- Email: [email protected]
Helicobacter pylori detection in human biopsies: a competitive PCR assay with internal control reveals false results
FEMS Immunology and Medical Microbiology 24 (1999) 201^208
Helicobacter pylori detection in human biopsies: a competitive PCR assay with internal control reveals false results A.-C.E. Thoreson a
1;a
, M. Borre 2;b , L.P. Andersen c , F. JÖrgensen d , S. Kiilerich d , J. Scheibel e , J. Rath f , K.A. Krogfelt a; *
Department of Gastrointestinal Infections, Statens Serum Institut, DK-2300 Copenhagen S, Denmark Department of Infection Immunology, Statens Serum Institut, DK-2300 Copenhagen S, Denmark Department of Clinical Microbiology, National University Hospital, DK-2100 Copenhagen, Denmark Department of Medical Gastroenterology, Glostrup University Hospital, DK-2600 Glostrup, Denmark e Department of Clinical Microbiology, Herlev University Hospital, DK-2730 Herlev Denmark f Department of Pathology, Glostrup University Hospital, DK-2600 Glostrup, Denmark
b c d
Received 25 November 1998 ; accepted 18 February 1999
Abstract A polymerase chain reaction assay (PCR) for the diagnosis of Helicobacter pylori in human gastric biopsies was developed. To prevent false-negative results while performing PCR on human tissues, an internal control is necessary. Primer set ACT1ACT2 which specifically amplifies a 542-bp fragment of the 16S rRNA gene of H. pylori was used. dUTP and hot-start were used to prevent false-positives from carryover of previous products and avoid non-specific extension products. A competitive internal control DNA fragment was constructed to detect the presence of inhibitors. Biopsies from 101 unselected patients with gastric symptoms were tested. PCR results were compared with results from microscopy of histological sections and conventional culturing for H. pylori. Forty-two percent of the biopsies were found to contain compounds inhibiting the PCR. The addition of the internal control assures the performance of the PCR assay and is an important quality control parameter. ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Helicobacter pylori; 16S rDNA primer; Hot-start; Deoxyuracil triphosphate; Internal control; Competitive polymerase chain reaction
1. Introduction * Corresponding author. Tel.: +45 32 68 37 45; Fax: +45 32 68 38 73; E-mail: [email protected] 1 Present address: Department of Medical Microbiology and Immunology, University of Go«teborg, Guldhedsgatan 10A, S-413 46 Go«teborg, Sweden. 2 Present address: PNA Diagnostics A/S, RÖnnegade 2, DK-2100 Copenhagen Ò, Denmark.
Helicobacter pylori was ¢rst isolated in the early 1980s. Since then great attention has been paid to revealing its role in the pathogenesis of gastroduodenal diseases and to developing techniques for its accurate detection [1,2]. Colonization of the human gastric mucosa by H. pylori may lead to acute and chronic infection resulting in gastritis, erosions and
0928-8244 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 9 2 8 - 8 2 4 4 ( 9 9 ) 0 0 0 2 7 - 9
FEMSIM 1018 6-5-99
202
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
ulcers. So far, most studies have con¢rmed that H. pylori causes chronic gastritis and is an important cause of peptic ulcer and is probably implicated in the pathogenesis of gastritis and gastric cancer [3,4]. A precise evaluation of the methods used to detect H. pylori is necessary for the correct diagnosis of upper gastrointestinal diseases. At present there are several techniques available for the detection of H. pylori. The sensitivity and speci¢city of the used diagnostic methods di¡er depending on the method, the handling of the specimen and the evaluation method. Advantages and disadvantages of each test have to be weighed against reliability and patient acceptability. In recent years the polymerase chain reaction (PCR) has become widely used for diagnostic purposes of fastidiously grown microorganisms. A number of di¡erent approaches have been described in successfully using PCR for the detection of H. pylori in gastric biopsies, gastric aspirates, tooth plaques and feces [5^10]. Even though the basic process of PCR is simple there are a huge number of variables, which have to be optimized in order to design a particular PCR protocol [11]. False-positive results may occur as a result of careless handling of PCR products and contamination through laboratory equipment. Little attention has been paid to falsenegative reactions, although it has been shown that samples of biological origin such as tissues, blood, sputum, and feces contain compounds inhibiting the polymerase chain reaction [12^15]. Recently, PCR techniques performed on pure H. pylori cultures proved to be unspeci¢c when used for the detection of H. pylori in clinical specimens [16]. In this study, the sensitivity and reliability of a previously developed PCR assay based on ampli¢cation of H. pylori 16S ribosomal DNA in human gastric biopsies [7] was improved. The sensitivity was improved by the use of hot-start and the use of deoxyuracil triphosphate (dUTP) instead of dTTP to the nucleotide mixture, an increased magnesium chloride concentration and an increased number of PCR cycles [17^19]. Most important, the reliability of the test was supported by the construction and addition of an internal PCR control. Ampli¢cation of internal control DNA fragment ensures that the specimen tested does not contain components that inhibit the PCR [20,21]. Thus, false-negative results
can virtually be avoided. The present competitive PCR was performed on human gastric biopsies and evaluated by comparing the results obtained by culture and histological examination of human gastric biopsies.
2. Materials and methods 2.1. Patients and biopsy sampling During a period of 1 year 106 consecutive patients were admitted for gastroscopy at Glostrup University Hospital because of dyspeptic complaints. None of the patients had previously received H. pylori eradication therapy or any anti-ulcer medication and no major gastric or duodenal surgery had been performed. One hundred and one patients (47 females and 54 males, median 53.2 years, range 17^ 83 years) were included in this study, ¢ve being excluded due to missing biopsy material. All patients had given their informed consent to participate in the study, which was approved by the local ethics committee. Endoscopic examination was performed and recorded: 44 patients with no abnormalities, eight having esophagitis, 17 gastritis, eight gastroduodenitis, nine prepyloric ulcer, three pyloric ulcer, 11 duodenal ulcer and one hiatus hernia. At least ¢ve antral biopsies were obtained from each patient. Two antral biopsies (from the large and small curvature, respectively) were transported in Stuart's medium to a microbiological facility for culturing within 24 h. Two other biopsies (from the large and small curvature, respectively) were ¢xed in phosphate bu¡ered formalin for histological examination and one antral biopsy was stored at 380³C in saline for PCR analysis. 2.2. Histological and microbiological examination Sections of formalin-¢xed biopsies, 5 mm thick, were examined for the presence of Helicobacter-like organisms (HLO) and the morphology was recorded after hematoxylin-eosin staining. In addition, immunohistochemical staining using polyclonal antibodies against HLOs was performed [22]. Biopsies for culturing were plated within 24 h on 7% de¢brinated horse blood agar plates (chocolate
FEMSIM 1018 6-5-99
