- Email: [email protected]
Hes3 expression in the adult mouse brain is regulated during demyelination and remyelination
Author’s Accepted Manuscript Hes3 expression in the adult mouse brain is regulated during demyelination and remyelination Louiza Toutouna, Polyxeni Nikolakopoulou, Steven W. Poser, Jimmy Masjkur, Carina ArpsForker, Maria Troullinaki, Sylvia Grossklaus, Viktoria Bosak, Ulrike Friedrich, Tjalf Ziemssen, Stefan R. Bornstein, Triantafyllos Chavakis, Andreas Androutsellis-Theotokis
PII: DOI: Reference:
www.elsevier.com/locate/brainres
S0006-8993(16)30153-6 http://dx.doi.org/10.1016/j.brainres.2016.03.014 BRES44780
To appear in: Brain Research Received date: 20 October 2015 Revised date: 14 March 2016 Accepted date: 16 March 2016 Cite this article as: Louiza Toutouna, Polyxeni Nikolakopoulou, Steven W. Poser, Jimmy Masjkur, Carina Arps-Forker, Maria Troullinaki, Sylvia Grossklaus, Viktoria Bosak, Ulrike Friedrich, Tjalf Ziemssen, Stefan R. Bornstein, Triantafyllos Chavakis and Andreas Androutsellis-Theotokis, Hes3 expression in the adult mouse brain is regulated during demyelination and remyelination, Brain Research, http://dx.doi.org/10.1016/j.brainres.2016.03.014 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Hes3 expression in the adult mouse brain is regulated during demyelination and remyelination 1
1
1
1
Louiza Toutouna , Polyxeni Nikolakopoulou , Steven W. Poser , Jimmy Masjkur , Carina Arps1
2
2
1,3
1
4
Forker , Maria Troullinaki , Sylvia Grossklaus , Viktoria Bosak , Ulrike Friedrich , Tjalf Ziemssen , 1
2
Stefan R. Bornstein , Triantafyllos Chavakis , and Andreas Androutsellis-Theotokis
1,3,5*
1
Technische Universität Dresden, Department of Internal Medicine III, Dresden, 01307, Germany Technische Universität Dresden, Department of Clinical Pathobiochemistry, Dresden, 01307, Germany 3 Center for Regenerative Therapies Dresden, 01307 Dresden, Germany 4 Zentrum für klinische Neurowissenschaften, Klinik und Poliklinik für Neurologie, Universitätsklinikum Carl Gustav Carus Dresden, Technische Universität Dresden 5 Department of Stem Cell Biology, Centre for Biomolecular Sciences, Division of Cancer and Stem Cells, School of Medicine, University of Nottingham, Nottingham, U.K. * Corresponding author: Andreas Androutsellis-Theotokis Stem Cell Biology Lab, Department of Internal Medicine III, Technische Universität Dresden, 2
Fetscherstrasse 74, Dresden, 01307, Germany. Tel.: +49-(0)351-796-5690, Fax: +49-(0)351-4586398. [email protected]
Abbreviations: Hes3, Hairy and Enhancer of Split 3; MBP, Myelin Basic Protein; NSC, Neural Stem Cell; OPC, Oligodendrocyte Precursor Cell; GFAP, Glial Fibrillary Acidic Protein; JAK, Janus Kinase; STAT3, Signal Transducer and Activator of Transcription
ABSTRACT
Hes3 is a component of the STAT3-Ser/Hes3 Signaling Axis controlling the growth and survival of neural stem cells and other plastic cells. Pharmacological activation of this pathway promotes neuronal rescue and behavioral recovery in models of ischemic stroke and Parkinson’s disease. Here we provide initial observations implicating Hes3 in the cuprizone model of demyelination and remyelination. We focus on the subpial motor cortex of mice because we detected high Hes3 expression. This area is of interest as it is impacted both in human demyelinating diseases and in the cuprizone model. We report that Hes3 expression is reduced at peak demyelination and is partially restored within 1 week after cuprizone withdrawal. This raises the possibility of Hes3 involvement in demyelination/remyelination that may warrant additional research. Supporting a possible role of Hes3 in the maintenance of oligodendrocyte markers, a Hes3 null mouse strain shows lower levels of myelin basic protein in undamaged adult mice, compared to wild-type controls. We also present a novel method for culturing the established oligodendrocyte progenitor cell line oli-neu in a manner that maintains Hes3 expression as well as its self-renewal and differentiation potential, offering an experimental tool to study Hes3. Based upon this approach, we identify a Janus kinase inhibitor and dbcAMP as powerful inducers of Hes3 gene expression. We provide a new biomarker and cell culture method that may be of interest in demyelination/remyelination research.
1
Keywords: Hes3, Myelin, oligodendrocyte precursor, brain, regeneration
1. INTRODUCTION
Hairy and Enhancer of Split 3 (Hes3) is a member of the Hes/Hey family of basic helix-loop-helix (bHLH) transcriptional repressors (Hatakeyama et al., 2004; Hirata et al., 2000; Hirata et al., 2001; Imayoshi and Kageyama, 2014). Genetic deletion experiments demonstrate that it opposes precarious differentiation of neural precursors during development, in cooperation with other members of the Hes3/Hey family (Hirata et al., 2000; Hirata et al., 2001). In neural stem cells (NSCs)/precursor cells, Hes3 expression is regulated by the STAT3-Ser/Hes3 Signaling Axis, a signaling pathway that involves a non-canonical branch of the Notch signaling pathway and phosphorylation of STAT3 on serine 727.
In vitro, pharmacological activation of this pathway promotes NSC survival and growth (AndroutsellisTheotokis et al., 2006; Androutsellis-Theotokis et al., 2008; Androutsellis-Theotokis et al., 2009; Ohta et al., 2012; Salewski et al., 2012). Hes3 may also be involved in the direct reprogramming of adult cells into induced NSCs as successful reprogramming correlates with Hes3 gene transduction (Cassady et al., 2014). In vivo, pharmacological activation improves behavioral scores in models of ischemic stroke and Parkinson’s disease (Androutsellis-Theotokis et al., 2006; AndroutsellisTheotokis et al., 2009).
Here we provide early evidence of the involvement of Hes3 in demyelination/remyelination. For in vivo work we utilized the cuprizone model of demyelination/remyelination (Blakemore, 1973; Denic et al., 2011; Kipp et al., 2009; Matsushima and Morell, 2001; Skripuletz et al., 2008; Torkildsen et al., 2008; Zendedel et al., 2013). We focus on the subpial motor cortex (spmCTX) because we observed high expression of Hes3 and because this area is also affected in this model as well as in patients with demyelinating diseases (Bo et al., 2003; Skripuletz et al., 2011; Wegner et al., 2006). We show that Hes3 expression is reduced at peak demyelination and is partially restored within 1 week after cuprizone withdrawal. This raises the possibility of Hes3 involvement in demyelination/remyelination that may warrant additional research. Supporting a possible role of Hes3 in the maintenance of oligodendrocyte markers, a Hes3 null mouse strain (Hirata et al., 2000; Hirata et al., 2001) shows lower levels of myelin basic protein (MBP) in undamaged adult mice, compared to wild-type controls. To allow the study of Hes3 in vitro, we developed a novel method for culturing the established oligodendrocyte progenitor cell line oli-neu (Jung et al., 1995) in a manner that maintains Hes3 expression as well as its self-renewal and differentiation potential. Based upon this approach, we identify a Janus kinase inhibitor and dbcAMP as powerful inducers of Hes3 gene expression. We provide
a
new
biomarker
and
cell
culture
demyelination/remyelination research.
2
method
that
may
be
of
interest
in
3
2. RESULTS
2.1 Hes3 mRNA expression in the adult mouse spmCTX is reduced at peak demyelination and is partially restored within 1 week after cuprizone withdrawal
We implemented an established model of demyelination/remyelination based on a cuprizonecontaining diet (Blakemore, 1973; Kipp et al., 2009; Matsushima and Morell, 2001; Skripuletz et al., 2008; Torkildsen et al., 2008). We studied four animal groups: Control mice were kept on normal diet for 8 weeks. Another group was placed on a cuprizone-containing diet for 5 weeks to induce demyelination and was then euthanized (5w/0w). Another two groups were placed on a cuprizone diet for 5 weeks and were then placed on normal diets for 1 and 3 weeks, respectively, to allow remyelination in the absence of a degenerative stimulus (5w/1w and 5w/3w, respectively) (Fig. 1A). Immunohistochemical detection and quantification of MBP signal (area coverage x intensity) demonstrates the loss and regeneration of MBP signal in this model (Fig. 1B-C). The procedure induces an increase in the number of oligodendrocyte precursors, identified by expression of O4 and O1 (Fig. 1D). Hes3 mRNA levels (assessed by reverse transcriptase and quantitative PCR methods) also change in the course of the intervention in the spmCTX; specifically, Hes3 signal (both isoforms) is reduced during degeneration and re-instated during regeneration (Fig. 1E-G; Suppl. Fig. 1).
