Olympus Optical Co., Ltd., Tokyo, Japan) and alternatively standard colonoscopes (Olympus 200 I or 230 I). A magnifying colonoscope, together with spraying of indigo carmine dye (0.2%), allows detailed examination of the mucosal crypt pattern of lesions with flat erythematous or discolored mucosa that by their appearance raise a suspicion of neoplasia. The depth of infiltration and epithelial atypia were assessed by examining H&E-stained sections. The macroscopic classification was made according to JRSCCR criteria (Table 1).11 Histologically, adenomas were categorized as showing mild, moderate, or severe atypia, and carcinomas were classified as intramucosal or submucosal according to the JRSCCR criteria.11 However, neoplasms that had the features of either adenoma with severe atypia or intramucosal carcinoma were categorized as highgrade dysplasia (HGD). Furthermore, adenomas that had the features of mild to moderate atypia were categorized as low-grade dysplasia (LGD). The glandular structures of these tumors were also assessed histologically. The degree of villous involvement was classified into 4 subcategories: more than 75% involvement, villous; 51% to 75% involvement, villotubular; 26% to 50% involvement, tubulovillous; and 0% to 25% involvement, tubular. In the H&Estained sections the maximum height in millimeters of the intramucosal lesion above the muscularis mucosa was measured at 4 points on the marginal area and at 2 points at the center of the tumor. The ratio of the maximum tumor size in millimeters to the mean height at the margin and center of the lesion was defined as the ratio of size to height for each tumor. VOLUME 51, NO. 4, PART 1, 2000
Growth patterns of superficially elevated neoplasias
K Kaneko, T Kurahashi, R Makino, et al.
A
A
B
B Figure 3. A, Colonoscopic appearance of a flat tumor; B, colonoscopic appearance of a flat tumor with dye spray technique.
Figure 4. Histologic appearance at low magnification of a flat tumor, 15 mm in diameter, obtained by endoscopic mucosal resection (H&E, orig. mag. × 1). All lesions were determined to be NA tumors or flat tumors on the basis of the following criteria. Tumors were classified as NA tumors if they had a uniformly rough surface with multiple small nodules (1 to 2 mm) and were only slightly elevated above the mucosal surface (Figs. 1 and 2). NA tumors with even 1 nodule over 5 mm in diameter were excluded. Flat tumors were defined as those in which the tumor was only slightly elevated without a central depression and with a smooth surface (Figs. 3 and 4). Analysis of Ki-ras gene mutations Cellular DNA was extracted from frozen biopsy specimens formalin-fixed and paraffin-embedded. The paraffinVOLUME 51, NO. 4, PART 1, 2000
Figure 5. A, After silver staining, Ki-ras mutations were visualized as shifted bands (arrow). N.C, Negative control; P.C, positive control; A, absence of Ki-ras mutation; P, presence of Kiras mutation. B, Nuclei of tumor cells strongly stained (overexpression of p53 immunohistochemistry, orig. mag. ×50). embedded tissues were cut into 10 µm thick sections and 2 to 4 of them were used for DNA extraction. Mutations of the Ki-ras gene were examined with polymerase chain reaction single-strand conformation polymorphism (PCRSSCP) analysis.14 DNA fragments that contained codons 12 and 13 of the Ki-ras gene were amplified with the following primers (Takara Inc., Tokyo, Japan): forward primer: 5´GACTGAATATAAACTTGTGG3´; reverse primer: 5´CTATTGTTGGATCATATTCG3´. PCR consisted of 40 cycles at 94°C for 30 seconds, 50°C for 2 minutes, and 72°C for 1 minute. PCR products were then analyzed by a nonisotopic SSCP technique and were visualized with silver staining (Bio-Rad, Hercules, Calif.) according to the protocol described by Orita et al.14 Briefly, PCR products were diluted 10-fold with 95% formamide and applied to a 12% polyacrylamide gel (3.3% cross linker) with Tris-glycine buffer. Electrophoresis was performed at 23°C. All codon 12 and 13 mutations of the Ki-ras gene were detectable under these SSCP conditions. After staining with silver, shifted bands were determined to be DNA fragments that had a mutation.15 As shown in Figure 5A, the shifted bands were visible after silver staining. Overexpression of p53 protein Overexpression of p53 protein was demonstrated by immunohistochemical staining of thin sections of formalin-fixed, paraffin-embedded tissues. Pab1801 (Oncogene Science, Cambridge, Mass.), a monoclonal antibody to p53 protein, was used, and the avidin-biotin-peroxidase GASTROINTESTINAL ENDOSCOPY
445
K Kaneko, T Kurahashi, R Makino, et al.