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
agar plates) (SSI 700, Statens Serum Institut, Copenhagen). Plates were incubated for 3^6 days at 37³C under microaerophilic conditions (maximum oxygen concentration of 5%). H. pylori were identi¢ed from small translucent colonies as Gram-negative, motile curved rods being urease-, oxidase- and catalase-positive. Individual isolates were stored in 20% glycerol/ broth at 380³C. 2.3. Bacterial strains and growth conditions H. pylori CCUG 17874 was used as a positive control in all microbiological tests and PCR tests. H. pylori strains were grown on 5% horse blood agar plates and/or chocolate agar plates in 3% O2 , 5% CO2 and 92% N2 for 3^6 days. 2.4. Extraction of DNA from human gastric biopsies DNA was extracted from each biopsy as follows. The tissue was rinsed three times with saline and thoroughly minced using the blunt end of an Eppendorf tip by gently pipetting against the walls of an Eppendorf tube. The homogenate was boiled for 10 min and centrifuged at 30 000 rpm for 10 min in a bench centrifuge to remove tissue debris. The DNA supernatant was recovered and stored at 320³C. 2.5. Preparation of chromosomal H. pylori DNA Chromosomal DNA of the reference strain H. pylori CCUG 17874 was puri¢ed using a standard phenol-chloroform-isoamyl alcohol (25:24:1) extraction method [23]. 2.6. Selection and synthesis of primer set Primers ACT-1 and ACT-2 targeting H. pylori ribosomal 16S DNA sequences used in this study have previously been thoroughly described [7]. These primers were found to be highly speci¢c for H. pylori when tested against 35 related species [7]. 2.7. Construction of a DNA fragment for con¢rming DNA ampli¢cation The internal control consisted of a 2131-bp DNA
203
fragment £anked by the target sequences of primers ACT-1 and ACT-2 designed recently aiming to speci¢cally target H. pylori chromosomal DNA in clinical biopsies. The DNA fragment was created by PCR ampli¢cation of a portion of the glurp gene (nt 63^2140) [24] from Plasmodium falciparum, by means of the two primers DA 120: 5P- GCGAATTCCTTGCTAGAGTGCTGATTAAAGTGCAAAAACTAATACAAGTGAG- 3P and DA 121: 5P- GCGGATCCTCCCACACTCTAGAATAGTCAAATGGTTTTGAAGGAACTGGTCC- 3P. These primers contain sequences (written in bold-faced type) near the 5P ends that may be used as target by the H. pylori 16S rDNA primers ACT-1 and ACT-2. 2.8. PCR conditions during DNA ampli¢cation PCR was performed in a Perkin-Elmer Cetus thermal cycler 480. Reaction volumes of 100 ml were used for ampli¢cation. The target DNA was properly diluted in pure sterile PCR water in a laminar air£ow cabinet. A master mix of 70 ml was prepared in a separated room next to the ampli¢cation area, containing 0.5 mM of the oligonucleotide primers, 200 mM of dATP, dCTP, dGTP and 400 mM of dUTP. The optimal magnesium chloride ¢nal concentration was 1.0 mM. The master mix was prepared with and without the internal control DNA. Then the template and 50 ml of mineral oil were added. All PCR reactions were heated to 85³C for 10 min prior to addition of Taq polymerase using the thermostable Taq polymerase (Amplitaq; Perkin-Elmer Cetus, Stratagene, California). Preheating and the consecutive ampli¢cation steps were performed in thermoblocks suited for PCR tubes equipped with handles. During hot-start 1.25 U of Taq-polymerase per PCR reaction was diluted in 10 ml of Super Taq PCR reaction bu¡er (AH-Diagnostics, HT Biotechnology Limited) and added to the PCR reaction mixture at 85³C. The consecutive ampli¢cation steps were performed during 50 cycles, each cycle consisted of 1 min denaturation at 94³C, 1 min annealing at 60³C and 1 min extension at 72³C. 2.9. Detection of ampli¢ed products After PCR, the ampli¢ed target and internal con-
FEMSIM 1018 6-5-99
204
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
Fig. 1. Ampli¢cation of a titrated competetive positive internal control DNA fragment (2131 bp) and target H. pylori chromosomal DNA (542 bp). Lanes : M, 1-kb DNA molecular mass marker (Pharmacia); 1, PCR water control; 2^9, 10-fold dilution of positive internal control DNA fragment, up to 108 added to 0.1 pg of puri¢ed chromosomal DNA (CCUG 17874) to each PCR reaction.
trol DNA was detected by gel electrophoresis. 20 ml of the reaction mixture was separated in 1% NuSieve and 1% Sea Kem agarose gels (FMC Bioproducts, Vallensb×k, Denmark) in 0.5UTBE bu¡er (Tris, borate, EDTA). Consecutively the ampli¢ed bands were stained by ethidium bromide (0.5 mg ml31 ) and photographed.
or to adding of the Taq polymerase increased the speci¢city of the test (data not shown). Furthermore, dTTP was replaced with the double amount of dUTP since the incorporation of dUTP is lower [18], and the MgCl2 concentration was adjusted.
3. Results
The internal control consisting of a large foreign DNA fragment and an oligonucleotide from H. pylori rDNA results in a 2131-bp band while the H. pylori DNA results in a 542-bp band. Thus, any misinterpretations of the size of the bands on a gel were prevented. Serial dilutions of the internal control DNA fragment were added to 0.1 pg of puri¢ed chromosomal DNA from H. pylori CCUG 17874, equivalent to 50 chromosomes of H. pylori (see Fig. 1).
3.1. Detection of H. pylori in antral biopsies by histology and culturing H. pylori was cultured from biopsies of 44 patients. All but one of these patients were found to be positive for HLOs by histological examination. In biopsies from 11 patients, HLOs were observed by microscopy but not cultured (Table 1). One positive of two tests is considered the `gold standard'. Thus 55 patients were found H. pylori-positive. 3.2. Optimizing the PCR protocol for detection of H. pylori in clinical specimens Biopsies obtained from patients with no abnormalities observed by endoscopy and found to be culture-negative were used for optimizing the PCR method by `spiking' them with puri¢ed H. pylori DNA (0.1 pg per sample). By testing a series of temperatures it was found that hot-start at 85³C pri-
3.3. Competition of the internal control with the target DNA
Table 1 Detection of Helicobacter pylori in human gastric biopsies by PCR compared to the `gold standard': culture or histology Culture or histology (microscopy) PCR No. of patients
+ + 52
+ 3 3
3 + 9a
3 3 37
+ : positive ; 3 : negative result. a Five of the nine patients were H. pylori-positive by urea breath test or had IgG antibodies against H. pylori by Western blot.
FEMSIM 1018 6-5-99
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
205
Fig. 2. PCR detection of H. pylori in seven human gastric biopsies using 16S rDNA primers ACT1 and ACT2 and by adding a 105 dilution of the internal control DNA fragment. Lanes: M, 1-kb DNA molecular mass marker (Pharmacia); 1, 8 and 17, PCR water control; PC, positive control amplifying puri¢ed H. pylori DNA with the internal control DNA. Lanes : 2^7 and 9^16, material extracted from gastric biopsies (GB) with and without internal control DNA (IC); 2, positive gastric biopsy A (GB A) with IC; 3, GB A without IC; 4, positive gastric biopsy B (GB B) with IC; 5, GB B without IC; 6, positive gastric biopsy A (GB C) with IC; 7, GB C without IC; 9, positive gastric biopsy B (GB D) with IC; 10, GB D without IC; 11, positive gastric biopsy A (GB E) with IC; 12, GB E without IC; 13, positive gastric biopsy F (GB F) with IC; 14, GB F without IC; 15, positive gastric biopsy G (GB G) with IC; 16, GB G without IC. Positions of the 542-bp target and the 2131-bp internal control ampli¢cations are indicated.
