- Email: [email protected]
Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury Yingli Qiao a, Fei Xiao b, Wenkai Li b, Mingyong Yu b, Peng Du b, Zheping Fang a, Jie Sun a, c, * a b c
Department of Hepatobiliary Surgery, Taizhou Hospital of Zhejiang Province, Wenzhou Medical University, Linhai, Zhejiang, 317000, China Department of Organ Transplantation, Liaocheng People’s Hospital, Liaocheng, Shandong, 252000, China Department of Endocrinology, Liaocheng People’s Hospital, Liaocheng, Shandong, 252000, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 November 2019 Accepted 8 November 2019 Available online xxx
Hepatocyte-derived inducible nitric oxide synthase (iNOS) was proved to impart protection against liver ischemia reperfusion (I/R) injury in our prior analysis. However, the mechanism for this hepatoprotection remains incompletely understood. Bone marrow chimeric mice were generated using expression of iNOS in a hepatocyte-selective manner against an iNOS-knockout background. The function of heme oxygenase 1 (HO-1) in iNOS-stimulated hepatoprotection and the molecular mechanisms were explored in vitro and in vivo, respectively. Hepatocyte-derived iNOS conferred protection from I/R injury and anoxia/reoxygenation stimulation. Mechanistically, iNOS activated nuclear factor erythroid 2-related factor 2 (Nrf-2) and subsequently, stimulated the transcription of HO-1. Results from our study led to the conclusion that HO-1 is another potent mediator of iNOS-mediated protection after liver I/R. © 2019 Elsevier Inc. All rights reserved.
Keywords: Liver Reperfusion injury HO-1 iNOS
1. Introduction Ischemia reperfusion (I/R) injury unavoidably develops during liver operation, and, represents the primary cause for acute hepatic dysfunction, and even rejection after transplantation [1]. As the main challenge in liver transplantation, I/R injury contributes to graft shortage. Although its clinical importance is obvious, the pathogenesis of IRI is not yet clear, and there is no effective treatment to prevent or treat this disease [2]. The pathological mechanisms of I/R injury are complex, involving innate immune activation, multifaceted players, and the perturbation of cellular interactions between hepatocytes and nonparenchymal cells [3]. Much of the research into this field has focused on nonparenchymal cells. However, the role of hepatocytes, as the largest population in the liver, is understudied [4]. I/R induces acute phase proteins expression, including inducible nitric oxide synthase (iNOS) and C-reactive protein [5]. We previously identified a protective function of iNOS in I/R injury [6]; however, the mechanism that accounts for hepatoprotection still need to be
* Corresponding author. Department of Hepatobiliary Surgery, Taizhou Hospital of Zhejiang Province, Wenzhou Medical University, No 150 Ximen Road, Linhai, Zhejiang, 317000, China. E-mail address: [email protected] (J. Sun).
clarified further. In response to environmental stress, hepatocytes are not mere passive victims of injury, but active participants to initiate defensive mechanisms, including heat shock proteins (HSPs) and antioxidative cytoprotectants such as heme oxygenase 1 (HO-1) [7]. Our prior results reported that HSP70 was not the only cytoprotectant in iNOS-induced hepatoprotection [6]. Here we explored whether HO-1 functions in iNOS-mediated protection in hepatocytes.
2. Materials and methods 2.1. Animal care and protocol iNOS knockout (KO) and wild-type (WT) C57BL/6 mice were raised in pathogen-free conditions. Mice were 8e10 weeks old and of the same genetic background The animal programme was sanctioned by the Committee on Animal Care and Use. As mentioned previously [8], chimerism is produced with iNOS KO and WT mice by transferring green fluorescent protein-labelled donor bone marrow cells to recipient animals that had been previously irradiated. The recipient/donor groupings are as follows: WT/KO and KO/KO.
https://doi.org/10.1016/j.bbrc.2019.11.053 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
2
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.2. In vivo model of hepatic I/R injury
2.6. Western blot
As mentioned previously [8], a partial warm I/R injury model was generated. Except for the control group, all mice were treated with 60min of portal triad occlusion, and then reperfused for 6 and 24 h. After reperfusion, the morphometric and pathological parameters were analyzed.
Antibodies against iNOS (Abcam, USA), nuclear factor erythroid 2-related factor 2 (Nrf-2) (Abcam), HO-1 (Boster, China), and GAPDH (Abcam) were used to measure protein by Western blot analysis. 2.7. Immunohistochemistry
2.3. Cell culture and transfection Isolation and culture of primary hepatocytes was performed as described [9]. Hepatocytes anoxia/reoxygenation (A/R) in vitro was conducted in accordance with prior studies [2]. iNOS transfection was conducted using pcDNA3.1(þ) plasmid. Inhibition of HO-1 was conducted using 20 mM of ZnPP (Sellseck, Houston, TX, USA) based on prior studies.
The immunohistochemical staining for HO-1 was conducted using a DAKO (Glostrup, Denmark) detection system. 2.8. Evaluation of apoptosis Cellular apoptosis was detected through flow cytometry using an Annexin V/propidium iodide (PI) staining kit (Beyotime, China) following established protocol.