Growth patterns of superficially elevated neoplasias
Table 2. Clinicopathologic findings of NA and flat tumors NA tumor (n = 25) Mean age (yr) Male/female ratio Location Right colon Left colon Tumor size (mm) Mean Range < 10 mm ≥ 10 mm Glandular structure Tubular Tubulovillous Villotubular Grade of atypia HGD LGD Ratio of size to height Total HGD LGD
Flat tumor (n = 55)
p Value
61 1.9:1
NS NS
12 (48%) 13 (52%)
23 (42%) 32 (58%)
NS
22.6 8-55 2 (8%) 23 (92%)
10.1 4-25 36 (65%) 19 (35%)
< 0.02
4 (16%) 13 (52%) 8 (32%)
55 (100%) 0 (0%) 0 (0%)
< 0.0001
8 (32%) 17 (68%)
8* (15%) 47 (85%)
NS
19.1 23.3 18.1
NS
63 1.8:1
17.8 22.8 15.5
< 0.0001
NS, No significant difference between NA and flat tumors. *Includes 1 invasive carcinoma infiltrating the submucosa.
method was used.3 Tumor cells with strongly stained nuclei and diffusely or focally stained lesions were considered positive for p53 protein. A case was scored as positive for overexpression when more than 10% of the cells in the entire neoplastic component showed a positive nuclear reaction (Fig. 5B). Statistical analysis The significance of differences in variables was assessed with the chi-square test or the Mann-Whitney test. Differences with p values less than 0.05 were considered significant.
RESULTS Clinicopathologic characteristics of NA tumors Of the 25 NA tumors, 8 (32%) showed HGD and 17 (68%) LGD, including mild atypia in 6 cases and moderate atypia in 11 cases (Table 2). Twenty-one NA tumors included both villous and tubular structures; 8 tumors were villotubular and 13 were tubulovillous. The remaining 4 cases showed only tubular structures (Table 2). No tumors contained only villous components. High-grade NA tumors (mean size 36.2 mm) were significantly larger than low-grade NA tumors (16.4 mm) (p < 0.05). Furthermore, small nodules on the surface of the 25 NA tumors averaged 1.8 mm in diameter (range 0.8 to 3.5 mm). Comparison of NA tumors and flat tumors The clinicopathologic characteristics and genetic changes in the 25 NA tumors were compared with 446
GASTROINTESTINAL ENDOSCOPY
those in the 55 flat tumors. There were no significant differences in the mean age or male-female ratio between patients with NA and those with flat tumors (Table 2). The locations of the 25 NA tumors were as follows: 5 in the rectum (20%), 5 in the sigmoid colon (20%), 3 in the descending colon (12%), 2 in the transverse colon (8%), 2 in the ascending colon (8%), and 8 in the cecum (32%). In contrast, the locations of the 55 flat tumors were as follows: 25 in the sigmoid colon (45%), 8 in the descending colon (15%), 11 in the transverse colon (20%), and 11 in the ascending colon (20%). There was no significant difference between NA tumors (48%) and flat tumors (42%) with regard to the frequency with which they were located in the right colon. However, approximately half of the NA tumors were located in the rectum and cecum, whereas no flat tumors were found in the rectum or cecum. NA tumors were significantly larger than flat tumors (p < 0.02) (Table 2). In contrast, of the 36 flat tumors (65%) that were 10 mm or less in diameter, 35 (97%) showed LGD (Table 3). Conversely, only 2 NA tumors (8%) were less than 10 mm in diameter and both showed LGD. The prevalence of small lesions (less than 10 mm) differed significantly between the 2 groups (p < 0.0001) (Table 2). All 55 flat tumors had a tubular pattern, whereas most of the 25 NA tumors had a villotubular or tubulovillous pattern. The frequency of the tubular pattern was significantly higher in flat tumors (55 of 55, 100%) than in NA tumors (4 of 25, 16%) (p < VOLUME 51, NO. 4, PART 1, 2000
Growth patterns of superficially elevated neoplasias
K Kaneko, T Kurahashi, R Makino, et al.