3.4. Detection of H. pylori DNA in human biopsies by competitive PCR Each of the biopsy samples was run twice simultaneously. In one tube, the internal control was added along with the target DNA and in the other equal amounts of PCR water were added. A PCR run was considered satisfactory (i.e. not inhibited), when the internal control and/or the H. pylori band were visible on the agarose gel. No ampli¢cation of the internal control (IC) was considered a `bad run' and PCR was repeated in a two-fold serial dilution. A satisfactory ampli¢cation of the internal control was achieved in all clinical samples after an aqueous 1:10 dilution. Representative H. pylori positive PCR results from 7 human clinical gastric specimens are shown in Fig. 2. Positive gastric biopsies A, B, D, E, and F resulted in two distinct bands on the agarose gel when the IC is added in the PCR reaction (lanes 2, 4, 9, 11, and 13) and one band of 542 bp without the IC (lanes 3, 5, 10, 12, and 14). In gastric biopsies (GB C and GB G) where the H. pylori band of 542 bp is not present (lanes 6 and 16) while the IC is ampli¢ed and that H. pylori band of 542 bp is ampli¢ed in the PCR reac-
tion where no IC is added. Most probably these biopsies originally contained less than 50 H. pylori chromosomes. Thus, the competition for the primers amplifying both fragments might be too strong. In negative gastric biopsies (data not shown) where the IC was added, the H. pylori band of 542 bp and/or the IC was not ampli¢ed because of tissue inhibitory components extracted. However, by diluting these samples (1:10), the PCR was completed successfully. Without the presence of the internal control, false negative and false positive samples would have been wrongly interpreted. Forty-three of the 101 direct ampli¢cations of extracted DNA from the biopsies were considered `bad runs', i.e. 42% of the clinical samples contained inhibitory components preventing DNA ampli¢cation. By the second PCR in 1:10 dilution H. pylori DNA was ampli¢ed in 13/43 samples that would have been de¢ned as negative by the ¢rst PCR. Overall, H. pylori DNA was detected by direct PCR in 61 of 101 biopsies. H. pylori was isolated or HLO was observed in biopsies from 55 of the patients. Nine biopsies were found positive by PCR only (see Table 1). By additional urea breath test and
FEMSIM 1018 6-5-99
206
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
serology [25], ¢ve of these nine patients were found to be H. pylori-positive.
4. Discussion H. pylori may be di¤cult to detect from human gastric biopsies by culture, microscopy and urea breath test when present in low numbers. It has been shown that transportation time and temperature can interfere with culturing [26]. Furthermore, coccoid forms may be induced by exposure to oxygen and high temperature. These forms are viable but are di¤cult to culture [27,28]. Therefore, a rapid and reliable test based on 16S rDNA competitive PCR has been developed for the detection of H. pylori DNA in human gastric biopsies. In this study, ¢ve antral biopsies were obtained from each of 101 patients with dyspeptic symptoms. Culture, histology and PCR were performed in different laboratories where the diagnostic assays were performed individually. The PCR protocol was based on primers speci¢cally targeting H. pylori 16S rDNA developed by Thoreson et al. [7]. Even small amounts of tissue material can interfere with the performance of the polymerase reaction [15,21,29]. Therefore, emphasis was placed on developing a gentle method for DNA extraction. The magnesium chloride concentration was adjusted and boiling was used for lysis of the bacteria. Furthermore, the PCR assay was improved by the hot-start technique and carryover products were avoided by replacing dTTP with dUTP. The hot-start technique avoids the formation of non-speci¢c extension products, thereby preventing ampli¢cation of hybridized contaminants, which may in£uence the speci¢city and also the sensitivity because of competition between speci¢c and non-speci¢c templates for the reaction components. To ensure that the PCR reaction was not inhibited by tissue components, a DNA fragment was constructed serving as an internal positive control and co-ampli¢ed with the original DNA extracted from the biopsy. The internal control fragment of 2131 bp was constructed as such to result in a band very distinct from that of the target DNA of 542 bp. Thus, the result cannot be misinterpreted when looking at the gels. Furthermore, the internal control was
based on DNA from the parasite Plasmodium falciparum, which is unrelated to H. pylori and other gastric bacteria. In our study, it was shown that 42% of the clinical samples contained inhibitory components, which prevented the ampli¢cation of the internal control and would be considered `negative' samples. Thirteen of those `negative' samples (i.e. 30%) were found to be positive after diluting the sample and achieving a successful PCR including the ampli¢cation of the IC. Of 101 patients tested for the presence of H. pylori, 55 were found positive by culture or histology. Fifty-two of these were H. pylori-positive by the developed PCR. Forty-six patients were negative by culturing or histology, and nine were positive by PCR (Table 1). It has been shown that ¢ve of these nine patients were positive by either urea breath test or serology [25]. Thus, only four patients were positive by PCR alone, which may be explained by the patchy colonization of H. pylori in the gastric mucosa or more likely by contamination of the biopsies by H. pylori DNA from the endoscopes. The PCR technique failed to detect H. pylori DNA in three biopsies, which were positive for H. pylori by culture or histology in other biopsies obtained from the same patient. This could be explained by the fact that H. pylori colonizes the gastric mucosa in a patchy manner or the bacteria were present in very low numbers (i.e. fewer than 50 bacteria). We can rule out that the results are false-negative since the internal control con¢rmed that the PCR technique worked properly. However, improper handling (e.g. prolonged transportation, storage at room temperature) of the biopsy sample could result in degradation of the H. pylori DNA. It is well known that culture of H. pylori fails in 10^20% of the patients, which is not surprising since H. pylori is a fastidious microorganism and factors such as long transportation time, exposure to oxygen, and storage in an improper medium will a¡ect the ability of the bacterium to survive. Furthermore, it has been shown that H. pylori grown under unfavorable conditions can transform into a coccoidal state or a dormant non-culturable form, which will not be cultured in this study setup and probably will not be seen by microscopy [27,28]. The PCR technique has the advantage that bacterial DNA can be detected although the bacteria are not culturable or
FEMSIM 1018 6-5-99
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
do not have the characteristic shape that can be recognized by microscopic examination of the biopsy [30,31]. In this study, the development of a con¢rmational PCR technique for the detection of H. pylori in human biopsies is presented. The technique was compared to conventional techniques, i.e. culturing and histology. Ampli¢cation of the internal control with the DNA obtained from human gastric biopsies revealed inhibition of the polymerase reaction in 42% of the 101 samples. Without the use of the internal control 12% of the samples would have been interpreted as a negative result. Overall, the PCR technique is a reliable method for the detection of H. pylori in human gastric biopsies when the quality is controlled. The need for an internal control while performing PCR on human tissue material is here emphasized.
[7]
[8]
[9]
[10]
[11] [12]
Acknowledgements Special thanks to Kirsten Pedersen, Mona S. Nilsson, and Hanne Kubert for excellent technical assistance. We are grateful for interesting discussions with JÖrgen Skov Jensen. This work was supported by the Nordic Academy Foundation of Science, NorFA (A.-C.E.T. received a mobility grant).
[13]
[14]
References [15] [1] Graham, D.Y. (1991) Helicobacter pylori: its epidemiology and its role in duodenal ulcer disease. J. Gastroenterol. Hepatol. 6, 105^113. [2] Marshall, B.J. and Warren, J.R. (1984) Unidenti¢ed curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet i, 1311^1315. [3] Buck, G.E. (1990) Campylobacter pylori and gastroduodenal disease. Clin. Microbiol. Rev. 3, 1^12. [4] Taylor, N.D. and Parsonnet, J. (1995) Epidemiology and natural history of helicobacter infections. In: Infection of the Gastrointestinal Tract (Blaser, M.J., Smith, P.D., Ravdin, J.I., Greenberg, H.B. and Guerrant, R.L., Eds.), pp. 565^ 589. Raven Press, New York. [5] Monteiro, L., Birac, C. and Me¨graud, F. (1996) Detection of Helicobacter pylori in gastric biopsy by polymerase chain reaction. In: Helicobacter pylori: Techniques for Clinical Diagnosis and Basic Research (Lee, A. and Me¨graud, F., Eds.), pp. 112^119. W.B. Saunders, London. [6] Nguyen, A.-M.H., Engstrand, L., Genta, R.B., Graham, D.Y.