2.4. Evaluation of hepatic injury
2.9. Evaluation of cell viability
Quantification of serum alanine transaminase (ALT) levels were used to evaluate liver injury after reperfusion from blood samples acquired at the indicated timepoints. Measurement of ALT was carried out by model 7150, a conventional automatic analyzer (Tokyo, Japan).
The CCK8 assay (KeyGen, NanJing, China) was utilized to examine cell viability as per manufacturer’s established protocol. 2.10. Statistical analysis
2.5. Gene expression analysis
Statistical analysis was conducted using Kaplan-Meier or ANOVA test. Analysis results are represented as mean ± SD. P < 0.05 denotes statistical significance.
iNOS, HO-1, and GAPDH mRNA expression was evaluated using quantitative real-time polymerase chain reaction (qRT-PCR). Table 1 includes list of primers.
3. Results 3.1. iNOS upregulates HO-1
Table 1 Primers for qRT-PCR. Gene
Forward primers
Reverse primers
GAPDH iNOS HO-1
CCAGTATGACTCCACTCACG AGGAGGAGAGAGATCCGATTTAG GACATGGCCTTCTGGTATGG
GACTCCACGACATACTCAGC TCAGACTTCCCTGTCTCAGTAG CTCGTGGAGACGCTTTACATAG
As previously documented [6], liver I/R led to a substantial upregulation in the protein expression of hepatic iNOS, in parallel with HO-1 protein, throughout 24 h after reperfusion (Fig. 1B and C). Consistent with the results of Western blot, the immunohistochemistry analysis showed stronger staining of HO-1 protein in hepatocytes after I/R (Fig. 1A). We also confirmed the above results
Fig. 1. iNOS upregulates liver HO-1 expression. (A) HO-1 immunohistochemical staining in hepatocytes in the Control, KO/KO, and WT/KO mice post-reperfusion. (B) Western blot analysis and (C) measurement of HO-1 expression in liver samples at 6 h and 24 h post-reperfusion. GAPDH was used as control; n ¼ 3; *P < 0.05 refers to comparison with the KO/ KO group.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
in primary hepatocytes that were exposed to A/R insult. In accordance with in vivo results, HO-1 levels were higher in WT hepatocytes, especially in hepatocytes with overexpression of iNOS (Fig. 2AeE), indicating that iNOS has an important function in induction of HO-1 expression. 3.2. iNOS derived from hepatocytes protects against I/R injury Chimeric mice with a hepatocyte-specific pattern of iNOS
3
expression were generated to explore the role of iNOS in an in vivo model of hepatic I/R damage. Specific iNOS expression in hepatocytes was confirmed using immunohistochemistry and Western blot. Consistent with our previous results [6], hepatocyte-specific iNOS deletion resulted in exacerbated liver injury compared with WT mice, characterized by severe disruption of lobular architecture (Fig. 3A) and higher serum ALT levels (Fig. 3B), indicating the hepatoprotection of iNOS derived from hepatocytes. In vitro treatment of A/R induced hepatocyte damage, apoptosis
Fig. 2. iNOS upregulates HO-1 in primary hepatocytes. (A and B) Expression of iNOS (A) and HO-1 (B) mRNA in primary hepatocytes exposed to A/R. (CeE) Western blot analysis (C) and expression of iNOS (D) and HO-1 (E) in primary hepatocytes after A/R exposure. GAPDH was used as control (n ¼ 3). *P < 0.05 refers to comparison with the corresponding controls.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
4
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
and reduced cell viability, which were exacerbated by iNOS deficiency and weakened by iNOS overexpression (Fig. 3CeE). In order to validate whether the upregulation of HO-1 by iNOS was involved in the hepatocyte protection, ZnPP was used to inhibit HO-1, resulting in aggravating hepatocyte injury (Fig. 3CeE). These results indicate that HO-1 is responsible for the iNOS-mediated liver protection.
3.3. iNOS activates Nrf2 Previous research reported that Nrf2 was the major transcription factor regulating the transcriptional level of HO-1 [10]. Under normal conditions, Nrf2 exists in the cytosol of the non-activated cell, and its activation is related to nuclear relocation. In this
Fig. 3. Hepatocellular iNOS shields against I/R injury. (A) The liver sections from control, KO/KO and WT/KO mice were stained with HE at 6 and 24 h after reperfusion(B) Serum ALT levels at 6 and 24 h after reperfusion; n ¼ 6e8. *P < 0.05 refers to comparison with KO/KO group. (C) The level of ALT in the primary hepatocyte culture medium exposed to A/R. n ¼ 3. *P < 0.05 and #P < 0.05 refers to comparison with KO þ Vehicle þ A/R and KO þ ZnPP þ A/R group, respectively. (D) Cell viability was evaluated through CCK8 assay. *P < 0.05 and #P < 0.05 refers to comparison with KO þ Vehicle þ A/R and KO þ ZnPP þ A/R group, respectively. (F) Apoptosis was quantified by annexin V/PI staining. *P < 0.05 and #P < 0.05 refers to comparison with the KO þ Vehicle þ A/R and the KO þ ZnPP þ A/R group, respectively.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. iNOS increases Nrf2 nuclear translocation. (A) Western blot analysis and (B) measurement of Nrf2 in nucleus of primary hepatocytes exposed to A/R in comparison to corresponding controls. *P < 0.05 indicates statistical significance.