Table 3. Tumor size and grade of histologic atypia Tumor size (mm)
Flat tumor (n = 55) LGD (n = 47) HGD (n = 8) NA tumor (n = 25) LGD (n = 17) HGD (n = 8)
≤4
5-9
10-19
20-29
30-39
≥40
10 —
25 1
12 4
— 3*
— —
— —
— —
2 —
10 1
4 3
1 1
— 3
Three cases containing 1 invasive carcinoma infiltrating the submucosa.
Table 4. Analysis of Ki-ras mutations and p53 protein overexpression Ki-ras gene mutations Flat tumor (n = 55) LGD (n = 47) HGD* (n = 8) NA tumor (n = 25) LGD (n = 17) HGD (n = 8)
0 0 0 11 7 4
(0%) (0%) (0%) (44%)‡ (41%) (50%)
p53 protein overexpression 4 0 4 3 0 3
(7%) (0%) (50%)† (12%) (0%) (38%)†
*Eight flat tumors including 1 invasive carcinoma infiltrating the submucosa. †Significantly different from LGD lesions. ‡Significantly different from flat tumors.
0.0001). The prevalence of HGD did not differ significantly between flat tumors (8 of 55, 15%) and NA tumors (8 of 25, 32%) (Table 3). The mean ratio of size to height did not differ significantly between NA tumors (17.8, range 7.2 to 28.2) and flat tumors (19.1, range 10.0 to 30.0). Furthermore, this ratio did not differ significantly between LGD and HGD lesions among either NA tumors (15.5 vs. 22.8) or flat tumors (18.1 vs. 23.3) (Table 3). Two patients with NA tumors underwent surgical resection with lymph node dissection, because their tumors were believed, on the basis of their large size (50 mm or larger), to have infiltrated the submucosa. Histologic examination of the resection specimens from these 2 patients revealed intramucosal lesions with HGD, but lymph node metastasis was not found after surgery. In contrast, 1 of 8 flat tumors with HGD had infiltrated the submucosa. Although this tumor was 20 mm in diameter, invasive carcinoma was diagnosed on the basis of the results of EUS and of crypt patterns observed with a magnifying colonoscope. Surgical resection with lymph node dissection was performed, and no metastatic lymph nodes were found. Analysis of Ki-ras mutations and p53 overexpression Mutation of Ki-ras gene was found in none of the flat tumors and in 44% of NA tumors (Table 4). This difference was significant (p < 0.0001). Of 11 NA VOLUME 51, NO. 4, PART 1, 2000
tumors with mutations of Ki-ras gene, 7 exhibited LGD and 4 HGD. The frequency of Ki-ras mutation did not differ significantly between NA tumors with LGD (7 of 17, 41%) and those with HGD (4 of 8, 50%) (Table 4). Furthermore, the incidence of Ki-ras mutation was not correlated with tumor size. The frequency of overexpression of p53 protein did not differ significantly between NA tumors (3 of 25, 12%) and flat tumors (4 of 55, 7%). The frequency of p53 overexpression was significantly higher in HGD lesions than in LGD lesions among both NA tumors (38% vs. 0%, p < 0.01) and flat tumors (50% vs. 0%, p < 0.0001) (Table 4). Although most NA tumors and flat tumors were intramucosal, a similar percentage (38% and 50%) of HGD lesions in the 2 groups showed p53 overexpression. In contrast, the frequency of Ki-ras mutation differed markedly between NA and flat tumors. DISCUSSION Recent studies in Japan have found a high incidence of flat or depressed colorectal carcinomas.6,8,9,16,17 In contrast, such lesions have been rarely noted in Western countries, perhaps because of different histologic criteria or population differences. Because the incidence of these types of tumors in the United Kingdom and Japan is similar when patients are studied with the Japanese colonoscopic technique described by Fujii et al.,18 the lower frequency in the West is probably due to flat and depressed neoplasia being mistaken for flat eryGASTROINTESTINAL ENDOSCOPY
447
K Kaneko, T Kurahashi, R Makino, et al.