2.2 Hes3 null mice exhibit lower MBP expression in uninjured brains than wild type controls in the spmCTX.
We observed significantly lower MBP expression (assessed by immunohistochemical detection of MBP; data show MBP area coverage times signal intensity) in uninjured Hes3 null mice compared to wild type controls (Fig. 2A,B). In the 5w/3w (three week regeneration) stage, Hes3 null mice exhibited slightly increased MBP expression.
2.3 The oli-neu oligodendrocyte precursor cell line expresses Hes3 and can be cultured in serumfree, defined conditions
We hypothesized that commonly used oligodendrocyte precursor cell lines such as oli-neu may express Hes3 when cultured under defined conditions and in the absence of factors that induce Janus kinase (JAK) activity, such as serum, enabling these cells to be used to study the STAT3-Ser/Hes3 Signaling Axis. Oli-neu cells are typically cultured in SATO medium supplemented with 1% horse serum (HS) [Culture condition: SATO/HS] (Jung et al., 1995) (Fig. 3). We also cultured oli-neu cells with the addition of 10%FBS as a means of powerfully activating JAK [Culture condition: SATO/HS/FBS]. Finally, we also cultured these cells under defined, serum-free conditions (using the base medium “N2”) in the presence of a JAK inhibitor [Culture condition: N2/JAK I./NoSerum] (Masjkur et al., 2014a).
4
Brightfield images show that oli-neu cells grow efficiently in all three conditions, although with differences in morphology (Fig. 4A). PCR analysis demonstrates the expression of Hes1, Hes3, GFAP, and Olig2 (Fig. 4B). Specifically, addition of FBS in the culture medium promoted the astrocytic phenotype with increased expression of GFAP and lower expression of Olig2, an early oligodendrocyte precursor marker. Hes3 is expressed in all conditions but its expression was greatly enhanced by addition of a JAK inhibitor in the N2/JAK I./No Serum conditions. Immunocytochemical analysis shows the expression of precursor markers in the three expansion culture conditions. Consistent with their oligodendroglial nature (Jung et al., 1995), half of the cells in SATO/HS and more than one third in N2/JAK I./NoSerum express the characteristic OPC marker O4 (48,6%±6,9% and 36,8%±5,1% respectively). In SATO/HS/FBS however, O4 is expressed in significantly lower levels (13,2%±1,3%). Cells express the early OPC marker Olig2 in all expansion conditions; its expression however is higher in SATO/HS and N2/JAK I./NoSerum (59%±7,2%, 44,3%±9,7% and 80%±7% in SATO/HS, SATO/HS/FBS and N2/JAK I./NoSerum respectively). The expression of MBP is low in all conditions, at approximately 1%. In SATO/HS and N2/JAK I./NoSerum the cells do not express GFAP (less than 1%). We note however that in SATO/HS/FBS the expression of GFAP is significantly higher than in the other two conditions, at 6,85%±1,24% (Fig. 4C,D).
Oli-neu cells in established culture systems can be induced to differentiate, allowing the study of their fate choice potential. Standard protocols involve the daily addition of 1mM dbcAMP to the growth conditions (Jung et al., 1995; Raible and McMorris, 1989; Raible and McMorris, 1993). In this work we implemented three differentiation protocols (Fig. 3). Specifically, we added dbcAMP to each of the three growth conditions described in Fig. 3 in order to induce differentiation. Immunohistochemical and PCR analyses show differences in differentiation potential in these three conditions; most striking is the increased GFAP expression in the presence of FBS (Fig. 4E,F). In all three differentiation protocols we observed an increase in Hes3 expression, following treatment with dbcAMP, in line with our previous observations that treatment of cultured mouse fetal and adult NSCs with cholera toxin (a potent activator of adenylate cyclase, leading to increased cAMP levels) also increases Hes3 expression and nuclear localization (Androutsellis-Theotokis et al., 2010). Fig. 5 shows a side-by-side comparison of Hes3 mRNA levels in oli-neu cells when these were cultured in SATO+FBS or N2 conditions with and without dbcAMP.
3. DISCUSSION
Hes3 has been implicated in the growth and survival of several immature and plastic cell types, including NSCs, iNSCs, glioblastoma cancer stem cells, adrenomedullary chromaffin progenitors, breast cancer cells, and pancreatic islet beta cells (Androutsellis-Theotokis et al., 2006; Masjkur et al., 2014a; Masjkur et al., 2014b; Ohta et al., 2012; Park et al., 2013; Salewski et al., 2012). Hes3 may also contribute to the reprogramming of adult cells into iNSCs (Cassady et al., 2014).
Here we establish assays and cell culture methods that will help the study of Hes3 in the context of
5
demyelination/remyelination. Using the in vivo cuprizone model of demyelination/remyelination we demonstrate that Hes3 mRNA expression is reduced in the demyelination stage and is partially restored at one and, even more, three weeks after cuprizone withdrawal. Although we focus on the spmCTX, these studies may be extended to other areas of the central nervous system
Using a Hes3 null mouse strain we show that in the uninjured brain, Hes3 null mice exhibit lower expression of MBP, relative to controls. This result suggests possible roles of Hes3 in myelination, inviting further study. MBP expression may be maintained through the action of Hes3 in myelinating oligodendrocytes or through the action of Hes3 on the oligodendrocyte progenitor compartment. Given that Hes3 is expressed on oligodendrocyte progenitors in vivo as well as in the oligodendrocyte progenitor cell line oli-neu in vitro, the latter seems to be, at least in part, a possible explanation. Our previous data establishing Hes3 as a biomarker of neural stem cells and glioblastoma cancer stem cells further supports a role of Hes3 in regulating the progenitor cell compartment and perhaps in maintaining it in the self-renewal state (Androutsellis-Theotokis et al., 2006; Androutsellis-Theotokis et al., 2009; Park et al., 2013). Such a function would ensure a healthy progenitor population which would then provide mature, myelinating (MBP+) cells.
Following de-myelination and re-myelination, especially at the 5w/3w time point, Hes3 null mice exhibit a slightly increased amount of MBP. This observation may not be expected if Hes3 positively regulates MBP expression in oligodendrocytes. However, it would be expected if Hes3 promotes the self-renewal state of oligodendrocyte progenitors. Our working hypothesis is that Hes3, by promoting progenitor cell self-renewal, delays myelination and MBP expression. Therefore, in the Hes3 null mice, progenitor cells (e.g., new progenitor cells generated in response to cuprizone) may differentiate into MBP+ oligodendrocytes faster than in the wild type controls, giving the result we obtained. This possibility raises the question of progenitor cell depletion in the Hes3 null mice, something that can be addressed with future, long-term experiments.
These results may suggest a role of Hes3 in maintaining the self-renewal state of oligodendrocyte progenitors, allowing for the appropriate amount of MBP at steady state (uninjured brains) but delaying the maturation of oligodendrocytes at early time points after damage (1 and 3 weeks). This would be in accordance with the role of Notch in controlling the timing of differentiation of oligodendrocyte progenitors by keeping them in an early progenitor state (Park and Appel, 2003; Wang et al., 1998; Zhang et al., 2009). To our knowledge, only the canonical branch of Notch and its downstream targets has been studied in remyelination (Boulanger and Messier, 2014; Franklin and Ffrench-Constant, 2008). Our results may encourage further studies on the role of the non-canonical Notch branch in remyelination and oligodendrocyte maturation.
To enable the study of Hes3 in an established oligodendrocyte progenitor cell line (oli-neu), we developed a cell culture method that maintains Hes3 expression as well as the self-renewal and differentiation potential of these cells. Key aspects of this culture system are the omission of serum
6
and the use of a JAK inhibitor, providing a defined medium composition. This culture system may be used for the study of the role(s) of Hes3 and other components of the STAT3-Ser/Hes3 Signaling Axis, as well as for drug discovery. For example, we identify a JAK inhibitor and dbcAMP as powerful inducers of Hes3 mRNA levels in these cells. With this work we introduce in vitro and in vivo tools that may be of use in the study of demyelinating diseases.
7
4. EXPERIMENTAL PROCEDURES
4.1 Animals. 6-week old C57Bl/6J male mice were used as previously described (Skripuletz et al., 2011). Experiments were carried out in accordance with the approved guidelines from the Landesdirektion Sachsen. Hes3 null mice were kindly provided by R. Kageyama (Hirata et al., 2001).
4.2 Oli-neu cell line culture Oli-neu cells were maintained and differentiated as previously described (Biname et al., 2013; FokSeang et al., 1995; Jung et al., 1995). For the N2/JAK I./NoSerum conditions, cells were cultured using NSC culture protocols (Androutsellis-Theotokis et al., 2006). 5-9 10x pictures per culture condition (N=3 or more) were randomly taken. Stained cells were manually counted with the “Cell Counter” plug-in from Fiji software (Schindelin et al., 2012).