study, we conducted Western blot to quantitatively analyze the nuclear content of Nrf2. The increased Nrf2 expression in the nucleus of hepatocytes indicated that it becomes activated by iNOS after transfection (Fig. 4A and B), suggesting that Nrf2 is related to the gene expression of HO-1 after gene transfer of iNOS. 4. Discussion Previously [6], we have shown the high expression of endogenous hepatic iNOS in hepatocytes and inflammatory cells. The precise role of endogenous iNOS remains controversial in this setting, with contributing to the liver injury or serving as a defense mechanism of protection. Whether the opposing actions of iNOS relate to the differing cellular sources remains unclear. Consistent with our previous study [6], the selective deletion of iNOS from hepatocytes worsened liver reperfusion injury, thus supporting the concept that hepatocellular iNOS is protective during I/R injury. We have provided the evidence that HSP70 could be involved in iNOS-mediated hepatoprotection against I/R injury, however, inhibition of HSP70 reversed, in part, the protective effect regulated by overexpression of iNOS, suggesting that additional protective molecules were also stimulated and worked with HSP70 amidst I/R injury. Our results demonstrate that HO-1 is another mediator of the beneficial effects of iNOS through an Nrf2dependent pathway, providing another protective mechanism of iNOS. Considerable evidence indicates that HO-1 is involved in protection against a wide variety of pathologic conditions, such as inflammation, infection, and I/R injury [11,12]. As reported, HO-1 is regulated, among other factors, by NO [13,14], on the basis of which we assume that iNOS may activate HO-1 in the hepatocyte. In contrast with previous reports [15], we and others [16,17] detected hepatocytes as another source of HO-1 after reperfusion, besides Kupffer cells and macrophages. Our present findings that the upregulation of hepatocellular iNOS was related to increased expression of hepatocellular HO-1, and that the protection afforded by iNOS overexpressing in vitro was partly ablated by the HO-1 inhibitor ZnPP (Fig. 3), reveal that HO-1 is a necessary mediator of iNOS-dependent hepatoprotection. The mechanism whereby iNOS regulates the expression of HO-1 is another problem for further exploration. One of the master transcription factors to regulate HO-1 expression is Nrf2, which has also been implicated in the hepatoprotection afforded by HO-1 [18e20]. At present, however, nothing is known regarding whether Nrf2 is implicated in the iNOS-dependent modulation of hepatocellular HO-1. Normally, Nrf2 is maintained in the cytosol. Upon stress or activation, Nrf2 undergoes nuclear localization, and binds to HO-1 promoter leading to transcriptional activation. In order to examine the function of Nrf2 in the iNOS-mediated modulation of
HO-1, we detected the consequence of iNOS on Nrf2 activation. The increased Nrf2 levels in the hepatocyte nuclei after iNOS transfection and I/R, accompanied by the high expression of HO-1, showed that iNOS activated Nrf2, which, in turn, stimulated the expression of HO-1. In summary, our study showed that iNOS can protect hepatocytes by activating Nrf2 through upregulating the key effector HO1, thereby representing a new treatment perspective for I/R injury. Declaration of competing interest The authors of this manuscript have no conflicts of interest to disclose. Acknowledgments This study was supported by the National Natural Science Foundation of China (grant number: NO81600495). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.053. References [1] Y. Zhai, H. Petrowsky, J.C. Hong, R.W. Busuttil, J.W. Kupiec-Weglinski, Ischaemia-reperfusion injury in liver transplantation–from bench to bedside, Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 79e89. [2] J. Hu, X.H. Zhu, X.J. Zhang, P.X. Wang, R. Zhang, P. Zhang, G.N. Zhao, L. Gao, X.F. Zhang, S. Tian, H. Li, Targeting TRAF3 signaling protects against hepatic ischemia/reperfusions injury, J. Hepatol. 64 (2016) 146e159. [3] J. Gracia-Sancho, A. Casillas-Ramirez, C. Peralta, Molecular pathways in protecting the liver from ischaemia/reperfusion injury: a 2015 update, Clin. Sci. (Lond.) 129 (2015) 345e362. [4] W.A. Dar, E. Sullivan, J.S. Bynon, H. Eltzschig, C. Ju, Ischaemia reperfusion injury in liver transplantation: cellular and molecular mechanisms, Liver Int. 39 (2019) 788e801. [5] K.A. Rose, N.S. Holman, A.M. Green, M.E. Andersen, E.L. LeCluyse, Co-culture of hepatocytes and Kupffer cells as an in vitro model of inflammation and druginduced hepatotoxicity, J. Pharm. Sci. 105 (2016) 950e964. [6] Y. Qiao, X. Zhang, G. Zhao, Z. Liu, M. Yu, Z. Fang, X. Li, Hepatocellular iNOS protects liver from ischemia/reperfusion injury through HSF1-dependent activation of HSP70, Biochem. Biophys. Res. Commun. 