thematous or discolored mucosa during colonoscopy. Recently, however, flat and depressed lesions have also been found in the West.18,19 In our prospective study, 2381 consecutive patients undergoing total colonoscopy were evaluated for flat and depressed neoplasia for 3 years, and such lesions were found in 80 (3.3%) and 16 (0.7%) patients, respectively. According to retrospective studies from Japan, 12% to 40% of adenomas and early colorectal carcinomas are flat rather than polypoid.20,21 Outside Japan, there have also been reports of small, flat neoplastic lesions. Lanspa et al.22 have concluded that flat adenomas are as prevalent as other adenomas and have suggested that flat adenomas represent an early stage of adenoma formation. Lynch et al.23 examined the clinical and pathologic features of 4 extended kindreds with hereditary flat adenoma syndrome and suggested that this condition is a variant of familial adenomatous polyposis. Some evidence suggests that flat elevated lesions have a higher malignant potential than polypoid lesions. Studies by Muto et al.24 have shown a much higher frequency of aneuploidy in flat elevated adenomas than in polypoid adenomas. Wolber and Owen25 have reported that small flat adenomas were 10 times more likely to contain HGD than were polypoid adenomas. Rubio et al.26 recently reported that 24.8% of a series of 141 resected flat adenomas in Japanese patients contained severe dysplasia compared with 13.3% of 90 lesions in Swedish patients. Our present study suggests that the risk of malignancy in flat tumors (14.5%) is similar to that reported previously. However, only 1 of 36 small flat tumors (less than 10 mm in diameter) showed HGD (2.8%) and the remaining 35 tumors showed LGD. Mitooka et al.27 reported severe atypia in 1.3% of diminutive polypoid adenomas. The risk of malignancy in small flat tumors may be the same as that in diminutive polypoid lesions. In contrast, 7 of 19 (37%) large flat tumors (10 mm or greater in diameter) showed HGD, including 1 invasive carcinoma (Dukes A). These results suggest that flat tumors without a central depression have enhanced malignant potential when they are 10 mm in diameter and larger. Imai et al.28 report that superficially elevated neoplasms, especially those more than 1 cm in diameter, with greater marginal irregularity had greater malignant potential. We propose that the malignant potential of small flat tumors without a central depression is lower than that of so-called flat adenomas, which are defined as small, flat elevated tumors, often with a shallow depression. One possible explanation for this discrepancy is that previous studies may have considered depressed or flat lesions with a central depression to be flat adeno448
GASTROINTESTINAL ENDOSCOPY
Growth patterns of superficially elevated neoplasias
mas. Kudo et al.12 have also reported that the incidence of severe dysplasia in small depressed lesions (6 to 10 mm) (50%) is higher than that in flat elevated neoplasia (2.4%). Fujii et al.18 report that 96% of flat lesions in English patients exhibited moderate dysplasia and the remaining 4% severe dysplasia that included a central depression. Furthermore, depressed lesions exhibited either severe dysplasia or invasive carcinoma. We suggest that the malignant potential of small flat lesions without a central depression is different from that of depressed lesions or flat lesions with a central depression. In the present study, clinicopathologic characteristics and genetic changes in NA tumors were compared with those in flat tumors. We found that NA tumors were significantly larger than flat tumors. Most (84%) NA tumors showed a tubulovillous or villotubular pattern, whereas all flat tumors demonstrated a tubular pattern. Furthermore, the frequency of Ki-ras mutations in the 25 NA tumors was 44%, whereas this mutation was not found in any of the 55 flat tumors. NA tumors and flat tumors differed greatly in size, glandular structure, and the incidence of Ki-ras mutation. According to the adenoma-carcinoma sequence model proposed by Vogelstein et al.,4,5 the Ki-ras gene makes adenomas larger and more severely dysplastic as an early event and the p53 gene is