4.3 Antibodies Rat anti-MBP (1:1000, MAB386, Merk-Millipore Darmstadt, Germany), rabbit anti-Olig2 (1:500, ab9610, Merk-Millipore, Darmstadt, Germany), chicken anti-GFAP (1:1000, ab4674, Abcam), mouse IgM O1 (1:200, MAB1327, R&D Systems Inc.) and mouse IgM O4 (1:200, MAB1326, R&D Systems Inc., Minneapolis, MN). Alexa-Fluor species-specific secondary antibodies were obtained from Jackson Immunoresearch Inc., West Grove, PA
4.4 MBP area and intensity Frozen brains were cut in cryostat in 16μm thick slices and mounted on glass slides. Pictures were taken with a Zeiss LSM780 confocal system. One picture per hemisphere between Bregma 0.02 and 1.18 lateral to midline were taken as a z-stack (z depth: 0.96μm pro stack). For the SUM projections the seven most central slides of the stack were combined using Fiji software and specific regions of interest (ROIs) were predefined for the spmCTX (Layer I) (Paxinos, 1998). At least 3 more ROIs were also created in MBP negative areas to measure and subtract the background staining. Myelination intensity, expressed as MBP staining intensity, was measured as the average of the mean pixel value of each ROI respectably for each anatomic area. For the area of myelination, expressed as the percentage of area of MBP staining, we used Fiji’s automatic threshold algorithm, “Otsu”. The average of ROIs for each field was calculated. Background ROIs were set to a value of 0. Immunohistochemistry was performed as previously described (Masjkur et al., 2014a). Data analysis was done in Microsoft Excel using student’s T-test. The motor cortex between Bregma 0.02 and 1.18 lateral to midline was dissected under a stereotactic microscope.
4.5 RNA isolation from tissue The motor cortex between Bregma 0.02 and 1.18 lateral to midline was dissected under a stereotactic microscope. RNA isolation from tissue was performed with the NucleoSpin® RNA Plus Kit (Mecherey-Nagel). Isolation from cells was performed with the Roche High Pure RNA Isolation Kit
8
(Roche 11828665001). RNA concentration and purity was tested by an OD260 and OD260/OD280 ratios respectively using Tecan Infinite M200Pro plate reader and software.
4.6 Reverse Transcriptase and Real Time PCR reaction We used the M-MLV Reverse Transcriptase Kit (Promega) and the DreamTaq Green DNA Polymerase Protocol (ThermoScientific). For real-time PCR, we used the BioRad Connect Real Time PCR Detection System with SsoFast EvaGreen Supermix Reagent (BioRad). For the analysis we used the ΔΔCt method of relative quantification using the expression of HPRT as a calibrator.
4.7 Primers Hes3_Fw: 5’- AAAGCTGGAGAAGGCCGATA -3’, Hes3_Rev: 5’- TCCTTGCCTACGTCTCACCA -3’, Hes3a_Fw: 5’- AAGCTCCCTGCCATAGCGGA -3’, Hes3a_Rev: 5’- ATGCGTGCACGGCGCTTCTT 3’,
Hes3b_Fw:
5’-
ACATCACAGCATGGGCACCGAGCCCACATC
-3’,
Hes3b_Rev:
5’-
GTTGATGCGTGCACGGCGCTTCTTC -3’, Hes1_Fw: 5’- CAGCCAGTGTCAACACGACAC -3’, Hes1_Rev: 5’- TCGTTCATGCACTCGCTGAG -3’, MBP_Fw: 5’- CTATAAATCGGCTCACAAGG -3’, MBP_Rev: 5’- AGGCGGTTATATTAAGAAGC -3’, GFAP_Fw: 5’- TCCTGGAACAGCAAAACAAG -3’, GFAP_Rev:
5’-
CAGCCTCAGGTTGGTTTCAT
-3’,
Olig2_Fw:
5’-
CAAATCTAATTCACATTCGGAAGGTTG -3’, Olig2_Rev: 5’- GACGATGGGCGACTAGACACC -3’, GalC_Fw: 5’- GCCTTATGGACGAAGTGGGT -3’, GalC_Rev: 5’- CTGCCGTCAAGGAGCCATA -3’, GAPDH_Fw: 5’- ATGACATCAAGAAGGTGGTG -3’, GAPDH_Rev: 5’- CATACCAGGAAATGAGCTTG -3’, HPRT_Fw: 5’- AAGCTTGCTGGTGAAAAGGA -3’, HPRT_Rev: 5’- TTGCGCTCATCTTAGGCTTT -3’
9
ACKNOWLEDGMENTS/CONFLICT OF INTEREST DISCLOSURE
This work was funded by a grant from the Else Kroener-Fresenius Foundation and a grant from the Deutsche Forschungsgemeinschaft (SFB 655: Cells into tissues). The funding sources had no involvement in the conduct of the research or the preparation of the article. We thank Prof. J. Trotter for kindly providing the Oli-neu cell line. We thank Dr. Ryoichiro Kageyama for kindly providing the Hes3 null mouse strain. The authors have no conflict of interest to declare.
LT, PN, and SWP designed and performed experiments, analyzed data and wrote the manuscript; JM, CA-F, MT, SG, VB, UF performed experiments; TJ, and SRB designed experiments, analyzed data and wrote the manuscript; CT interpreted data and edited the manuscript; AA-T generated the manuscript concept, designed experiments, analyzed data and wrote the manuscript. All authors have approved the final article.
Supplementary Figure 1. Uncropped version of Figure 1E. PCR detection of Hes3 mRNA in the spmCTX (both hemispheres pooled together; “M”: molecular weight markers; L32 rRNA and hypoxanthine phosphoribosyltransferase/HRPT are used as internal standards).
10
REFERENCES
Androutsellis-Theotokis, A., Leker, R.R., Soldner, F., Hoeppner, D.J., Ravin, R., Poser, S.W., Rueger, M.A., Bae, S.K., Kittappa, R., McKay, R.D., 2006. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature. 442, 823-6. Androutsellis-Theotokis, A., Rueger, M.A., Mkhikian, H., Korb, E., McKay, R.D., 2008. Signaling pathways controlling neural stem cells slow progressive brain disease. Cold Spring Harb Symp Quant Biol. 73, 403-10. Androutsellis-Theotokis, A., Rueger, M.A., Park, D.M., Mkhikian, H., Korb, E., Poser, S.W., Walbridge, S., Munasinghe, J., Koretsky, A.P., Lonser, R.R., McKay, R.D., 2009. Targeting neural precursors in the adult brain rescues injured dopamine neurons. Proc Natl Acad Sci U S A. 106, 13570-5. Androutsellis-Theotokis, A., Walbridge, S., Park, D.M., Lonser, R.R., McKay, R.D., 2010. Cholera toxin regulates a signaling pathway critical for the expansion of neural stem cell cultures from the fetal and adult rodent brains. PLoS One. 5, e10841. Biname, F., Sakry, D., Dimou, L., Jolivel, V., Trotter, J., 2013. NG2 regulates directional migration of oligodendrocyte precursor cells via Rho GTPases and polarity complex proteins. J Neurosci. 33, 10858-74. Blakemore, W.F., 1973. Remyelination of the superior cerebellar peduncle in the mouse following demyelination induced by feeding cuprizone. J Neurol Sci. 20, 73-83. Bo, L., Vedeler, C.A., Nyland, H.I., Trapp, B.D., Mork, S.J., 2003. Subpial demyelination in the cerebral cortex of multiple sclerosis patients. J Neuropathol Exp Neurol. 62, 723-32. Boulanger, J.J., Messier, C., 2014. From precursors to myelinating oligodendrocytes: contribution of intrinsic and extrinsic factors to white matter plasticity in the adult brain. Neuroscience. 269, 343-66. Cassady, J.P., D'Alessio, A.C., Sarkar, S., Dani, V.S., Fan, Z.P., Ganz, K., Roessler, R., Sur, M., Young, R.A., Jaenisch, R., 2014. Direct lineage conversion of adult mouse liver cells and B lymphocytes to neural stem cells. Stem Cell Reports. 3, 948-56. Denic, A., Johnson, A.J., Bieber, A.J., Warrington, A.E., Rodriguez, M., Pirko, I., 2011. The relevance of animal models in multiple sclerosis research. Pathophysiology. 18, 21-9. Fok-Seang, J., Mathews, G.A., ffrench-Constant, C., Trotter, J., Fawcett, J.W., 1995. Migration of oligodendrocyte precursors on astrocytes and meningeal cells. Dev Biol. 171, 1-15. Franklin, R.J., Ffrench-Constant, C., 2008. Remyelination in the CNS: from biology to therapy. Nat Rev Neurosci. 9, 839-55. Hatakeyama, J., Bessho, Y., Katoh, K., Ookawara, S., Fujioka, M., Guillemot, F., Kageyama, R., 2004. Hes genes regulate size, shape and histogenesis of the nervous system by control of the timing of neural stem cell differentiation. Development. 131, 5539-50. Hirata, H., Ohtsuka, T., Bessho, Y., Kageyama, R., 2000. Generation of structurally and functionally distinct factors from the basic helix-loop-helix gene Hes3 by alternative first exons. J Biol Chem. 275, 19083-9. Hirata, H., Tomita, K., Bessho, Y., Kageyama, R., 2001. Hes1 and Hes3 regulate maintenance of the isthmic organizer and development of the mid/hindbrain. Embo J. 20, 4454-66. Imayoshi, I., Kageyama, R., 2014. bHLH factors in self-renewal, multipotency, and fate choice of neural progenitor cells. Neuron. 82, 9-23. Jung, M., Kramer, E., Grzenkowski, M., Tang, K., Blakemore, W., Aguzzi, A., Khazaie, K., Chlichlia, K., von Blankenfeld, G., Kettenmann, H., et al., 1995. Lines of murine oligodendroglial precursor cells immortalized by an activated neu tyrosine kinase show distinct degrees of interaction with axons in vitro and in vivo. Eur J Neurosci. 7, 1245-65.