512 (2019) 882e888. [7] S. Kuboki, R. Schuster, J. Blanchard, T.A. Pritts, H.R. Wong, A.B. Lentsch, Role of heat shock protein 70 in hepatic ischemia-reperfusion injury in mice, Am. J. Physiol. Gastrointest. Liver Physiol. 292 (2007) G1141eG1149. [8] A. Tsung, R.A. Hoffman, K. Izuishi, N.D. Critchlow, A. Nakao, M.H. Chan, M.T. Lotze, D.A. Geller, T.R. Billiar, Hepatic ischemia/reperfusion injury involves functional TLR4 signaling in nonparenchymal cells, J. Immunol. 175 (2005) 7661e7668. [9] H.C. Yu, H.Y. Qin, F. He, L. Wang, W. Fu, D. Liu, F.C. Guo, L. Liang, K.F. Dou, H. Han, Canonical notch pathway protects hepatocytes from ischemia/reperfusion injury in mice by repressing reactive oxygen species production through JAK2/STAT3 signaling, Hepatology 54 (2011) 979e988. [10] J. Alam, J.L. Cook, How many transcription factors does it take to turn on the heme oxygenase-1 gene? Am. J. Respir. Cell Mol. Biol. 36 (2007) 166e174. [11] S. Saha, M. Basu, S. Guin, P. Gupta, A.M. Mitterstiller, G. Weiss, K. Jana, A. Ukil,
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
6
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[12]
[13]
[14]
[15]
Leishmania donovani exploits macrophage heme oxygenase-1 to neutralize oxidative burst and TLR signaling-dependent host defense, J. Immunol. 202 (2019) 827e840. L. Devey, D. Ferenbach, E. Mohr, K. Sangster, C.O. Bellamy, J. Hughes, S.J. Wigmore, Tissue-resident macrophages protect the liver from ischemia reperfusion injury via a heme oxygenase-1-dependent mechanism, Mol. Ther. 17 (2009) 65e72. B.S. Zuckerbraun, T.R. Billiar, S.L. Otterbein, P.K. Kim, F. Liu, A.M. Choi, F.H. Bach, L.E. Otterbein, Carbon monoxide protects against liver failure through nitric oxide-induced heme oxygenase 1, J. Exp. Med. 198 (2003) 1707e1716. R. Zamora, Y. Vodovotz, K.S. Aulak, P.K. Kim, J.M. Kane 3rd, L. Alarcon, D.J. Stuehr, T.R. Billiar, A DNA microarray study of nitric oxide-induced genes in mouse hepatocytes: implications for hepatic heme oxygenase-1 expression in ischemia/reperfusion, Nitric Oxide 7 (2002) 165e186. K. Nakamura, M. Zhang, S. Kageyama, B. Ke, T. Fujii, R.A. Sosa, E.F. Reed, N. Datta, A. Zarrinpar, R.W. Busuttil, J.A. Araujo, J.W. Kupiec-Weglinski, Macrophage heme oxygenase-1-SIRT1-p53 axis regulates sterile inflammation in liver ischemia-reperfusion injury, J. Hepatol. 67 (2017) 1232e1242.
[16] D. Xu, L. Chen, X. Chen, Y. Wen, C. Yu, J. Yao, H. Wu, X. Wang, Q. Xia, X. Kong, The triterpenoid CDDO-imidazolide ameliorates mouse liver ischemiareperfusion injury through activating the Nrf2/HO-1 pathway enhanced autophagy, Cell Death Dis. 8 (2017) e2983. [17] D. Xu, M. Xu, X. Kong, Q. Xia, Protective effects of heme oxygenase 1 during ischemia-reperfusion injury: hepatocytes or non-parenchymal cells? J. Hepatol. 69 (2018) 752e753. [18] M. Ge, W. Yao, D. Yuan, S. Zhou, X. Chen, Y. Zhang, H. Li, Z. Xia, Z. Hei, Brg1mediated Nrf2/HO-1 pathway activation alleviates hepatic ischemiareperfusion injury, Cell Death Dis. 8 (2017) e2841. [19] J.W. Kang, S.M. Lee, Melatonin inhibits type 1 interferon signaling of toll-like receptor 4 via heme oxygenase-1 induction in hepatic ischemia/reperfusion, J. Pineal Res. 53 (2012) 67e76. [20] B. Ke, X.D. Shen, Y. Zhang, H. Ji, F. Gao, S. Yue, N. Kamo, Y. Zhai, M. Yamamoto, R.W. Busuttil, J.W. Kupiec-Weglinski, KEAP1-NRF2 complex in ischemiainduced hepatocellular damage of mouse liver transplants, J. Hepatol. 59 (2013) 1200e1207.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury Yingli Qiao a, Fei Xiao b, Wenkai Li b, Mingyong Yu b, Peng Du b, Zheping Fang a, Jie Sun a, c, * a b c
Department of Hepatobiliary Surgery, Taizhou Hospital of Zhejiang Province, Wenzhou Medical University, Linhai, Zhejiang, 317000, China Department of Organ Transplantation, Liaocheng People’s Hospital, Liaocheng, Shandong, 252000, China Department of Endocrinology, Liaocheng People’s Hospital, Liaocheng, Shandong, 252000, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 November 2019 Accepted 8 November 2019 Available online xxx
Hepatocyte-derived inducible nitric oxide synthase (iNOS) was proved to impart protection against liver ischemia reperfusion (I/R) injury in our prior analysis. However, the mechanism for this hepatoprotection remains incompletely understood. Bone marrow chimeric mice were generated using expression of iNOS in a hepatocyte-selective manner against an iNOS-knockout background. The function of heme oxygenase 1 (HO-1) in iNOS-stimulated hepatoprotection and the molecular mechanisms were explored in vitro and in vivo, respectively. Hepatocyte-derived iNOS conferred protection from I/R injury and anoxia/reoxygenation stimulation. Mechanistically, iNOS activated nuclear factor erythroid 2-related factor 2 (Nrf-2) and subsequently, stimulated the transcription of HO-1. Results from our study led to the conclusion that HO-1 is another potent mediator of iNOS-mediated protection after liver I/R. © 2019 Elsevier Inc. All rights reserved.