related to malignant transformation as a late event in the development of polypoid neoplasia. It is reasonable to speculate that the genetic pathway of NA tumors differs from that of flat tumors in the early events of carcinogenesis, because the incidence of Ki-ras mutation differed greatly between the 2 types of tumors and the frequency of p53 overexpression in NA tumors did not. Villotubular or tubulovillous glandular structures might play a greater role in the growth pattern of NA tumors. Furthermore, the villous component in NA tumors may be associated with tumor enlargement, because villous adenomas are often large. We suggest that the Ki-ras gene is related not only to the carcinogenesis of colorectal neoplasia but also to the proliferative ability of cells that grow in a villous pattern. The clinicopathologic and genetic characteristics of NA tumors differ from those of flat tumors in an early stage of carcinogenesis, although both NA tumors and flat tumors are macroscopically classified as superficially elevated. In contrast, the grade of histologic atypia tended to increase in both NA tumors and flat tumors as their size increased. Imai et al.28 also report that the histologic grade of atypia of superficially elevated neoplasms increases as their size increases. In a previous study, we assumed that polypoid neoplasia and depressed neoplasia would develop mostly VOLUME 51, NO. 4, PART 1, 2000
Growth patterns of superficially elevated neoplasias
upward and downward from the normal mucosa, respectively.29 However, we observed that these NA tumors and flat tumors spread horizontally along the mucosal layer and progressed neither upward nor downward at the center of the lesion. The mean ratio of size to height suggests that NA tumors and flat tumors should grow laterally along the mucosal layer, in as much as this ratio increases with atypia. We previously reported that 5% to 14% of invasive colorectal carcinomas have a laterally spreading growth pattern and that the genetic pathway in such carcinomas is different from that in polypoid or nonpolypoid growth-type tumors.30,31 We conclude that some superficially elevated neoplasms progress laterally along the mucosal surface. Most flat lesions may be difficult to detect at colonoscopy, and those in the present series only appeared as faint patches of mucosal hyperemia or discolored mucosa. Furthermore, 42% of flat tumors and 48% of NA tumors were located in the right colon and NA tumors were frequently found in the cecum (32%). To detect such lesions, we recommend total colonoscopy with indigo carmine dye spraying. Sigmoidoscopy is likely to miss flat lesions and cannot detect the 32% found in the proximal colon. If suspicious lesions are not sprayed with indigo carmine dye, their size and shape cannot be characterized accurately. Superficially elevated neoplasia without central depression can be classified into at least 2 groups that have different pathways for the development of colorectal cancers: flat adenomas with a smooth surface and NA tumors with a uniformly rough appearance and multiple small nodules. These tumors can be characterized by their growth patterns, i.e., superficial horizontal spread along the mucosal layer. We have reported a new growth pattern for colorectal tumors designated as NA tumors.
K Kaneko, T Kurahashi, R Makino, et al.
5. 6.
7. 8.
9.
10.
11.
12.
13.
14.
15.
16. 17.
18.
19.
ACKNOWLEDGMENT We thank Professor Mitsuo Kusano of the Second Department of Surgery, Showa University School of Medicine, for donating materials used in this study.
20.
21.
REFERENCES 1. Baker S, Preisinger AC, Jessup JM. p53 gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 1990;50:7717-22. 2. Kawasaki Y, Monden T, Morimoto H. Immunohistochemical study of p53 expression in microwave-fixed paraffin embedded sections of colorectal carcinoma and adenoma. Am J Clin Pathol 1992;97:244-9. 3. Levi E, Stryker SJ, Rao MS. p53 protein overexpression in colorectal tumors from patients with familial adenomatous polyposis: is it an early or late event? Am J Gastroenterol 1996;91:11-4. 4. Vogelstein B, Fearson ER, Hamilton SR, Kern SE, Preisinger VOLUME 51, NO. 4, PART 1, 2000
22.
23.
24. 25. 26.