11
Kipp, M., Clarner, T., Dang, J., Copray, S., Beyer, C., 2009. The cuprizone animal model: new insights into an old story. Acta Neuropathol. 118, 723-36. Masjkur, J., Arps-Forker, C., Poser, S.W., Nikolakopoulou, P., Toutouna, L., Chenna, R., Chavakis, T., Chatzigeorgiou, A., Chen, L.S., Dubrovska, A., Choudhary, P., Uphues, I., Mark, M., Bornstein, S.R., Androutsellis-Theotokis, A., 2014a. Hes3 is Expressed in the Adult Pancreatic Islet and Regulates Gene Expression, Cell Growth, and Insulin Release. J Biol Chem. Masjkur, J., Levenfus, I., Lange, S., Arps-Forker, C., Poser, S., Qin, N., Vukicevic, V., Chavakis, T., Eisenhofer, G., Bornstein, S.R., Ehrhart-Bornstein, M., Androutsellis-Theotokis, A., 2014b. A Defined, Controlled Culture System for Primary Bovine Chromaffin Progenitors Reveals Novel Biomarkers and Modulators. Stem Cells Transl Med. Matsushima, G.K., Morell, P., 2001. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol. 11, 107-16. Ohta, S., Misawa, A., Fukaya, R., Inoue, S., Kanemura, Y., Okano, H., Kawakami, Y., Toda, M., 2012. Macrophage migration inhibitory factor (MIF) promotes cell survival and proliferation of neural stem/progenitor cells. J Cell Sci. 125, 3210-20. Park, D.M., Jung, J., Masjkur, J., Makrogkikas, S., Ebermann, D., Saha, S., Rogliano, R., Paolillo, N., Pacioni, S., McKay, R.D., Poser, S., Androutsellis-Theotokis, A., 2013. Hes3 regulates cell number in cultures from glioblastoma multiforme with stem cell characteristics. Sci Rep. 3, 1095. Park, H.C., Appel, B., 2003. Delta-Notch signaling regulates oligodendrocyte specification. Development. 130, 3747-55. Paxinos, G.a.W., C, 1998. The Rat Brain in Stereotaxic Coordinates. Vol., Elsevier/Academic Press, New York, NY. Raible, D.W., McMorris, F.A., 1989. Cyclic AMP regulates the rate of differentiation of oligodendrocytes without changing the lineage commitment of their progenitors. Dev Biol. 133, 437-46. Raible, D.W., McMorris, F.A., 1993. Oligodendrocyte differentiation and progenitor cell proliferation are independently regulated by cyclic AMP. J Neurosci Res. 34, 287-94. Salewski, R.P., Buttigieg, J., Mitchell, R.A., van der Kooy, D., Nagy, A., Fehlings, M.G., 2012. The generation of definitive neural stem cells from PiggyBac transposon-induced pluripotent stem cells can be enhanced by induction of the NOTCH signaling pathway. Stem Cells Dev. 22, 383-96. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J.Y., White, D.J., Hartenstein, V., Eliceiri, K., Tomancak, P., Cardona, A., 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods. 9, 676-82. Skripuletz, T., Lindner, M., Kotsiari, A., Garde, N., Fokuhl, J., Linsmeier, F., Trebst, C., Stangel, M., 2008. Cortical demyelination is prominent in the murine cuprizone model and is straindependent. Am J Pathol. 172, 1053-61. Skripuletz, T., Gudi, V., Hackstette, D., Stangel, M., 2011. De- and remyelination in the CNS white and grey matter induced by cuprizone: the old, the new, and the unexpected. Histol Histopathol. 26, 1585-97. Torkildsen, O., Brunborg, L.A., Myhr, K.M., Bo, L., 2008. The cuprizone model for demyelination. Acta Neurol Scand Suppl. 188, 72-6. Wang, S., Sdrulla, A.D., diSibio, G., Bush, G., Nofziger, D., Hicks, C., Weinmaster, G., Barres, B.A., 1998. Notch receptor activation inhibits oligodendrocyte differentiation. Neuron. 21, 63-75. Wegner, C., Esiri, M.M., Chance, S.A., Palace, J., Matthews, P.M., 2006. Neocortical neuronal, synaptic, and glial loss in multiple sclerosis. Neurology. 67, 960-7. Zendedel, A., Beyer, C., Kipp, M., 2013. Cuprizone-induced demyelination as a tool to study remyelination and axonal protection. J Mol Neurosci. 51, 567-72. 12
Zhang, Y., Argaw, A.T., Gurfein, B.T., Zameer, A., Snyder, B.J., Ge, C., Lu, Q.R., Rowitch, D.H., Raine, C.S., Brosnan, C.F., John, G.R., 2009. Notch1 signaling plays a role in regulating precursor differentiation during CNS remyelination. Proc Natl Acad Sci U S A. 106, 19162-7.
FIGURE LEGENDS
Figure 1. Hes3 expression in the adult mouse spmCTX is regulated in different stages of the cuprizone model of demyelination and remyelination. (A) Schematic diagram of the experimental animal groups used: control mice (8 weeks of control diet); mice placed on a cuprizone-containing diet for 5 weeks and euthanized immediately after (5w/0w); mice placed on a cuprizone-containing diet for 5 weeks, then placed on a normal diet for 1 or 3 weeks and euthanized immediately after (5w/1w and 5w/3w, respectively). (B) Immunohistochemical analysis of MBP signal in the spmCTX in different animal groups. (C) Quantification of MBP signal (measured as coverage area times intensity) from the images in (B) (Error bars: SEM, N=4, **p<0.00025, within Bonferroni limits).(D) Number of O4+ and O1+ cells in the spmCTX (data from both hemispheres were pooled together) at the different stages of the cuprizone model. (E) PCR detection of Hes3 mRNA in the spmCTX (both hemispheres pooled together; “M”: molecular weight markers; L32 rRNA and hypoxanthine phosphoribosyltransferase/HRPT are used as internal standards). (F) Diagram showing the dissected spmCTX area used for the analyses. (G) Quantitative PCR analysis of Hes3a and Hes3b mRNA in samples from the dissected spmCTX. (Error bars: SEM, N=4, *p<0.0083, **p<0.0016, within Bonferroni limits).
13
Figure 2. Hes3 null mice exhibit differences in MBP signal in different stages of the cuprizone model, relative to controls. (A) Immunohistochemical detection of MBP in control and Hes3 null mice subjected to the cuprizone model (Scale bars: 20μm). (B) Quantification of the MBP signal (coverage area x signal intensity) from immunohistochemical analyses in control and Hes3 null mice subjected to the cuprizone model (Error bars: SEM, N=3-4, *p<0.05, **p<0.01).
14
Figure 3. Schematic diagram of the culture conditions used for differentiation.
15
Figure 4. The oli-neu oligodendroglial precursor cell line expresses Hes3 and can be cultured in serum-free, defined conditions. (A) Brightfield 10x image examples of oli-neu cells cultured in different conditions. (Self-renewal conditions; Scale bars: 100μm). (B) Reverse Transcriptase PCR analysis of Hes1, Hes3, GFAP, and Olig2 in the different self-renewal culture conditions. (C) Examples of immunohistochemical detection of oligodendrocyte lineage biomarkers in the different self-renewal culture conditions (expansion conditions; scale bars 50μm). (D) Quantification of biomarker expression as a percentage of DAPI in the self-renewal culture conditions. (Error bars: SEM, N=3-4, *p<0.05, **p<0.01). (E) Reverse Transcriptase PCR analysis of Hes1, Hes3, GalC, MBP, and GFAP following induced differentiation (by addition of 1mM dbcAMP) in the different culture conditions. (F) Immunohistochemical detection of O4, MBP, and GFAP following induced differentiation in the different culture conditions (by addition of dbcAMP). (Scale bars 50μm).
16
Figure 5. dbcAMP induces Hes3 transcription. (A) PCR analysis for Hes3 demonstrates that in both SATO+FBS and N2 oli-neu culture conditions, dbcAMP (1mM for 2 days) increases Hes3 mRNA levels.