[16]
[17] [18]
[19]
[20]
207
and El-Zaatari, A.K. (1993) Detection of Helicobacter pylori in dental plaque by reverse transcription polymerase chain reaction. J. Clin. Microbiol. 31, 783^787. Thoreson, A.E., Borre, M.B., Andersen, L.P., Elsborg, L., Holck, S., Conway, P., Henrichsen, J., Vuust, J. and Krogfelt, K.A. (1995) Development of ribosomal 16S RNA primers for detection of Helicobacter pylori strains by polymerase chain reaction (PCR). FEMS Immunol. Med. Microbiol. 10, 325^ 334. Van Zwet, A.A., Thijs, J.C., Kooistra-Smid, A.M.D., Schirm, J. and Snijder, J.M.A. (1993) Sensitivity of culture compared with that of polymerase chain reaction for detection of Helicobacter pylori from antral biopsy samples. J. Clin. Microbiol. 31, 1918^1920. Wang, J.T., Lin, J.T., Sheu, J.C., Yang, J.C., Chen, D.S. and Wang, T.H. (1993) Detection of Helicobacter pylori in gastric biopsy tissue by polymerase chain reaction. Eur. J. Clin. Microbiol. Infect. Dis. 12, 367^371. Westblom, T.U., Phadnis, S., Yang, P. and Czinn, S.J. (1993) Diagnosis of Helicobacter pylori infection by means of a polymerase chain reaction assay for gastric juice aspirates. Clin. Infect. Dis. 16, 367^371. Cha, R.S. and Thilly, W.G. (1993) Speci¢city, e¤ciency and ¢delity of PCR. PCR Methods Appl. 3, (Suppl.) S18^S29. Covacci, A. and Rappuoli, R. (1996) PCR ampli¢cation of gene sequences from Helicobacter pylori strains. In: Helicobacter pylori :Ttechniques for Clinical Diagnosis and Basic Research (Lee, A. and Me¨graud, F., Eds.), pp. 94^112. W.B. Saunders, London. Lantz, P.G., Matsson, M., Wadsto«m, T. and Ra®dstro«m, P. (1997) Removal of PCR inhibitors from human faecal samples through the use of an aqueous two phase system for sample preparation prior to PCR. J. Microbiol. Methods 28, 159^167. Monteiro, L., Bonnemaison, D., Vekris, A., Petry, K.G., Bonnet, J., Vidal, R., Cabrita, J. and Me¨graud, F. (1997) Complex polysaccharides as PCR inhibitors on feces: Helicobacter pylori model. J. Clin. Microbiol. 35, 995^998. Nolte, F.S., Metchock, B., McGowan, J.E., Edwards, A., Okwumabua, O., Thurmond, C., Mitchell, P.S., Plikaytis, B. and Shinnick, T. (1993) Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization. J. Clin. Microbiol. 31, 1777^1782. Chong, S.K.F., Lou, Q., Fitzgerald, J.F. and Lee, C.-H. (1996) Evaluation of 16S rRNA gene PCR with primers Hp1 and Hp2 for detection of Helicobacter pylori. J. Clin. Microbiol. 34, 2728^2730. Kitchen, P.A., Szotyori, Z., Fromholc, C. and Almond, N. (1990) Avoidance of false positives. Nature 344, 201. Longo, M.C., Berninger, M.S. and Hartley, J.L. (1990) Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene 93, 125^128. Mullis, K. (1991) The polymerase chain reaction in an anemic mode: how to avoid cold deoxyribonuclear fusion. PCR Methods Appl. 1, 1^4. Cone, R.W., Hobson, A.C. and Huang, M.L.W. (1992) Coampli¢ed positive control detects inhibition of polymerase chain reactions. J. Clin. Microbiol. 30, 3185^3189.
FEMSIM 1018 6-5-99
208
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
[21] Ursi, J.-P., Ursi, D., Ieven, M. and Pattyn, S.R. (1992) Utility of an internal control for the polymerase chain reaction. APMIS 100, 635^639. [22] Andersen, L.P., Holck, S. and Povlsen, C.O. (1988) Campylobacter pylori detected by indirect immunohistochemical technique. APMIS 96, 559^664. [23] Gingeras, T.R., Davis, G.R., Whit¢eld, K.M., Chappelle, H.L., DiMichele, L.J. and Kwoh, D.Y. (1990) A transcription-based ampli¢cation system. In: PCR Protocols. A Guide to Methods and Applications (Innis, M.A., Ed.), pp. 245^253. Academic Press, San Diego, CA. [24] Borre, M.B,Dziegiel,M., HÖgh, B., Petersen, E., Rieneck, K., Riley, E., Meis, J.F., Aikawa, M., Nakamura, K., Harada, M., Wind, A., Jakobsen, P.H., Cowland, J., Jespen, S., Axelsen, N. and Vuust, J. (1991) Primary structure and localization of a conserved immunogenic Plasmodium falciparum glutamate rich protein (GLURP) expressed in both the preerythrocytic and erythrocytic stages of the vertebrate life cycle. Mol. Biochem. Parasit. 49, 119^132. [25] Andersen, L.P., Kiilerick, S., Pedersen, G., Thoresson, A.C., JÖrgensen, F., Rath, J., Larsen, N.-E., BÖrup, O., Krogfelt, K.A., Scheibel, J. and Rune, S. (1998) An analysis of seven di¡erent methods to diagnose Helicobacter pylori infections. Scand. J. Gastroenterol. 33, 24^30.
[26] Veenendaal, R.A., Lichtendahl-Bernards, A.T., Pena, A.S., Endtz, H.P., van Boven, C.P.A. and Lamers, C.B.H.W. (1993) E¡ect of transport medium and transportation time on culture of Helicobacter pylori from gastric biopsy specimens. J. Clin. Pathol. 46, 561^563. [27] Bode, G., Mauch, F. and Malfertheiner, P. (1993) The coccoid forms of Helicobacter pylori. Criteria for their viability. Epidemiol. Infect. 111, 483^490. [28] Vijayakumari, S., Khin, M.M., Jiang, B. and Ho, B. (1995) The pathogenic role of the coccoid form of Helicobacter pylori. Cytobios 82, 251^260. [29] Higuchi, R. (1989) Simple and rapid preparation of samples for PCR. In: PCR ^ Technology, Principles and Application for DNA Ampli¢cation (Erlich, H.A., Ed.), pp. 31^38. Stockton Press, New York. [30] Lin, T.T., Yeh, D.T., Yang, E. and Chen, P.C. (1996) Detection of Helicobacter pylori by polymerase chain reaction assay using biopsy specimens taken for CLO test. J. Gastroenterol. 31, 329^332. [31] Narikawa, S., Kawai, S., Aoshima, H., Kawata, O., Kawaguchi, R., Hikiji, K., Kato, M., Iino, S. and Mizushima, Y. (1997) Comparison of nucleic acids of helical and coccoid forms of Helicobacter pylori. Clin. Diagn. Lab. Immunol. 4, 285^290.