Keywords: Liver Reperfusion injury HO-1 iNOS
1. Introduction Ischemia reperfusion (I/R) injury unavoidably develops during liver operation, and, represents the primary cause for acute hepatic dysfunction, and even rejection after transplantation [1]. As the main challenge in liver transplantation, I/R injury contributes to graft shortage. Although its clinical importance is obvious, the pathogenesis of IRI is not yet clear, and there is no effective treatment to prevent or treat this disease [2]. The pathological mechanisms of I/R injury are complex, involving innate immune activation, multifaceted players, and the perturbation of cellular interactions between hepatocytes and nonparenchymal cells [3]. Much of the research into this field has focused on nonparenchymal cells. However, the role of hepatocytes, as the largest population in the liver, is understudied [4]. I/R induces acute phase proteins expression, including inducible nitric oxide synthase (iNOS) and C-reactive protein [5]. We previously identified a protective function of iNOS in I/R injury [6]; however, the mechanism that accounts for hepatoprotection still need to be
* Corresponding author. Department of Hepatobiliary Surgery, Taizhou Hospital of Zhejiang Province, Wenzhou Medical University, No 150 Ximen Road, Linhai, Zhejiang, 317000, China. E-mail address: [email protected] (J. Sun).
clarified further. In response to environmental stress, hepatocytes are not mere passive victims of injury, but active participants to initiate defensive mechanisms, including heat shock proteins (HSPs) and antioxidative cytoprotectants such as heme oxygenase 1 (HO-1) [7]. Our prior results reported that HSP70 was not the only cytoprotectant in iNOS-induced hepatoprotection [6]. Here we explored whether HO-1 functions in iNOS-mediated protection in hepatocytes.
2. Materials and methods 2.1. Animal care and protocol iNOS knockout (KO) and wild-type (WT) C57BL/6 mice were raised in pathogen-free conditions. Mice were 8e10 weeks old and of the same genetic background The animal programme was sanctioned by the Committee on Animal Care and Use. As mentioned previously [8], chimerism is produced with iNOS KO and WT mice by transferring green fluorescent protein-labelled donor bone marrow cells to recipient animals that had been previously irradiated. The recipient/donor groupings are as follows: WT/KO and KO/KO.
https://doi.org/10.1016/j.bbrc.2019.11.053 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
2
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2.2. In vivo model of hepatic I/R injury
2.6. Western blot
As mentioned previously [8], a partial warm I/R injury model was generated. Except for the control group, all mice were treated with 60min of portal triad occlusion, and then reperfused for 6 and 24 h. After reperfusion, the morphometric and pathological parameters were analyzed.
Antibodies against iNOS (Abcam, USA), nuclear factor erythroid 2-related factor 2 (Nrf-2) (Abcam), HO-1 (Boster, China), and GAPDH (Abcam) were used to measure protein by Western blot analysis. 2.7. Immunohistochemistry
2.3. Cell culture and transfection Isolation and culture of primary hepatocytes was performed as described [9]. Hepatocytes anoxia/reoxygenation (A/R) in vitro was conducted in accordance with prior studies [2]. iNOS transfection was conducted using pcDNA3.1(þ) plasmid. Inhibition of HO-1 was conducted using 20 mM of ZnPP (Sellseck, Houston, TX, USA) based on prior studies.
The immunohistochemical staining for HO-1 was conducted using a DAKO (Glostrup, Denmark) detection system. 2.8. Evaluation of apoptosis Cellular apoptosis was detected through flow cytometry using an Annexin V/propidium iodide (PI) staining kit (Beyotime, China) following established protocol.