17
Highlights
Hes3 is regulated in mouse models of demyelination and remyelination Hes3 null mice exhibit altered regulation of myelin basic protein Serum-free culture systems for oli-neu cells allow the study of Hes3 in vitro dbcAMP induces Hes3 expression in the oli-neu cell line
18
PII: DOI: Reference:
www.elsevier.com/locate/brainres
S0006-8993(16)30153-6 http://dx.doi.org/10.1016/j.brainres.2016.03.014 BRES44780
To appear in: Brain Research Received date: 20 October 2015 Revised date: 14 March 2016 Accepted date: 16 March 2016 Cite this article as: Louiza Toutouna, Polyxeni Nikolakopoulou, Steven W. Poser, Jimmy Masjkur, Carina Arps-Forker, Maria Troullinaki, Sylvia Grossklaus, Viktoria Bosak, Ulrike Friedrich, Tjalf Ziemssen, Stefan R. Bornstein, Triantafyllos Chavakis and Andreas Androutsellis-Theotokis, Hes3 expression in the adult mouse brain is regulated during demyelination and remyelination, Brain Research, http://dx.doi.org/10.1016/j.brainres.2016.03.014 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Hes3 expression in the adult mouse brain is regulated during demyelination and remyelination 1
1
1
1
Louiza Toutouna , Polyxeni Nikolakopoulou , Steven W. Poser , Jimmy Masjkur , Carina Arps1
2
2
1,3
1
4
Forker , Maria Troullinaki , Sylvia Grossklaus , Viktoria Bosak , Ulrike Friedrich , Tjalf Ziemssen , 1
2
Stefan R. Bornstein , Triantafyllos Chavakis , and Andreas Androutsellis-Theotokis
1,3,5*
1
Technische Universität Dresden, Department of Internal Medicine III, Dresden, 01307, Germany Technische Universität Dresden, Department of Clinical Pathobiochemistry, Dresden, 01307, Germany 3 Center for Regenerative Therapies Dresden, 01307 Dresden, Germany 4 Zentrum für klinische Neurowissenschaften, Klinik und Poliklinik für Neurologie, Universitätsklinikum Carl Gustav Carus Dresden, Technische Universität Dresden 5 Department of Stem Cell Biology, Centre for Biomolecular Sciences, Division of Cancer and Stem Cells, School of Medicine, University of Nottingham, Nottingham, U.K. * Corresponding author: Andreas Androutsellis-Theotokis Stem Cell Biology Lab, Department of Internal Medicine III, Technische Universität Dresden, 2
Fetscherstrasse 74, Dresden, 01307, Germany. Tel.: +49-(0)351-796-5690, Fax: +49-(0)351-4586398. [email protected]
Abbreviations: Hes3, Hairy and Enhancer of Split 3; MBP, Myelin Basic Protein; NSC, Neural Stem Cell; OPC, Oligodendrocyte Precursor Cell; GFAP, Glial Fibrillary Acidic Protein; JAK, Janus Kinase; STAT3, Signal Transducer and Activator of Transcription
ABSTRACT
Hes3 is a component of the STAT3-Ser/Hes3 Signaling Axis controlling the growth and survival of neural stem cells and other plastic cells. Pharmacological activation of this pathway promotes neuronal rescue and behavioral recovery in models of ischemic stroke and Parkinson’s disease. Here we provide initial observations implicating Hes3 in the cuprizone model of demyelination and remyelination. We focus on the subpial motor cortex of mice because we detected high Hes3 expression. This area is of interest as it is impacted both in human demyelinating diseases and in the cuprizone model. We report that Hes3 expression is reduced at peak demyelination and is partially restored within 1 week after cuprizone withdrawal. This raises the possibility of Hes3 involvement in demyelination/remyelination that may warrant additional research. Supporting a possible role of Hes3 in the maintenance of oligodendrocyte markers, a Hes3 null mouse strain shows lower levels of myelin basic protein in undamaged adult mice, compared to wild-type controls. We also present a novel method for culturing the established oligodendrocyte progenitor cell line oli-neu in a manner that maintains Hes3 expression as well as its self-renewal and differentiation potential, offering an experimental tool to study Hes3. Based upon this approach, we identify a Janus kinase inhibitor and dbcAMP as powerful inducers of Hes3 gene expression. We provide a new biomarker and cell culture method that may be of interest in demyelination/remyelination research.
1
Keywords: Hes3, Myelin, oligodendrocyte precursor, brain, regeneration
1. INTRODUCTION
Hairy and Enhancer of Split 3 (Hes3) is a member of the Hes/Hey family of basic helix-loop-helix (bHLH) transcriptional repressors (Hatakeyama et al., 2004; Hirata et al., 2000; Hirata et al., 2001; Imayoshi and Kageyama, 2014). Genetic deletion experiments demonstrate that it opposes precarious differentiation of neural precursors during development, in cooperation with other members of the Hes3/Hey family (Hirata et al., 2000; Hirata et al., 2001). In neural stem cells (NSCs)/precursor cells, Hes3 expression is regulated by the STAT3-Ser/Hes3 Signaling Axis, a signaling pathway that involves a non-canonical branch of the Notch signaling pathway and phosphorylation of STAT3 on serine 727.
In vitro, pharmacological activation of this pathway promotes NSC survival and growth (AndroutsellisTheotokis et al., 2006; Androutsellis-Theotokis et al., 2008; Androutsellis-Theotokis et al., 2009; Ohta et al., 2012; Salewski et al., 2012). Hes3 may also be involved in the direct reprogramming of adult cells into induced NSCs as successful reprogramming correlates with Hes3 gene transduction (Cassady et al., 2014). In vivo, pharmacological activation improves behavioral scores in models of ischemic stroke and Parkinson’s disease (Androutsellis-Theotokis et al., 2006; AndroutsellisTheotokis et al., 2009).
Here we provide early evidence of the involvement of Hes3 in demyelination/remyelination. For in vivo work we utilized the cuprizone model of demyelination/remyelination (Blakemore, 1973; Denic et al., 2011; Kipp et al., 2009; Matsushima and Morell, 2001; Skripuletz et al., 2008; Torkildsen et al., 2008; Zendedel et al., 2013). We focus on the subpial motor cortex (spmCTX) because we observed high expression of Hes3 and because this area is also affected in this model as well as in patients with demyelinating diseases (Bo et al., 2003; Skripuletz et al., 2011; Wegner et al., 2006). We show that Hes3 expression is reduced at peak demyelination and is partially restored within 1 week after cuprizone withdrawal. This raises the possibility of Hes3 involvement in demyelination/remyelination that may warrant additional research. Supporting a possible role of Hes3 in the maintenance of oligodendrocyte markers, a Hes3 null mouse strain (Hirata et al., 2000; Hirata et al., 2001) shows lower levels of myelin basic protein (MBP) in undamaged adult mice, compared to wild-type controls. To allow the study of Hes3 in vitro, we developed a novel method for culturing the established oligodendrocyte progenitor cell line oli-neu (Jung et al., 1995) in a manner that maintains Hes3 expression as well as its self-renewal and differentiation potential. Based upon this approach, we identify a Janus kinase inhibitor and dbcAMP as powerful inducers of Hes3 gene expression. We provide
a
new
biomarker
and
cell
culture
demyelination/remyelination research.
2
method
that
may
be
of
interest
in
3
2. RESULTS
2.1 Hes3 mRNA expression in the adult mouse spmCTX is reduced at peak demyelination and is partially restored within 1 week after cuprizone withdrawal
We implemented an established model of demyelination/remyelination based on a cuprizonecontaining diet (Blakemore, 1973; Kipp et al., 2009; Matsushima and Morell, 2001; Skripuletz et al., 2008; Torkildsen et al., 2008). We studied four animal groups: Control mice were kept on normal diet for 8 weeks. Another group was placed on a cuprizone-containing diet for 5 weeks to induce demyelination and was then euthanized (5w/0w). Another two groups were placed on a cuprizone diet for 5 weeks and were then placed on normal diets for 1 and 3 weeks, respectively, to allow remyelination in the absence of a degenerative stimulus (5w/1w and 5w/3w, respectively) (Fig. 1A). Immunohistochemical detection and quantification of MBP signal (area coverage x intensity) demonstrates the loss and regeneration of MBP signal in this model (Fig. 1B-C). The procedure induces an increase in the number of oligodendrocyte precursors, identified by expression of O4 and O1 (Fig. 1D). Hes3 mRNA levels (assessed by reverse transcriptase and quantitative PCR methods) also change in the course of the intervention in the spmCTX; specifically, Hes3 signal (both isoforms) is reduced during degeneration and re-instated during regeneration (Fig. 1E-G; Suppl. Fig. 1).
2.2 Hes3 null mice exhibit lower MBP expression in uninjured brains than wild type controls in the spmCTX.
We observed significantly lower MBP expression (assessed by immunohistochemical detection of MBP; data show MBP area coverage times signal intensity) in uninjured Hes3 null mice compared to wild type controls (Fig. 2A,B). In the 5w/3w (three week regeneration) stage, Hes3 null mice exhibited slightly increased MBP expression.