FEMSIM 1018 6-5-99
Helicobacter pylori detection in human biopsies: a competitive PCR assay with internal control reveals false results A.-C.E. Thoreson a
1;a
, M. Borre 2;b , L.P. Andersen c , F. JÖrgensen d , S. Kiilerich d , J. Scheibel e , J. Rath f , K.A. Krogfelt a; *
Department of Gastrointestinal Infections, Statens Serum Institut, DK-2300 Copenhagen S, Denmark Department of Infection Immunology, Statens Serum Institut, DK-2300 Copenhagen S, Denmark Department of Clinical Microbiology, National University Hospital, DK-2100 Copenhagen, Denmark Department of Medical Gastroenterology, Glostrup University Hospital, DK-2600 Glostrup, Denmark e Department of Clinical Microbiology, Herlev University Hospital, DK-2730 Herlev Denmark f Department of Pathology, Glostrup University Hospital, DK-2600 Glostrup, Denmark
b c d
Received 25 November 1998 ; accepted 18 February 1999
Abstract A polymerase chain reaction assay (PCR) for the diagnosis of Helicobacter pylori in human gastric biopsies was developed. To prevent false-negative results while performing PCR on human tissues, an internal control is necessary. Primer set ACT1ACT2 which specifically amplifies a 542-bp fragment of the 16S rRNA gene of H. pylori was used. dUTP and hot-start were used to prevent false-positives from carryover of previous products and avoid non-specific extension products. A competitive internal control DNA fragment was constructed to detect the presence of inhibitors. Biopsies from 101 unselected patients with gastric symptoms were tested. PCR results were compared with results from microscopy of histological sections and conventional culturing for H. pylori. Forty-two percent of the biopsies were found to contain compounds inhibiting the PCR. The addition of the internal control assures the performance of the PCR assay and is an important quality control parameter. ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Helicobacter pylori; 16S rDNA primer; Hot-start; Deoxyuracil triphosphate; Internal control; Competitive polymerase chain reaction
1. Introduction * Corresponding author. Tel.: +45 32 68 37 45; Fax: +45 32 68 38 73; E-mail: [email protected] 1 Present address: Department of Medical Microbiology and Immunology, University of Go«teborg, Guldhedsgatan 10A, S-413 46 Go«teborg, Sweden. 2 Present address: PNA Diagnostics A/S, RÖnnegade 2, DK-2100 Copenhagen Ò, Denmark.
Helicobacter pylori was ¢rst isolated in the early 1980s. Since then great attention has been paid to revealing its role in the pathogenesis of gastroduodenal diseases and to developing techniques for its accurate detection [1,2]. Colonization of the human gastric mucosa by H. pylori may lead to acute and chronic infection resulting in gastritis, erosions and
0928-8244 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 9 2 8 - 8 2 4 4 ( 9 9 ) 0 0 0 2 7 - 9
FEMSIM 1018 6-5-99
202
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
ulcers. So far, most studies have con¢rmed that H. pylori causes chronic gastritis and is an important cause of peptic ulcer and is probably implicated in the pathogenesis of gastritis and gastric cancer [3,4]. A precise evaluation of the methods used to detect H. pylori is necessary for the correct diagnosis of upper gastrointestinal diseases. At present there are several techniques available for the detection of H. pylori. The sensitivity and speci¢city of the used diagnostic methods di¡er depending on the method, the handling of the specimen and the evaluation method. Advantages and disadvantages of each test have to be weighed against reliability and patient acceptability. In recent years the polymerase chain reaction (PCR) has become widely used for diagnostic purposes of fastidiously grown microorganisms. A number of di¡erent approaches have been described in successfully using PCR for the detection of H. pylori in gastric biopsies, gastric aspirates, tooth plaques and feces [5^10]. Even though the basic process of PCR is simple there are a huge number of variables, which have to be optimized in order to design a particular PCR protocol [11]. False-positive results may occur as a result of careless handling of PCR products and contamination through laboratory equipment. Little attention has been paid to falsenegative reactions, although it has been shown that samples of biological origin such as tissues, blood, sputum, and feces contain compounds inhibiting the polymerase chain reaction [12^15]. Recently, PCR techniques performed on pure H. pylori cultures proved to be unspeci¢c when used for the detection of H. pylori in clinical specimens [16]. In this study, the sensitivity and reliability of a previously developed PCR assay based on ampli¢cation of H. pylori 16S ribosomal DNA in human gastric biopsies [7] was improved. The sensitivity was improved by the use of hot-start and the use of deoxyuracil triphosphate (dUTP) instead of dTTP to the nucleotide mixture, an increased magnesium chloride concentration and an increased number of PCR cycles [17^19]. Most important, the reliability of the test was supported by the construction and addition of an internal PCR control. Ampli¢cation of internal control DNA fragment ensures that the specimen tested does not contain components that inhibit the PCR [20,21]. Thus, false-negative results
can virtually be avoided. The present competitive PCR was performed on human gastric biopsies and evaluated by comparing the results obtained by culture and histological examination of human gastric biopsies.
2. Materials and methods 2.1. Patients and biopsy sampling During a period of 1 year 106 consecutive patients were admitted for gastroscopy at Glostrup University Hospital because of dyspeptic complaints. None of the patients had previously received H. pylori eradication therapy or any anti-ulcer medication and no major gastric or duodenal surgery had been performed. One hundred and one patients (47 females and 54 males, median 53.2 years, range 17^ 83 years) were included in this study, ¢ve being excluded due to missing biopsy material. All patients had given their informed consent to participate in the study, which was approved by the local ethics committee. Endoscopic examination was performed and recorded: 44 patients with no abnormalities, eight having esophagitis, 17 gastritis, eight gastroduodenitis, nine prepyloric ulcer, three pyloric ulcer, 11 duodenal ulcer and one hiatus hernia. At least ¢ve antral biopsies were obtained from each patient. Two antral biopsies (from the large and small curvature, respectively) were transported in Stuart's medium to a microbiological facility for culturing within 24 h. Two other biopsies (from the large and small curvature, respectively) were ¢xed in phosphate bu¡ered formalin for histological examination and one antral biopsy was stored at 380³C in saline for PCR analysis. 2.2. Histological and microbiological examination Sections of formalin-¢xed biopsies, 5 mm thick, were examined for the presence of Helicobacter-like organisms (HLO) and the morphology was recorded after hematoxylin-eosin staining. In addition, immunohistochemical staining using polyclonal antibodies against HLOs was performed [22]. Biopsies for culturing were plated within 24 h on 7% de¢brinated horse blood agar plates (chocolate
FEMSIM 1018 6-5-99
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