2.4. Evaluation of hepatic injury
2.9. Evaluation of cell viability
Quantification of serum alanine transaminase (ALT) levels were used to evaluate liver injury after reperfusion from blood samples acquired at the indicated timepoints. Measurement of ALT was carried out by model 7150, a conventional automatic analyzer (Tokyo, Japan).
The CCK8 assay (KeyGen, NanJing, China) was utilized to examine cell viability as per manufacturer’s established protocol. 2.10. Statistical analysis
2.5. Gene expression analysis
Statistical analysis was conducted using Kaplan-Meier or ANOVA test. Analysis results are represented as mean ± SD. P < 0.05 denotes statistical significance.
iNOS, HO-1, and GAPDH mRNA expression was evaluated using quantitative real-time polymerase chain reaction (qRT-PCR). Table 1 includes list of primers.
3. Results 3.1. iNOS upregulates HO-1
Table 1 Primers for qRT-PCR. Gene
Forward primers
Reverse primers
GAPDH iNOS HO-1
CCAGTATGACTCCACTCACG AGGAGGAGAGAGATCCGATTTAG GACATGGCCTTCTGGTATGG
GACTCCACGACATACTCAGC TCAGACTTCCCTGTCTCAGTAG CTCGTGGAGACGCTTTACATAG
As previously documented [6], liver I/R led to a substantial upregulation in the protein expression of hepatic iNOS, in parallel with HO-1 protein, throughout 24 h after reperfusion (Fig. 1B and C). Consistent with the results of Western blot, the immunohistochemistry analysis showed stronger staining of HO-1 protein in hepatocytes after I/R (Fig. 1A). We also confirmed the above results
Fig. 1. iNOS upregulates liver HO-1 expression. (A) HO-1 immunohistochemical staining in hepatocytes in the Control, KO/KO, and WT/KO mice post-reperfusion. (B) Western blot analysis and (C) measurement of HO-1 expression in liver samples at 6 h and 24 h post-reperfusion. GAPDH was used as control; n ¼ 3; *P < 0.05 refers to comparison with the KO/ KO group.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
in primary hepatocytes that were exposed to A/R insult. In accordance with in vivo results, HO-1 levels were higher in WT hepatocytes, especially in hepatocytes with overexpression of iNOS (Fig. 2AeE), indicating that iNOS has an important function in induction of HO-1 expression. 3.2. iNOS derived from hepatocytes protects against I/R injury Chimeric mice with a hepatocyte-specific pattern of iNOS
3
expression were generated to explore the role of iNOS in an in vivo model of hepatic I/R damage. Specific iNOS expression in hepatocytes was confirmed using immunohistochemistry and Western blot. Consistent with our previous results [6], hepatocyte-specific iNOS deletion resulted in exacerbated liver injury compared with WT mice, characterized by severe disruption of lobular architecture (Fig. 3A) and higher serum ALT levels (Fig. 3B), indicating the hepatoprotection of iNOS derived from hepatocytes. In vitro treatment of A/R induced hepatocyte damage, apoptosis
Fig. 2. iNOS upregulates HO-1 in primary hepatocytes. (A and B) Expression of iNOS (A) and HO-1 (B) mRNA in primary hepatocytes exposed to A/R. (CeE) Western blot analysis (C) and expression of iNOS (D) and HO-1 (E) in primary hepatocytes after A/R exposure. GAPDH was used as control (n ¼ 3). *P < 0.05 refers to comparison with the corresponding controls.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
4
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
and reduced cell viability, which were exacerbated by iNOS deficiency and weakened by iNOS overexpression (Fig. 3CeE). In order to validate whether the upregulation of HO-1 by iNOS was involved in the hepatocyte protection, ZnPP was used to inhibit HO-1, resulting in aggravating hepatocyte injury (Fig. 3CeE). These results indicate that HO-1 is responsible for the iNOS-mediated liver protection.
3.3. iNOS activates Nrf2 Previous research reported that Nrf2 was the major transcription factor regulating the transcriptional level of HO-1 [10]. Under normal conditions, Nrf2 exists in the cytosol of the non-activated cell, and its activation is related to nuclear relocation. In this
Fig. 3. Hepatocellular iNOS shields against I/R injury. (A) The liver sections from control, KO/KO and WT/KO mice were stained with HE at 6 and 24 h after reperfusion(B) Serum ALT levels at 6 and 24 h after reperfusion; n ¼ 6e8. *P < 0.05 refers to comparison with KO/KO group. (C) The level of ALT in the primary hepatocyte culture medium exposed to A/R. n ¼ 3. *P < 0.05 and #P < 0.05 refers to comparison with KO þ Vehicle þ A/R and KO þ ZnPP þ A/R group, respectively. (D) Cell viability was evaluated through CCK8 assay. *P < 0.05 and #P < 0.05 refers to comparison with KO þ Vehicle þ A/R and KO þ ZnPP þ A/R group, respectively. (F) Apoptosis was quantified by annexin V/PI staining. *P < 0.05 and #P < 0.05 refers to comparison with the KO þ Vehicle þ A/R and the KO þ ZnPP þ A/R group, respectively.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. iNOS increases Nrf2 nuclear translocation. (A) Western blot analysis and (B) measurement of Nrf2 in nucleus of primary hepatocytes exposed to A/R in comparison to corresponding controls. *P < 0.05 indicates statistical significance.