2.3 The oli-neu oligodendrocyte precursor cell line expresses Hes3 and can be cultured in serumfree, defined conditions
We hypothesized that commonly used oligodendrocyte precursor cell lines such as oli-neu may express Hes3 when cultured under defined conditions and in the absence of factors that induce Janus kinase (JAK) activity, such as serum, enabling these cells to be used to study the STAT3-Ser/Hes3 Signaling Axis. Oli-neu cells are typically cultured in SATO medium supplemented with 1% horse serum (HS) [Culture condition: SATO/HS] (Jung et al., 1995) (Fig. 3). We also cultured oli-neu cells with the addition of 10%FBS as a means of powerfully activating JAK [Culture condition: SATO/HS/FBS]. Finally, we also cultured these cells under defined, serum-free conditions (using the base medium “N2”) in the presence of a JAK inhibitor [Culture condition: N2/JAK I./NoSerum] (Masjkur et al., 2014a).
4
Brightfield images show that oli-neu cells grow efficiently in all three conditions, although with differences in morphology (Fig. 4A). PCR analysis demonstrates the expression of Hes1, Hes3, GFAP, and Olig2 (Fig. 4B). Specifically, addition of FBS in the culture medium promoted the astrocytic phenotype with increased expression of GFAP and lower expression of Olig2, an early oligodendrocyte precursor marker. Hes3 is expressed in all conditions but its expression was greatly enhanced by addition of a JAK inhibitor in the N2/JAK I./No Serum conditions. Immunocytochemical analysis shows the expression of precursor markers in the three expansion culture conditions. Consistent with their oligodendroglial nature (Jung et al., 1995), half of the cells in SATO/HS and more than one third in N2/JAK I./NoSerum express the characteristic OPC marker O4 (48,6%±6,9% and 36,8%±5,1% respectively). In SATO/HS/FBS however, O4 is expressed in significantly lower levels (13,2%±1,3%). Cells express the early OPC marker Olig2 in all expansion conditions; its expression however is higher in SATO/HS and N2/JAK I./NoSerum (59%±7,2%, 44,3%±9,7% and 80%±7% in SATO/HS, SATO/HS/FBS and N2/JAK I./NoSerum respectively). The expression of MBP is low in all conditions, at approximately 1%. In SATO/HS and N2/JAK I./NoSerum the cells do not express GFAP (less than 1%). We note however that in SATO/HS/FBS the expression of GFAP is significantly higher than in the other two conditions, at 6,85%±1,24% (Fig. 4C,D).
Oli-neu cells in established culture systems can be induced to differentiate, allowing the study of their fate choice potential. Standard protocols involve the daily addition of 1mM dbcAMP to the growth conditions (Jung et al., 1995; Raible and McMorris, 1989; Raible and McMorris, 1993). In this work we implemented three differentiation protocols (Fig. 3). Specifically, we added dbcAMP to each of the three growth conditions described in Fig. 3 in order to induce differentiation. Immunohistochemical and PCR analyses show differences in differentiation potential in these three conditions; most striking is the increased GFAP expression in the presence of FBS (Fig. 4E,F). In all three differentiation protocols we observed an increase in Hes3 expression, following treatment with dbcAMP, in line with our previous observations that treatment of cultured mouse fetal and adult NSCs with cholera toxin (a potent activator of adenylate cyclase, leading to increased cAMP levels) also increases Hes3 expression and nuclear localization (Androutsellis-Theotokis et al., 2010). Fig. 5 shows a side-by-side comparison of Hes3 mRNA levels in oli-neu cells when these were cultured in SATO+FBS or N2 conditions with and without dbcAMP.
3. DISCUSSION
Hes3 has been implicated in the growth and survival of several immature and plastic cell types, including NSCs, iNSCs, glioblastoma cancer stem cells, adrenomedullary chromaffin progenitors, breast cancer cells, and pancreatic islet beta cells (Androutsellis-Theotokis et al., 2006; Masjkur et al., 2014a; Masjkur et al., 2014b; Ohta et al., 2012; Park et al., 2013; Salewski et al., 2012). Hes3 may also contribute to the reprogramming of adult cells into iNSCs (Cassady et al., 2014).
Here we establish assays and cell culture methods that will help the study of Hes3 in the context of
5
demyelination/remyelination. Using the in vivo cuprizone model of demyelination/remyelination we demonstrate that Hes3 mRNA expression is reduced in the demyelination stage and is partially restored at one and, even more, three weeks after cuprizone withdrawal. Although we focus on the spmCTX, these studies may be extended to other areas of the central nervous system
Using a Hes3 null mouse strain we show that in the uninjured brain, Hes3 null mice exhibit lower expression of MBP, relative to controls. This result suggests possible roles of Hes3 in myelination, inviting further study. MBP expression may be maintained through the action of Hes3 in myelinating oligodendrocytes or through the action of Hes3 on the oligodendrocyte progenitor compartment. Given that Hes3 is expressed on oligodendrocyte progenitors in vivo as well as in the oligodendrocyte progenitor cell line oli-neu in vitro, the latter seems to be, at least in part, a possible explanation. Our previous data establishing Hes3 as a biomarker of neural stem cells and glioblastoma cancer stem cells further supports a role of Hes3 in regulating the progenitor cell compartment and perhaps in maintaining it in the self-renewal state (Androutsellis-Theotokis et al., 2006; Androutsellis-Theotokis et al., 2009; Park et al., 2013). Such a function would ensure a healthy progenitor population which would then provide mature, myelinating (MBP+) cells.
Following de-myelination and re-myelination, especially at the 5w/3w time point, Hes3 null mice exhibit a slightly increased amount of MBP. This observation may not be expected if Hes3 positively regulates MBP expression in oligodendrocytes. However, it would be expected if Hes3 promotes the self-renewal state of oligodendrocyte progenitors. Our working hypothesis is that Hes3, by promoting progenitor cell self-renewal, delays myelination and MBP expression. Therefore, in the Hes3 null mice, progenitor cells (e.g., new progenitor cells generated in response to cuprizone) may differentiate into MBP+ oligodendrocytes faster than in the wild type controls, giving the result we obtained. This possibility raises the question of progenitor cell depletion in the Hes3 null mice, something that can be addressed with future, long-term experiments.
These results may suggest a role of Hes3 in maintaining the self-renewal state of oligodendrocyte progenitors, allowing for the appropriate amount of MBP at steady state (uninjured brains) but delaying the maturation of oligodendrocytes at early time points after damage (1 and 3 weeks). This would be in accordance with the role of Notch in controlling the timing of differentiation of oligodendrocyte progenitors by keeping them in an early progenitor state (Park and Appel, 2003; Wang et al., 1998; Zhang et al., 2009). To our knowledge, only the canonical branch of Notch and its downstream targets has been studied in remyelination (Boulanger and Messier, 2014; Franklin and Ffrench-Constant, 2008). Our results may encourage further studies on the role of the non-canonical Notch branch in remyelination and oligodendrocyte maturation.
To enable the study of Hes3 in an established oligodendrocyte progenitor cell line (oli-neu), we developed a cell culture method that maintains Hes3 expression as well as the self-renewal and differentiation potential of these cells. Key aspects of this culture system are the omission of serum
6
and the use of a JAK inhibitor, providing a defined medium composition. This culture system may be used for the study of the role(s) of Hes3 and other components of the STAT3-Ser/Hes3 Signaling Axis, as well as for drug discovery. For example, we identify a JAK inhibitor and dbcAMP as powerful inducers of Hes3 mRNA levels in these cells. With this work we introduce in vitro and in vivo tools that may be of use in the study of demyelinating diseases.
7
4. EXPERIMENTAL PROCEDURES
4.1 Animals. 6-week old C57Bl/6J male mice were used as previously described (Skripuletz et al., 2011). Experiments were carried out in accordance with the approved guidelines from the Landesdirektion Sachsen. Hes3 null mice were kindly provided by R. Kageyama (Hirata et al., 2001).
4.2 Oli-neu cell line culture Oli-neu cells were maintained and differentiated as previously described (Biname et al., 2013; FokSeang et al., 1995; Jung et al., 1995). For the N2/JAK I./NoSerum conditions, cells were cultured using NSC culture protocols (Androutsellis-Theotokis et al., 2006). 5-9 10x pictures per culture condition (N=3 or more) were randomly taken. Stained cells were manually counted with the “Cell Counter” plug-in from Fiji software (Schindelin et al., 2012).