agar plates) (SSI 700, Statens Serum Institut, Copenhagen). Plates were incubated for 3^6 days at 37³C under microaerophilic conditions (maximum oxygen concentration of 5%). H. pylori were identi¢ed from small translucent colonies as Gram-negative, motile curved rods being urease-, oxidase- and catalase-positive. Individual isolates were stored in 20% glycerol/ broth at 380³C. 2.3. Bacterial strains and growth conditions H. pylori CCUG 17874 was used as a positive control in all microbiological tests and PCR tests. H. pylori strains were grown on 5% horse blood agar plates and/or chocolate agar plates in 3% O2 , 5% CO2 and 92% N2 for 3^6 days. 2.4. Extraction of DNA from human gastric biopsies DNA was extracted from each biopsy as follows. The tissue was rinsed three times with saline and thoroughly minced using the blunt end of an Eppendorf tip by gently pipetting against the walls of an Eppendorf tube. The homogenate was boiled for 10 min and centrifuged at 30 000 rpm for 10 min in a bench centrifuge to remove tissue debris. The DNA supernatant was recovered and stored at 320³C. 2.5. Preparation of chromosomal H. pylori DNA Chromosomal DNA of the reference strain H. pylori CCUG 17874 was puri¢ed using a standard phenol-chloroform-isoamyl alcohol (25:24:1) extraction method [23]. 2.6. Selection and synthesis of primer set Primers ACT-1 and ACT-2 targeting H. pylori ribosomal 16S DNA sequences used in this study have previously been thoroughly described [7]. These primers were found to be highly speci¢c for H. pylori when tested against 35 related species [7]. 2.7. Construction of a DNA fragment for con¢rming DNA ampli¢cation The internal control consisted of a 2131-bp DNA
203
fragment £anked by the target sequences of primers ACT-1 and ACT-2 designed recently aiming to speci¢cally target H. pylori chromosomal DNA in clinical biopsies. The DNA fragment was created by PCR ampli¢cation of a portion of the glurp gene (nt 63^2140) [24] from Plasmodium falciparum, by means of the two primers DA 120: 5P- GCGAATTCCTTGCTAGAGTGCTGATTAAAGTGCAAAAACTAATACAAGTGAG- 3P and DA 121: 5P- GCGGATCCTCCCACACTCTAGAATAGTCAAATGGTTTTGAAGGAACTGGTCC- 3P. These primers contain sequences (written in bold-faced type) near the 5P ends that may be used as target by the H. pylori 16S rDNA primers ACT-1 and ACT-2. 2.8. PCR conditions during DNA ampli¢cation PCR was performed in a Perkin-Elmer Cetus thermal cycler 480. Reaction volumes of 100 ml were used for ampli¢cation. The target DNA was properly diluted in pure sterile PCR water in a laminar air£ow cabinet. A master mix of 70 ml was prepared in a separated room next to the ampli¢cation area, containing 0.5 mM of the oligonucleotide primers, 200 mM of dATP, dCTP, dGTP and 400 mM of dUTP. The optimal magnesium chloride ¢nal concentration was 1.0 mM. The master mix was prepared with and without the internal control DNA. Then the template and 50 ml of mineral oil were added. All PCR reactions were heated to 85³C for 10 min prior to addition of Taq polymerase using the thermostable Taq polymerase (Amplitaq; Perkin-Elmer Cetus, Stratagene, California). Preheating and the consecutive ampli¢cation steps were performed in thermoblocks suited for PCR tubes equipped with handles. During hot-start 1.25 U of Taq-polymerase per PCR reaction was diluted in 10 ml of Super Taq PCR reaction bu¡er (AH-Diagnostics, HT Biotechnology Limited) and added to the PCR reaction mixture at 85³C. The consecutive ampli¢cation steps were performed during 50 cycles, each cycle consisted of 1 min denaturation at 94³C, 1 min annealing at 60³C and 1 min extension at 72³C. 2.9. Detection of ampli¢ed products After PCR, the ampli¢ed target and internal con-
FEMSIM 1018 6-5-99
204
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
Fig. 1. Ampli¢cation of a titrated competetive positive internal control DNA fragment (2131 bp) and target H. pylori chromosomal DNA (542 bp). Lanes : M, 1-kb DNA molecular mass marker (Pharmacia); 1, PCR water control; 2^9, 10-fold dilution of positive internal control DNA fragment, up to 108 added to 0.1 pg of puri¢ed chromosomal DNA (CCUG 17874) to each PCR reaction.
trol DNA was detected by gel electrophoresis. 20 ml of the reaction mixture was separated in 1% NuSieve and 1% Sea Kem agarose gels (FMC Bioproducts, Vallensb×k, Denmark) in 0.5UTBE bu¡er (Tris, borate, EDTA). Consecutively the ampli¢ed bands were stained by ethidium bromide (0.5 mg ml31 ) and photographed.
or to adding of the Taq polymerase increased the speci¢city of the test (data not shown). Furthermore, dTTP was replaced with the double amount of dUTP since the incorporation of dUTP is lower [18], and the MgCl2 concentration was adjusted.
3. Results
The internal control consisting of a large foreign DNA fragment and an oligonucleotide from H. pylori rDNA results in a 2131-bp band while the H. pylori DNA results in a 542-bp band. Thus, any misinterpretations of the size of the bands on a gel were prevented. Serial dilutions of the internal control DNA fragment were added to 0.1 pg of puri¢ed chromosomal DNA from H. pylori CCUG 17874, equivalent to 50 chromosomes of H. pylori (see Fig. 1).
3.1. Detection of H. pylori in antral biopsies by histology and culturing H. pylori was cultured from biopsies of 44 patients. All but one of these patients were found to be positive for HLOs by histological examination. In biopsies from 11 patients, HLOs were observed by microscopy but not cultured (Table 1). One positive of two tests is considered the `gold standard'. Thus 55 patients were found H. pylori-positive. 3.2. Optimizing the PCR protocol for detection of H. pylori in clinical specimens Biopsies obtained from patients with no abnormalities observed by endoscopy and found to be culture-negative were used for optimizing the PCR method by `spiking' them with puri¢ed H. pylori DNA (0.1 pg per sample). By testing a series of temperatures it was found that hot-start at 85³C pri-
3.3. Competition of the internal control with the target DNA
Table 1 Detection of Helicobacter pylori in human gastric biopsies by PCR compared to the `gold standard': culture or histology Culture or histology (microscopy) PCR No. of patients
+ + 52
+ 3 3
3 + 9a
3 3 37
+ : positive ; 3 : negative result. a Five of the nine patients were H. pylori-positive by urea breath test or had IgG antibodies against H. pylori by Western blot.
FEMSIM 1018 6-5-99
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
205
Fig. 2. PCR detection of H. pylori in seven human gastric biopsies using 16S rDNA primers ACT1 and ACT2 and by adding a 105 dilution of the internal control DNA fragment. Lanes: M, 1-kb DNA molecular mass marker (Pharmacia); 1, 8 and 17, PCR water control; PC, positive control amplifying puri¢ed H. pylori DNA with the internal control DNA. Lanes : 2^7 and 9^16, material extracted from gastric biopsies (GB) with and without internal control DNA (IC); 2, positive gastric biopsy A (GB A) with IC; 3, GB A without IC; 4, positive gastric biopsy B (GB B) with IC; 5, GB B without IC; 6, positive gastric biopsy A (GB C) with IC; 7, GB C without IC; 9, positive gastric biopsy B (GB D) with IC; 10, GB D without IC; 11, positive gastric biopsy A (GB E) with IC; 12, GB E without IC; 13, positive gastric biopsy F (GB F) with IC; 14, GB F without IC; 15, positive gastric biopsy G (GB G) with IC; 16, GB G without IC. Positions of the 542-bp target and the 2131-bp internal control ampli¢cations are indicated.