study, we conducted Western blot to quantitatively analyze the nuclear content of Nrf2. The increased Nrf2 expression in the nucleus of hepatocytes indicated that it becomes activated by iNOS after transfection (Fig. 4A and B), suggesting that Nrf2 is related to the gene expression of HO-1 after gene transfer of iNOS. 4. Discussion Previously [6], we have shown the high expression of endogenous hepatic iNOS in hepatocytes and inflammatory cells. The precise role of endogenous iNOS remains controversial in this setting, with contributing to the liver injury or serving as a defense mechanism of protection. Whether the opposing actions of iNOS relate to the differing cellular sources remains unclear. Consistent with our previous study [6], the selective deletion of iNOS from hepatocytes worsened liver reperfusion injury, thus supporting the concept that hepatocellular iNOS is protective during I/R injury. We have provided the evidence that HSP70 could be involved in iNOS-mediated hepatoprotection against I/R injury, however, inhibition of HSP70 reversed, in part, the protective effect regulated by overexpression of iNOS, suggesting that additional protective molecules were also stimulated and worked with HSP70 amidst I/R injury. Our results demonstrate that HO-1 is another mediator of the beneficial effects of iNOS through an Nrf2dependent pathway, providing another protective mechanism of iNOS. Considerable evidence indicates that HO-1 is involved in protection against a wide variety of pathologic conditions, such as inflammation, infection, and I/R injury [11,12]. As reported, HO-1 is regulated, among other factors, by NO [13,14], on the basis of which we assume that iNOS may activate HO-1 in the hepatocyte. In contrast with previous reports [15], we and others [16,17] detected hepatocytes as another source of HO-1 after reperfusion, besides Kupffer cells and macrophages. Our present findings that the upregulation of hepatocellular iNOS was related to increased expression of hepatocellular HO-1, and that the protection afforded by iNOS overexpressing in vitro was partly ablated by the HO-1 inhibitor ZnPP (Fig. 3), reveal that HO-1 is a necessary mediator of iNOS-dependent hepatoprotection. The mechanism whereby iNOS regulates the expression of HO-1 is another problem for further exploration. One of the master transcription factors to regulate HO-1 expression is Nrf2, which has also been implicated in the hepatoprotection afforded by HO-1 [18e20]. At present, however, nothing is known regarding whether Nrf2 is implicated in the iNOS-dependent modulation of hepatocellular HO-1. Normally, Nrf2 is maintained in the cytosol. Upon stress or activation, Nrf2 undergoes nuclear localization, and binds to HO-1 promoter leading to transcriptional activation. In order to examine the function of Nrf2 in the iNOS-mediated modulation of
HO-1, we detected the consequence of iNOS on Nrf2 activation. The increased Nrf2 levels in the hepatocyte nuclei after iNOS transfection and I/R, accompanied by the high expression of HO-1, showed that iNOS activated Nrf2, which, in turn, stimulated the expression of HO-1. In summary, our study showed that iNOS can protect hepatocytes by activating Nrf2 through upregulating the key effector HO1, thereby representing a new treatment perspective for I/R injury. Declaration of competing interest The authors of this manuscript have no conflicts of interest to disclose. Acknowledgments This study was supported by the National Natural Science Foundation of China (grant number: NO81600495). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.053. References [1] Y. Zhai, H. Petrowsky, J.C. Hong, R.W. Busuttil, J.W. Kupiec-Weglinski, Ischaemia-reperfusion injury in liver transplantation–from bench to bedside, Nat. Rev. Gastroenterol. Hepatol. 10 (2013) 79e89. [2] J. Hu, X.H. Zhu, X.J. Zhang, P.X. Wang, R. Zhang, P. Zhang, G.N. Zhao, L. Gao, X.F. Zhang, S. Tian, H. Li, Targeting TRAF3 signaling protects against hepatic ischemia/reperfusions injury, J. Hepatol. 