4.3 Antibodies Rat anti-MBP (1:1000, MAB386, Merk-Millipore Darmstadt, Germany), rabbit anti-Olig2 (1:500, ab9610, Merk-Millipore, Darmstadt, Germany), chicken anti-GFAP (1:1000, ab4674, Abcam), mouse IgM O1 (1:200, MAB1327, R&D Systems Inc.) and mouse IgM O4 (1:200, MAB1326, R&D Systems Inc., Minneapolis, MN). Alexa-Fluor species-specific secondary antibodies were obtained from Jackson Immunoresearch Inc., West Grove, PA
4.4 MBP area and intensity Frozen brains were cut in cryostat in 16μm thick slices and mounted on glass slides. Pictures were taken with a Zeiss LSM780 confocal system. One picture per hemisphere between Bregma 0.02 and 1.18 lateral to midline were taken as a z-stack (z depth: 0.96μm pro stack). For the SUM projections the seven most central slides of the stack were combined using Fiji software and specific regions of interest (ROIs) were predefined for the spmCTX (Layer I) (Paxinos, 1998). At least 3 more ROIs were also created in MBP negative areas to measure and subtract the background staining. Myelination intensity, expressed as MBP staining intensity, was measured as the average of the mean pixel value of each ROI respectably for each anatomic area. For the area of myelination, expressed as the percentage of area of MBP staining, we used Fiji’s automatic threshold algorithm, “Otsu”. The average of ROIs for each field was calculated. Background ROIs were set to a value of 0. Immunohistochemistry was performed as previously described (Masjkur et al., 2014a). Data analysis was done in Microsoft Excel using student’s T-test. The motor cortex between Bregma 0.02 and 1.18 lateral to midline was dissected under a stereotactic microscope.
4.5 RNA isolation from tissue The motor cortex between Bregma 0.02 and 1.18 lateral to midline was dissected under a stereotactic microscope. RNA isolation from tissue was performed with the NucleoSpin® RNA Plus Kit (Mecherey-Nagel). Isolation from cells was performed with the Roche High Pure RNA Isolation Kit
8
(Roche 11828665001). RNA concentration and purity was tested by an OD260 and OD260/OD280 ratios respectively using Tecan Infinite M200Pro plate reader and software.
4.6 Reverse Transcriptase and Real Time PCR reaction We used the M-MLV Reverse Transcriptase Kit (Promega) and the DreamTaq Green DNA Polymerase Protocol (ThermoScientific). For real-time PCR, we used the BioRad Connect Real Time PCR Detection System with SsoFast EvaGreen Supermix Reagent (BioRad). For the analysis we used the ΔΔCt method of relative quantification using the expression of HPRT as a calibrator.
4.7 Primers Hes3_Fw: 5’- AAAGCTGGAGAAGGCCGATA -3’, Hes3_Rev: 5’- TCCTTGCCTACGTCTCACCA -3’, Hes3a_Fw: 5’- AAGCTCCCTGCCATAGCGGA -3’, Hes3a_Rev: 5’- ATGCGTGCACGGCGCTTCTT 3’,
Hes3b_Fw:
5’-
ACATCACAGCATGGGCACCGAGCCCACATC
-3’,
Hes3b_Rev:
5’-
GTTGATGCGTGCACGGCGCTTCTTC -3’, Hes1_Fw: 5’- CAGCCAGTGTCAACACGACAC -3’, Hes1_Rev: 5’- TCGTTCATGCACTCGCTGAG -3’, MBP_Fw: 5’- CTATAAATCGGCTCACAAGG -3’, MBP_Rev: 5’- AGGCGGTTATATTAAGAAGC -3’, GFAP_Fw: 5’- TCCTGGAACAGCAAAACAAG -3’, GFAP_Rev:
5’-
CAGCCTCAGGTTGGTTTCAT
-3’,
Olig2_Fw:
5’-
CAAATCTAATTCACATTCGGAAGGTTG -3’, Olig2_Rev: 5’- GACGATGGGCGACTAGACACC -3’, GalC_Fw: 5’- GCCTTATGGACGAAGTGGGT -3’, GalC_Rev: 5’- CTGCCGTCAAGGAGCCATA -3’, GAPDH_Fw: 5’- ATGACATCAAGAAGGTGGTG -3’, GAPDH_Rev: 5’- CATACCAGGAAATGAGCTTG -3’, HPRT_Fw: 5’- AAGCTTGCTGGTGAAAAGGA -3’, HPRT_Rev: 5’- TTGCGCTCATCTTAGGCTTT -3’
9
ACKNOWLEDGMENTS/CONFLICT OF INTEREST DISCLOSURE
This work was funded by a grant from the Else Kroener-Fresenius Foundation and a grant from the Deutsche Forschungsgemeinschaft (SFB 655: Cells into tissues). The funding sources had no involvement in the conduct of the research or the preparation of the article. We thank Prof. J. Trotter for kindly providing the Oli-neu cell line. We thank Dr. Ryoichiro Kageyama for kindly providing the Hes3 null mouse strain. The authors have no conflict of interest to declare.
LT, PN, and SWP designed and performed experiments, analyzed data and wrote the manuscript; JM, CA-F, MT, SG, VB, UF performed experiments; TJ, and SRB designed experiments, analyzed data and wrote the manuscript; CT interpreted data and edited the manuscript; AA-T generated the manuscript concept, designed experiments, analyzed data and wrote the manuscript. All authors have approved the final article.
Supplementary Figure 1. Uncropped version of Figure 1E. PCR detection of Hes3 mRNA in the spmCTX (both hemispheres pooled together; “M”: molecular weight markers; L32 rRNA and hypoxanthine phosphoribosyltransferase/HRPT are used as internal standards).
10
REFERENCES
Androutsellis-Theotokis, A., Leker, R.R., Soldner, F., Hoeppner, D.J., Ravin, R., Poser, S.W., Rueger, M.A., Bae, S.K., Kittappa, R., McKay, R.D., 2006. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature. 442, 823-6. Androutsellis-Theotokis, A., Rueger, M.A., Mkhikian, H., Korb, E., McKay, R.D., 2008. Signaling pathways controlling neural stem cells slow progressive brain disease. Cold Spring Harb Symp Quant Biol. 73, 403-10. Androutsellis-Theotokis, A., Rueger, M.A., Park, D.M., Mkhikian, H., Korb, E., Poser, S.W., Walbridge, S., Munasinghe, J., Koretsky, A.P., Lonser, R.R., McKay, R.D., 2009. Targeting neural precursors in the adult brain rescues injured dopamine neurons. Proc Natl Acad Sci U S A. 106, 13570-5. Androutsellis-Theotokis, A., Walbridge, S., Park, D.M., Lonser, R.R., McKay, R.D., 2010. Cholera toxin regulates a signaling pathway critical for the expansion of neural stem cell cultures from the fetal and adult rodent brains. PLoS One. 5, e10841. Biname, F., Sakry, D., Dimou, L., Jolivel, V., Trotter, J., 2013. NG2 regulates directional migration of oligodendrocyte precursor cells via Rho GTPases and polarity complex proteins. J Neurosci. 33, 10858-74. Blakemore, W.F., 1973. Remyelination of the superior cerebellar peduncle in the mouse following demyelination induced by feeding cuprizone. J Neurol Sci. 20, 73-83. Bo, L., Vedeler, C.A., Nyland, H.I., Trapp, B.D., Mork, S.J., 2003. Subpial demyelination in the cerebral cortex of multiple sclerosis patients. J Neuropathol Exp Neurol. 62, 723-32. Boulanger, J.J., Messier, C., 2014. From precursors to myelinating oligodendrocytes: contribution of intrinsic and extrinsic factors to white matter plasticity in the adult brain. Neuroscience. 269, 343-66. Cassady, J.P., D'Alessio, A.C., Sarkar, S., Dani, V.S., Fan, Z.P., Ganz, K., Roessler, R., Sur, M., Young, R.A., Jaenisch, R., 2014. Direct lineage conversion of adult mouse liver cells and B lymphocytes to neural stem cells. Stem Cell Reports. 3, 948-56. Denic, A., Johnson, A.J., Bieber, A.J., Warrington, A.E., Rodriguez, M., Pirko, I., 2011. The relevance of animal models in multiple sclerosis research. Pathophysiology. 18, 21-9. Fok-Seang, J., Mathews, G.A., ffrench-Constant, C., Trotter, J., Fawcett, J.W., 1995. Migration of oligodendrocyte precursors on astrocytes and meningeal cells. Dev Biol. 171, 1-15. Franklin, R.J., Ffrench-Constant, C., 2008. Remyelination in the CNS: from biology to therapy. Nat Rev Neurosci. 9, 839-55. Hatakeyama, J., Bessho, Y., Katoh, K., Ookawara, S., Fujioka, M., Guillemot, F., Kageyama, R., 2004. Hes genes regulate size, shape and histogenesis of the nervous system by control of the timing of neural stem cell differentiation. Development. 131, 5539-50. Hirata, H., Ohtsuka, T., Bessho, Y., Kageyama, R., 2000. Generation of structurally and functionally distinct factors from the basic helix-loop-helix gene Hes3 by alternative first exons. J Biol Chem. 275, 19083-9. Hirata, H., Tomita, K., Bessho, Y., Kageyama, R., 2001. Hes1 and Hes3 regulate maintenance of the isthmic organizer and development of the mid/hindbrain. Embo J. 20, 4454-66. Imayoshi, I., Kageyama, R., 2014. bHLH factors in self-renewal, multipotency, and fate choice of neural progenitor cells. Neuron. 82, 9-23. Jung, M., Kramer, E., Grzenkowski, M., Tang, K., Blakemore, W., Aguzzi, A., Khazaie, K., Chlichlia, K., von Blankenfeld, G., Kettenmann, H., et al., 1995. Lines of murine oligodendroglial precursor cells immortalized by an activated neu tyrosine kinase show distinct degrees of interaction with axons in vitro and in vivo. Eur J Neurosci. 7, 1245-65.