3.4. Detection of H. pylori DNA in human biopsies by competitive PCR Each of the biopsy samples was run twice simultaneously. In one tube, the internal control was added along with the target DNA and in the other equal amounts of PCR water were added. A PCR run was considered satisfactory (i.e. not inhibited), when the internal control and/or the H. pylori band were visible on the agarose gel. No ampli¢cation of the internal control (IC) was considered a `bad run' and PCR was repeated in a two-fold serial dilution. A satisfactory ampli¢cation of the internal control was achieved in all clinical samples after an aqueous 1:10 dilution. Representative H. pylori positive PCR results from 7 human clinical gastric specimens are shown in Fig. 2. Positive gastric biopsies A, B, D, E, and F resulted in two distinct bands on the agarose gel when the IC is added in the PCR reaction (lanes 2, 4, 9, 11, and 13) and one band of 542 bp without the IC (lanes 3, 5, 10, 12, and 14). In gastric biopsies (GB C and GB G) where the H. pylori band of 542 bp is not present (lanes 6 and 16) while the IC is ampli¢ed and that H. pylori band of 542 bp is ampli¢ed in the PCR reac-
tion where no IC is added. Most probably these biopsies originally contained less than 50 H. pylori chromosomes. Thus, the competition for the primers amplifying both fragments might be too strong. In negative gastric biopsies (data not shown) where the IC was added, the H. pylori band of 542 bp and/or the IC was not ampli¢ed because of tissue inhibitory components extracted. However, by diluting these samples (1:10), the PCR was completed successfully. Without the presence of the internal control, false negative and false positive samples would have been wrongly interpreted. Forty-three of the 101 direct ampli¢cations of extracted DNA from the biopsies were considered `bad runs', i.e. 42% of the clinical samples contained inhibitory components preventing DNA ampli¢cation. By the second PCR in 1:10 dilution H. pylori DNA was ampli¢ed in 13/43 samples that would have been de¢ned as negative by the ¢rst PCR. Overall, H. pylori DNA was detected by direct PCR in 61 of 101 biopsies. H. pylori was isolated or HLO was observed in biopsies from 55 of the patients. Nine biopsies were found positive by PCR only (see Table 1). By additional urea breath test and
FEMSIM 1018 6-5-99
206
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
serology [25], ¢ve of these nine patients were found to be H. pylori-positive.
4. Discussion H. pylori may be di¤cult to detect from human gastric biopsies by culture, microscopy and urea breath test when present in low numbers. It has been shown that transportation time and temperature can interfere with culturing [26]. Furthermore, coccoid forms may be induced by exposure to oxygen and high temperature. These forms are viable but are di¤cult to culture [27,28]. Therefore, a rapid and reliable test based on 16S rDNA competitive PCR has been developed for the detection of H. pylori DNA in human gastric biopsies. In this study, ¢ve antral biopsies were obtained from each of 101 patients with dyspeptic symptoms. Culture, histology and PCR were performed in different laboratories where the diagnostic assays were performed individually. The PCR protocol was based on primers speci¢cally targeting H. pylori 16S rDNA developed by Thoreson et al. [7]. Even small amounts of tissue material can interfere with the performance of the polymerase reaction [15,21,29]. Therefore, emphasis was placed on developing a gentle method for DNA extraction. The magnesium chloride concentration was adjusted and boiling was used for lysis of the bacteria. Furthermore, the PCR assay was improved by the hot-start technique and carryover products were avoided by replacing dTTP with dUTP. The hot-start technique avoids the formation of non-speci¢c extension products, thereby preventing ampli¢cation of hybridized contaminants, which may in£uence the speci¢city and also the sensitivity because of competition between speci¢c and non-speci¢c templates for the reaction components. To ensure that the PCR reaction was not inhibited by tissue components, a DNA fragment was constructed serving as an internal positive control and co-ampli¢ed with the original DNA extracted from the biopsy. The internal control fragment of 2131 bp was constructed as such to result in a band very distinct from that of the target DNA of 542 bp. Thus, the result cannot be misinterpreted when looking at the gels. Furthermore, the internal control was
based on DNA from the parasite Plasmodium falciparum, which is unrelated to H. pylori and other gastric bacteria. In our study, it was shown that 42% of the clinical samples contained inhibitory components, which prevented the ampli¢cation of the internal control and would be considered `negative' samples. Thirteen of those `negative' samples (i.e. 30%) were found to be positive after diluting the sample and achieving a successful PCR including the ampli¢cation of the IC. Of 101 patients tested for the presence of H. pylori, 55 were found positive by culture or histology. Fifty-two of these were H. pylori-positive by the developed PCR. Forty-six patients were negative by culturing or histology, and nine were positive by PCR (Table 1). It has been shown that ¢ve of these nine patients were positive by either urea breath test or serology [25]. Thus, only four patients were positive by PCR alone, which may be explained by the patchy colonization of H. pylori in the gastric mucosa or more likely by contamination of the biopsies by H. pylori DNA from the endoscopes. The PCR technique failed to detect H. pylori DNA in three biopsies, which were positive for H. pylori by culture or histology in other biopsies obtained from the same patient. This could be explained by the fact that H. pylori colonizes the gastric mucosa in a patchy manner or the bacteria were present in very low numbers (i.e. fewer than 50 bacteria). We can rule out that the results are false-negative since the internal control con¢rmed that the PCR technique worked properly. However, improper handling (e.g. prolonged transportation, storage at room temperature) of the biopsy sample could result in degradation of the H. pylori DNA. It is well known that culture of H. pylori fails in 10^20% of the patients, which is not surprising since H. pylori is a fastidious microorganism and factors such as long transportation time, exposure to oxygen, and storage in an improper medium will a¡ect the ability of the bacterium to survive. Furthermore, it has been shown that H. pylori grown under unfavorable conditions can transform into a coccoidal state or a dormant non-culturable form, which will not be cultured in this study setup and probably will not be seen by microscopy [27,28]. The PCR technique has the advantage that bacterial DNA can be detected although the bacteria are not culturable or
FEMSIM 1018 6-5-99
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
do not have the characteristic shape that can be recognized by microscopic examination of the biopsy [30,31]. In this study, the development of a con¢rmational PCR technique for the detection of H. pylori in human biopsies is presented. The technique was compared to conventional techniques, i.e. culturing and histology. Ampli¢cation of the internal control with the DNA obtained from human gastric biopsies revealed inhibition of the polymerase reaction in 42% of the 101 samples. Without the use of the internal control 12% of the samples would have been interpreted as a negative result. Overall, the PCR technique is a reliable method for the detection of H. pylori in human gastric biopsies when the quality is controlled. The need for an internal control while performing PCR on human tissue material is here emphasized.
[7]
[8]
[9]
[10]
[11] [12]
Acknowledgements Special thanks to Kirsten Pedersen, Mona S. Nilsson, and Hanne Kubert for excellent technical assistance. We are grateful for interesting discussions with JÖrgen Skov Jensen. This work was supported by the Nordic Academy Foundation of Science, NorFA (A.-C.E.T. received a mobility grant).
[13]
[14]
References [15] [1] Graham, D.Y. (1991) Helicobacter pylori: its epidemiology and its role in duodenal ulcer disease. J. Gastroenterol. Hepatol. 6, 105^113. [2] Marshall, B.J. and Warren, J.R. (1984) Unidenti¢ed curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet i, 1311^1315. [3] Buck, G.E. (1990) Campylobacter pylori and gastroduodenal disease. Clin. Microbiol. Rev. 3, 1^12. [4] Taylor, N.D. and Parsonnet, J. (1995) Epidemiology and natural history of helicobacter infections. In: Infection of the Gastrointestinal Tract (Blaser, M.J., Smith, P.D., Ravdin, J.I., Greenberg, H.B. and Guerrant, R.L., Eds.), pp. 565^ 589. Raven Press, New York. [5] Monteiro, L., Birac, C. and Me¨graud, F. (1996) Detection of Helicobacter pylori in gastric biopsy by polymerase chain reaction. In: Helicobacter pylori: Techniques for Clinical Diagnosis and Basic Research (Lee, A. and Me¨graud, F., Eds.), pp. 112^119. W.B. Saunders, London. [6] Nguyen, A.-M.H., Engstrand, L., Genta, R.B., Graham, D.Y.