AC, Leppert M, et al. Genetic alterations during colorectal tumor development. N Engl J Med 1988;319:525-32. Fearson ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 1990;61:759-67. Muto T, Kamiya J, Sawada T, Konishi F, Sugihara K, Kubota Y, et al. Small “flat adenoma” of the large bowel with special reference to its clinico-pathologic features. Dis Colon Rectum 1985;28:847-51. Robert A, Wolber MD, David A, Owen MB. Flat adenoma of the colon. Hum Pathol 1991;22:70-4. Tada S, Yao T, Iida M, Koga H, Hizawa K, Fujishima M. A clinicopathologic study of small flat colorectal carcinoma. Cancer 1994;74:2430-5. Matsumoto T, Iida M, Yao T, Fujishima M. Role of non-polypoid neoplastic lesions in the pathogenesis of colorectal cancer. Dis Colon Rectum 1994;37:450-5. Yamagata S, Muto T, Uchida Y, Masaki T, Higuchi Y, Sawada T, et al. Polypoid growth and K-ras codon 12 mutation in colorectal cancer. Cancer 1995;75:953-7. Japanese Research Society for Cancer of the Colon and Rectum. General rules for clinical and pathological studies on cancer of the colon, rectum and anus. Jpn J Surg 1983;13:557-73. Kudo S, Tamura T, Nakajima S, Sano Y, Yamano H, Serizawa M, et al. Depressed type of colorectal cancer. Endoscopy 1995;27:54-7. Kudo S. Endoscopic mucosal resection of flat adenoma and depressed types of early colorectal cancer. Endoscopy 1993;25:455-61. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-9. Sugano K, Kyogoku A, Fukuyama N, Ohkura H, Shimosato Y, Sekiya T, et al. Methods in laboratory investigation: rapid and simple detection of c-Ki-ras 2 gene codon 12 mutations by nonradioisotopic single-strand conformation polymorphism analysis. Lab Invest 1993;68:361-6. Kuramoto S, Ohara T. Minute cancers arising de novo in the human large intestine. Cancer 1988;61:829-34. Bedenne L, Faivre J, Boutron MC, Piard F, Cauvin JM, Hillon P. Adenoma-carcinoma sequence of “de novo” carcinogenesis? Cancer 1992;69:883-8. Fujii T, Rembacken BJ, Dixon MF, Yoshida S, Axon ATR. Flat adenomas in the United Kingdom: are treatable cancers being missed? Endoscopy 1998;30:437-43. Hart AR, Kudo S, Mackay EH, Atkin WS. Flat adenomas exist in asymptomatic people: important implications for colorectal cancer screening programmes. Gut 1998;43:229-31. Yokota T, Sugihara K, Yokoyama T, Kondo H, Oka M, Shirao K, et al. Small depressed cancer of the large bowel: report of three cases. Am J Gastroenterol 1995;90:134-6. Kudo S, Tamura S, Hirota Y, Sano Y, Yamano H, Serizawa M, et al. The problem of de novo colorectal carcinoma. Eur J Cancer 1995;31:1118-20. Lanspa SJ, Rouse J, Smyrk T, Watson P, Jenkins JX, Lynch HT. Epidemiological characteristics of the flat adenoma of Muto: a prospective study. Dis Colon Rectum 1992;35:543-6. Lynch HT, Smyrk TC, Watson P, Lanspa SJ, Lynch PM, Jenkins JX, et al. Hereditary flat adenoma syndrome: a variant of familial adenomatous polyposis? Dis Colon Rectum 1992;35:411-21. Muto T, Masaki T, Suzuki K. DNA ploidy pattern of flat adenomas of the large bowel. Dis Colon Rectum 1991;34:696-8. Wolber RA, Owen DA. Flat adenoma of the colon. Hum Pathol 1991;34:981-6. Rubio C, Watanabe T, Masaki T, Muto T. Histological differGASTROINTESTINAL ENDOSCOPY
449
K Kaneko, T Kurahashi, R Makino, et al.
ences between flat tubular colorectal neoplasia in Japan and Sweden. In Vivo 1997;11:93-4. 27. Mitooka H, Fujimori T, Maeda S. Minute flat depressed neoplastic lesions of the colon detected by contrast chromoscopy using an indigo carmine capsule. Gastrointest Endosc 1995; 41:453-9. 28. Imai Y, Terai T, Miwa H, Ohno Y, Ogihara T, Sato N. Marginal irregularity of flat elevated type of colorectal tumor as a marker of malignant potential. Gastrointest Endosc 1998; 48:263-6. 29. Kaneko K, Fujii T, Kato S, Boku N, Oda Y, Koba I, et al.
450
GASTROINTESTINAL ENDOSCOPY
Growth patterns of superficially elevated neoplasias
Growth patterns and genetic changes of colorectal carcinoma. Jpn J Clin Oncol 1998;28:196-201. 30. Kurahashi T, Kaneko K, Akita Y, Yoshikawa N, Yamada H, Nishikawa J, et al. Growth pattern and genetic pathway of colorectal carcinoma [abstract]. Gastroenterology 1997;113: A597. 31. Kaneko K, Kurahashi T, Makino R, Akita Y, Yoshikawa N, Mitamura K. Involvement of mutations of APC, Ki-ras and p53 genes to growth pattern of colorectal carcinomas [abstract]. Gut 1997;41:A252.
VOLUME 51, NO. 4, PART 1, 2000