64 (2016) 146e159. [3] J. Gracia-Sancho, A. Casillas-Ramirez, C. Peralta, Molecular pathways in protecting the liver from ischaemia/reperfusion injury: a 2015 update, Clin. Sci. (Lond.) 129 (2015) 345e362. [4] W.A. Dar, E. Sullivan, J.S. Bynon, H. Eltzschig, C. Ju, Ischaemia reperfusion injury in liver transplantation: cellular and molecular mechanisms, Liver Int. 39 (2019) 788e801. [5] K.A. Rose, N.S. Holman, A.M. Green, M.E. Andersen, E.L. LeCluyse, Co-culture of hepatocytes and Kupffer cells as an in vitro model of inflammation and druginduced hepatotoxicity, J. Pharm. Sci. 105 (2016) 950e964. [6] Y. Qiao, X. Zhang, G. Zhao, Z. Liu, M. Yu, Z. Fang, X. Li, Hepatocellular iNOS protects liver from ischemia/reperfusion injury through HSF1-dependent activation of HSP70, Biochem. Biophys. Res. Commun. 512 (2019) 882e888. [7] S. Kuboki, R. Schuster, J. Blanchard, T.A. Pritts, H.R. Wong, A.B. Lentsch, Role of heat shock protein 70 in hepatic ischemia-reperfusion injury in mice, Am. J. Physiol. Gastrointest. Liver Physiol. 292 (2007) G1141eG1149. [8] A. Tsung, R.A. Hoffman, K. Izuishi, N.D. Critchlow, A. Nakao, M.H. Chan, M.T. Lotze, D.A. Geller, T.R. Billiar, Hepatic ischemia/reperfusion injury involves functional TLR4 signaling in nonparenchymal cells, J. Immunol. 175 (2005) 7661e7668. [9] H.C. Yu, H.Y. Qin, F. He, L. Wang, W. Fu, D. Liu, F.C. Guo, L. Liang, K.F. Dou, H. Han, Canonical notch pathway protects hepatocytes from ischemia/reperfusion injury in mice by repressing reactive oxygen species production through JAK2/STAT3 signaling, Hepatology 54 (2011) 979e988. [10] J. Alam, J.L. Cook, How many transcription factors does it take to turn on the heme oxygenase-1 gene? Am. J. Respir. Cell Mol. Biol. 36 (2007) 166e174. [11] S. Saha, M. Basu, S. Guin, P. Gupta, A.M. Mitterstiller, G. Weiss, K. Jana, A. Ukil,
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053
6
Y. Qiao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[12]
[13]
[14]
[15]
Leishmania donovani exploits macrophage heme oxygenase-1 to neutralize oxidative burst and TLR signaling-dependent host defense, J. Immunol. 202 (2019) 827e840. L. Devey, D. Ferenbach, E. Mohr, K. Sangster, C.O. Bellamy, J. Hughes, S.J. Wigmore, Tissue-resident macrophages protect the liver from ischemia reperfusion injury via a heme oxygenase-1-dependent mechanism, Mol. Ther. 17 (2009) 65e72. B.S. Zuckerbraun, T.R. Billiar, S.L. Otterbein, P.K. Kim, F. Liu, A.M. Choi, F.H. Bach, L.E. Otterbein, Carbon monoxide protects against liver failure through nitric oxide-induced heme oxygenase 1, J. Exp. Med. 198 (2003) 1707e1716. R. Zamora, Y. Vodovotz, K.S. Aulak, P.K. Kim, J.M. Kane 3rd, L. Alarcon, D.J. Stuehr, T.R. Billiar, A DNA microarray study of nitric oxide-induced genes in mouse hepatocytes: implications for hepatic heme oxygenase-1 expression in ischemia/reperfusion, Nitric Oxide 7 (2002) 165e186. K. Nakamura, M. Zhang, S. Kageyama, B. Ke, T. Fujii, R.A. Sosa, E.F. Reed, N. Datta, A. Zarrinpar, R.W. Busuttil, J.A. Araujo, J.W. Kupiec-Weglinski, Macrophage heme oxygenase-1-SIRT1-p53 axis regulates sterile inflammation in liver ischemia-reperfusion injury, J. Hepatol. 67 (2017) 1232e1242.
[16] D. Xu, L. Chen, X. Chen, Y. Wen, C. Yu, J. Yao, H. Wu, X. Wang, Q. Xia, X. Kong, The triterpenoid CDDO-imidazolide ameliorates mouse liver ischemiareperfusion injury through activating the Nrf2/HO-1 pathway enhanced autophagy, Cell Death Dis. 8 (2017) e2983. [17] D. Xu, M. Xu, X. Kong, Q. Xia, Protective effects of heme oxygenase 1 during ischemia-reperfusion injury: hepatocytes or non-parenchymal cells? J. Hepatol. 69 (2018) 752e753. [18] M. Ge, W. Yao, D. Yuan, S. Zhou, X. Chen, Y. Zhang, H. Li, Z. Xia, Z. Hei, Brg1mediated Nrf2/HO-1 pathway activation alleviates hepatic ischemiareperfusion injury, Cell Death Dis. 8 (2017) e2841. [19] J.W. Kang, S.M. Lee, Melatonin inhibits type 1 interferon signaling of toll-like receptor 4 via heme oxygenase-1 induction in hepatic ischemia/reperfusion, J. Pineal Res. 53 (2012) 67e76. [20] B. Ke, X.D. Shen, Y. Zhang, H. Ji, F. Gao, S. Yue, N. Kamo, Y. Zhai, M. Yamamoto, R.W. Busuttil, J.W. Kupiec-Weglinski, KEAP1-NRF2 complex in ischemiainduced hepatocellular damage of mouse liver transplants, J. Hepatol. 59 (2013) 1200e1207.
Please cite this article as: Y. Qiao et al., Hepatocellular HO-1 mediated iNOS-induced hepatoprotection against liver ischemia reperfusion injury, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.053