11
Kipp, M., Clarner, T., Dang, J., Copray, S., Beyer, C., 2009. The cuprizone animal model: new insights into an old story. Acta Neuropathol. 118, 723-36. Masjkur, J., Arps-Forker, C., Poser, S.W., Nikolakopoulou, P., Toutouna, L., Chenna, R., Chavakis, T., Chatzigeorgiou, A., Chen, L.S., Dubrovska, A., Choudhary, P., Uphues, I., Mark, M., Bornstein, S.R., Androutsellis-Theotokis, A., 2014a. Hes3 is Expressed in the Adult Pancreatic Islet and Regulates Gene Expression, Cell Growth, and Insulin Release. J Biol Chem. Masjkur, J., Levenfus, I., Lange, S., Arps-Forker, C., Poser, S., Qin, N., Vukicevic, V., Chavakis, T., Eisenhofer, G., Bornstein, S.R., Ehrhart-Bornstein, M., Androutsellis-Theotokis, A., 2014b. A Defined, Controlled Culture System for Primary Bovine Chromaffin Progenitors Reveals Novel Biomarkers and Modulators. Stem Cells Transl Med. Matsushima, G.K., Morell, P., 2001. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol. 11, 107-16. Ohta, S., Misawa, A., Fukaya, R., Inoue, S., Kanemura, Y., Okano, H., Kawakami, Y., Toda, M., 2012. Macrophage migration inhibitory factor (MIF) promotes cell survival and proliferation of neural stem/progenitor cells. J Cell Sci. 125, 3210-20. Park, D.M., Jung, J., Masjkur, J., Makrogkikas, S., Ebermann, D., Saha, S., Rogliano, R., Paolillo, N., Pacioni, S., McKay, R.D., Poser, S., Androutsellis-Theotokis, A., 2013. Hes3 regulates cell number in cultures from glioblastoma multiforme with stem cell characteristics. Sci Rep. 3, 1095. Park, H.C., Appel, B., 2003. Delta-Notch signaling regulates oligodendrocyte specification. Development. 130, 3747-55. Paxinos, G.a.W., C, 1998. The Rat Brain in Stereotaxic Coordinates. Vol., Elsevier/Academic Press, New York, NY. Raible, D.W., McMorris, F.A., 1989. Cyclic AMP regulates the rate of differentiation of oligodendrocytes without changing the lineage commitment of their progenitors. Dev Biol. 133, 437-46. Raible, D.W., McMorris, F.A., 1993. Oligodendrocyte differentiation and progenitor cell proliferation are independently regulated by cyclic AMP. J Neurosci Res. 34, 287-94. Salewski, R.P., Buttigieg, J., Mitchell, R.A., van der Kooy, D., Nagy, A., Fehlings, M.G., 2012. The generation of definitive neural stem cells from PiggyBac transposon-induced pluripotent stem cells can be enhanced by induction of the NOTCH signaling pathway. Stem Cells Dev. 22, 383-96. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J.Y., White, D.J., Hartenstein, V., Eliceiri, K., Tomancak, P., Cardona, A., 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods. 9, 676-82. Skripuletz, T., Lindner, M., Kotsiari, A., Garde, N., Fokuhl, J., Linsmeier, F., Trebst, C., Stangel, M., 2008. Cortical demyelination is prominent in the murine cuprizone model and is straindependent. Am J Pathol. 172, 1053-61. Skripuletz, T., Gudi, V., Hackstette, D., Stangel, M., 2011. De- and remyelination in the CNS white and grey matter induced by cuprizone: the old, the new, and the unexpected. Histol Histopathol. 26, 1585-97. Torkildsen, O., Brunborg, L.A., Myhr, K.M., Bo, L., 2008. The cuprizone model for demyelination. Acta Neurol Scand Suppl. 188, 72-6. Wang, S., Sdrulla, A.D., diSibio, G., Bush, G., Nofziger, D., Hicks, C., Weinmaster, G., Barres, B.A., 1998. Notch receptor activation inhibits oligodendrocyte differentiation. Neuron. 21, 63-75. Wegner, C., Esiri, M.M., Chance, S.A., Palace, J., Matthews, P.M., 2006. Neocortical neuronal, synaptic, and glial loss in multiple sclerosis. Neurology. 67, 960-7. Zendedel, A., Beyer, C., Kipp, M., 2013. Cuprizone-induced demyelination as a tool to study remyelination and axonal protection. J Mol Neurosci. 51, 567-72. 12
Zhang, Y., Argaw, A.T., Gurfein, B.T., Zameer, A., Snyder, B.J., Ge, C., Lu, Q.R., Rowitch, D.H., Raine, C.S., Brosnan, C.F., John, G.R., 2009. Notch1 signaling plays a role in regulating precursor differentiation during CNS remyelination. Proc Natl Acad Sci U S A. 106, 19162-7.
FIGURE LEGENDS
Figure 1. Hes3 expression in the adult mouse spmCTX is regulated in different stages of the cuprizone model of demyelination and remyelination. (A) Schematic diagram of the experimental animal groups used: control mice (8 weeks of control diet); mice placed on a cuprizone-containing diet for 5 weeks and euthanized immediately after (5w/0w); mice placed on a cuprizone-containing diet for 5 weeks, then placed on a normal diet for 1 or 3 weeks and euthanized immediately after (5w/1w and 5w/3w, respectively). (B) Immunohistochemical analysis of MBP signal in the spmCTX in different animal groups. (C) Quantification of MBP signal (measured as coverage area times intensity) from the images in (B) (Error bars: SEM, N=4, **p<0.00025, within Bonferroni limits).(D) Number of O4+ and O1+ cells in the spmCTX (data from both hemispheres were pooled together) at the different stages of the cuprizone model. (E) PCR detection of Hes3 mRNA in the spmCTX (both hemispheres pooled together; “M”: molecular weight markers; L32 rRNA and hypoxanthine phosphoribosyltransferase/HRPT are used as internal standards). (F) Diagram showing the dissected spmCTX area used for the analyses. (G) Quantitative PCR analysis of Hes3a and Hes3b mRNA in samples from the dissected spmCTX. (Error bars: SEM, N=4, *p<0.0083, **p<0.0016, within Bonferroni limits).
13
Figure 2. Hes3 null mice exhibit differences in MBP signal in different stages of the cuprizone model, relative to controls. (A) Immunohistochemical detection of MBP in control and Hes3 null mice subjected to the cuprizone model (Scale bars: 20μm). (B) Quantification of the MBP signal (coverage area x signal intensity) from immunohistochemical analyses in control and Hes3 null mice subjected to the cuprizone model (Error bars: SEM, N=3-4, *p<0.05, **p<0.01).
14
Figure 3. Schematic diagram of the culture conditions used for differentiation.
15
Figure 4. The oli-neu oligodendroglial precursor cell line expresses Hes3 and can be cultured in serum-free, defined conditions. (A) Brightfield 10x image examples of oli-neu cells cultured in different conditions. (Self-renewal conditions; Scale bars: 100μm). (B) Reverse Transcriptase PCR analysis of Hes1, Hes3, GFAP, and Olig2 in the different self-renewal culture conditions. (C) Examples of immunohistochemical detection of oligodendrocyte lineage biomarkers in the different self-renewal culture conditions (expansion conditions; scale bars 50μm). (D) Quantification of biomarker expression as a percentage of DAPI in the self-renewal culture conditions. (Error bars: SEM, N=3-4, *p<0.05, **p<0.01). (E) Reverse Transcriptase PCR analysis of Hes1, Hes3, GalC, MBP, and GFAP following induced differentiation (by addition of 1mM dbcAMP) in the different culture conditions. (F) Immunohistochemical detection of O4, MBP, and GFAP following induced differentiation in the different culture conditions (by addition of dbcAMP). (Scale bars 50μm).
16
Figure 5. dbcAMP induces Hes3 transcription. (A) PCR analysis for Hes3 demonstrates that in both SATO+FBS and N2 oli-neu culture conditions, dbcAMP (1mM for 2 days) increases Hes3 mRNA levels.
17
Highlights
Hes3 is regulated in mouse models of demyelination and remyelination Hes3 null mice exhibit altered regulation of myelin basic protein Serum-free culture systems for oli-neu cells allow the study of Hes3 in vitro dbcAMP induces Hes3 expression in the oli-neu cell line
18