[16]
[17] [18]
[19]
[20]
207
and El-Zaatari, A.K. (1993) Detection of Helicobacter pylori in dental plaque by reverse transcription polymerase chain reaction. J. Clin. Microbiol. 31, 783^787. Thoreson, A.E., Borre, M.B., Andersen, L.P., Elsborg, L., Holck, S., Conway, P., Henrichsen, J., Vuust, J. and Krogfelt, K.A. (1995) Development of ribosomal 16S RNA primers for detection of Helicobacter pylori strains by polymerase chain reaction (PCR). FEMS Immunol. Med. Microbiol. 10, 325^ 334. Van Zwet, A.A., Thijs, J.C., Kooistra-Smid, A.M.D., Schirm, J. and Snijder, J.M.A. (1993) Sensitivity of culture compared with that of polymerase chain reaction for detection of Helicobacter pylori from antral biopsy samples. J. Clin. Microbiol. 31, 1918^1920. Wang, J.T., Lin, J.T., Sheu, J.C., Yang, J.C., Chen, D.S. and Wang, T.H. (1993) Detection of Helicobacter pylori in gastric biopsy tissue by polymerase chain reaction. Eur. J. Clin. Microbiol. Infect. Dis. 12, 367^371. Westblom, T.U., Phadnis, S., Yang, P. and Czinn, S.J. (1993) Diagnosis of Helicobacter pylori infection by means of a polymerase chain reaction assay for gastric juice aspirates. Clin. Infect. Dis. 16, 367^371. Cha, R.S. and Thilly, W.G. (1993) Speci¢city, e¤ciency and ¢delity of PCR. PCR Methods Appl. 3, (Suppl.) S18^S29. Covacci, A. and Rappuoli, R. (1996) PCR ampli¢cation of gene sequences from Helicobacter pylori strains. In: Helicobacter pylori :Ttechniques for Clinical Diagnosis and Basic Research (Lee, A. and Me¨graud, F., Eds.), pp. 94^112. W.B. Saunders, London. Lantz, P.G., Matsson, M., Wadsto«m, T. and Ra®dstro«m, P. (1997) Removal of PCR inhibitors from human faecal samples through the use of an aqueous two phase system for sample preparation prior to PCR. J. Microbiol. Methods 28, 159^167. Monteiro, L., Bonnemaison, D., Vekris, A., Petry, K.G., Bonnet, J., Vidal, R., Cabrita, J. and Me¨graud, F. (1997) Complex polysaccharides as PCR inhibitors on feces: Helicobacter pylori model. J. Clin. Microbiol. 35, 995^998. Nolte, F.S., Metchock, B., McGowan, J.E., Edwards, A., Okwumabua, O., Thurmond, C., Mitchell, P.S., Plikaytis, B. and Shinnick, T. (1993) Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization. J. Clin. Microbiol. 31, 1777^1782. Chong, S.K.F., Lou, Q., Fitzgerald, J.F. and Lee, C.-H. (1996) Evaluation of 16S rRNA gene PCR with primers Hp1 and Hp2 for detection of Helicobacter pylori. J. Clin. Microbiol. 34, 2728^2730. Kitchen, P.A., Szotyori, Z., Fromholc, C. and Almond, N. (1990) Avoidance of false positives. Nature 344, 201. Longo, M.C., Berninger, M.S. and Hartley, J.L. (1990) Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene 93, 125^128. Mullis, K. (1991) The polymerase chain reaction in an anemic mode: how to avoid cold deoxyribonuclear fusion. PCR Methods Appl. 1, 1^4. Cone, R.W., Hobson, A.C. and Huang, M.L.W. (1992) Coampli¢ed positive control detects inhibition of polymerase chain reactions. J. Clin. Microbiol. 30, 3185^3189.
FEMSIM 1018 6-5-99
208
A.-C.E. Thoreson et al. / FEMS Immunology and Medical Microbiology 24 (1999) 201^208
[21] Ursi, J.-P., Ursi, D., Ieven, M. and Pattyn, S.R. (1992) Utility of an internal control for the polymerase chain reaction. APMIS 100, 635^639. [22] Andersen, L.P., Holck, S. and Povlsen, C.O. (1988) Campylobacter pylori detected by indirect immunohistochemical technique. APMIS 96, 559^664. [23] Gingeras, T.R., Davis, G.R., Whit¢eld, K.M., Chappelle, H.L., DiMichele, L.J. and Kwoh, D.Y. (1990) A transcription-based ampli¢cation system. In: PCR Protocols. A Guide to Methods and Applications (Innis, M.A., Ed.), pp. 245^253. Academic Press, San Diego, CA. [24] Borre, M.B,Dziegiel,M., HÖgh, B., Petersen, E., Rieneck, K., Riley, E., Meis, J.F., Aikawa, M., Nakamura, K., Harada, M., Wind, A., Jakobsen, P.H., Cowland, J., Jespen, S., Axelsen, N. and Vuust, J. (1991) Primary structure and localization of a conserved immunogenic Plasmodium falciparum glutamate rich protein (GLURP) expressed in both the preerythrocytic and erythrocytic stages of the vertebrate life cycle. Mol. Biochem. Parasit. 49, 119^132. [25] Andersen, L.P., Kiilerick, S., Pedersen, G., Thoresson, A.C., JÖrgensen, F., Rath, J., Larsen, N.-E., BÖrup, O., Krogfelt, K.A., Scheibel, J. and Rune, S. (1998) An analysis of seven di¡erent methods to diagnose Helicobacter pylori infections. Scand. J. Gastroenterol. 33, 24^30.
[26] Veenendaal, R.A., Lichtendahl-Bernards, A.T., Pena, A.S., Endtz, H.P., van Boven, C.P.A. and Lamers, C.B.H.W. (1993) E¡ect of transport medium and transportation time on culture of Helicobacter pylori from gastric biopsy specimens. J. Clin. Pathol. 46, 561^563. [27] Bode, G., Mauch, F. and Malfertheiner, P. (1993) The coccoid forms of Helicobacter pylori. Criteria for their viability. Epidemiol. Infect. 111, 483^490. [28] Vijayakumari, S., Khin, M.M., Jiang, B. and Ho, B. (1995) The pathogenic role of the coccoid form of Helicobacter pylori. Cytobios 82, 251^260. [29] Higuchi, R. (1989) Simple and rapid preparation of samples for PCR. In: PCR ^ Technology, Principles and Application for DNA Ampli¢cation (Erlich, H.A., Ed.), pp. 31^38. Stockton Press, New York. [30] Lin, T.T., Yeh, D.T., Yang, E. and Chen, P.C. (1996) Detection of Helicobacter pylori by polymerase chain reaction assay using biopsy specimens taken for CLO test. J. Gastroenterol. 31, 329^332. [31] Narikawa, S., Kawai, S., Aoshima, H., Kawata, O., Kawaguchi, R., Hikiji, K., Kato, M., Iino, S. and Mizushima, Y. (1997) Comparison of nucleic acids of helical and coccoid forms of Helicobacter pylori. Clin. Diagn. Lab. Immunol. 4, 285^290.
FEMSIM 1018 6-5-99