- Email: [email protected]
Heterodimerization of γ-aminobutyric acid B receptor subunits as revealed by the yeast two-hybrid system
Methods 27 (2002) 301–310 www.academicpress.com
Heterodimerization of c-aminobutyric acid B receptor subunits as revealed by the yeast two-hybrid system Julia H. White,a,* Alan Wise,b and Fiona H. Marshallc a
Pathway Discovery, GlaxoSmithKline, Gunnels Wood Road, Stevenage, Hertfordshire, SG1 2NY, UK Systems Research, GlaxoSmithKline, Gunnels Wood Road, Stevenage, Hertfordshire, SG1 2NY, UK Molecular Pharmacology, Millennium Pharmaceuticals Ltd., Granta Park, Great Abington, Cambridge, CB1 6ET, UK b
c
Accepted 4 June 2002
Abstract Several lines of evidence suggested that the first c-aminobutyric acid B receptor to be cloned required an additional factor for functional expression. GABAB1 was retained within the endoplasmic reticulum and failed to couple to signal transduction pathways on stimulation with agonists. In radioligand binding experiments it was found that although the affinity of antagonists showed a close agreement between rat brain membranes and membranes expressing the cloned receptor, agonist ligands were significantly weaker at recombinant receptors. Using the C-terminal tail as bait, a yeast two-hybrid screen was run against a human brain cDNA library and identified a second receptor, GABAB2 , as a major interacting protein. This interaction was confirmed by coimmunoprecipitation as well as extensive colocalization studies. Coexpression of the two seven-transmembrane proteins generated a fully functional receptor, which was expressed at the cell surface confirming the importance of receptor heterodimerization for GABAB receptor activity. 2002 Elsevier Science (USA). All rights reserved. Keywords: c-Aminobutyric acid B receptor; Coimmunoprecipitation; Glycosylation; Yeast two-hybrid system; GTPcS binding
1. Introduction It is now well established that G-protein-coupled receptors (GPCRs) are able to oligomerize into both homodimers and heterodimers and that this can result in changes in the ligand specificity, pharmacology, and signaling of receptors [1,2]. This has important implications for understanding and characterizing receptor function and also for developing new drugs acting on this protein superfamily. The c-aminobutyric acid B ðGABAB Þ heterodimeric receptor is, to date, the only known example where two seven-transmembrane receptors must come together to form an obligate heterodimer, where neither of the receptor subunits is functional when expressed alone. A similar situation, however, exists with the CGRP and adrenomedullin receptors where a GPCR must heterodimerize with single-transmembrane proteins known as RAMPs to form fully functional receptors [3]. Within the human *
Corresponding author. E-mail address: [email protected] (J.H. White).
genome more than 700 GPCRs have been identified, around half of which remain orphan receptors despite extensive screening against large numbers of candidate ligands. One possibility is that some of these orphan receptors like the GABAB receptor require another partner to be functional. By considering the techniques that led to the recognition that the GABAB receptor requires an additional ‘‘factor’’ to be functional, we can begin to assess whether other orphan receptors may be candidates for heterodimerization or RAMP-like accessory proteins. The GABAB receptor was described [4] many years prior to cloning and its pharmacology, localization, and signaling mechanisms were well characterized using native tissue. The first GABAB receptor (GABAB1 ) was expression cloned in 1997 [5]. However, from the outset, there were clearly discrepancies between the recombinant receptor and the endogenous receptor, as characterized from brain membranes. First, in radioligand binding studies, agonist affinities were found to be around 100-fold weaker in membranes prepared from cells expressing GABAB1 compared with those prepared
1046-2023/02/$ - see front matter 2002 Elsevier Science (USA). All rights reserved. PII: S 1 0 4 6 - 2 0 2 3 ( 0 2 ) 0 0 0 8 7 - 7
302
J.H. White et al. / Methods 27 (2002) 301–310
from rat brain. Second, only very weak functional responses in an adenylyl cyclase assay were described. In our hands GABAB1 failed to respond to GABA or other known GABAB agonists using a variety of different functional readouts. Assuming there are no errors in the cDNA construct, the most likely reason a receptor fails to respond to agonists as expected is either a low level of protein expression or a lack of receptor expression at the cell surface. Both of these possibilities can be studied using Western blotting or flow cytometry comparing intact and permeabilized cells. This can be done using antibodies raised to the native protein or, more commonly, using antibodies to N-terminal epitope tags. In the case of the GABAB receptor, GABAB1 was not expressed at the cell surface and further studies examining the glycosylation status of the protein suggested that it was retained within the endoplasmic reticulum (ER) [7,8]. This suggested that an associated protein was required to traffic the receptor to the plasma membrane. To identify such receptor-associated cofactors, a number of approaches can be employed, each with its advantages and drawbacks. These include affinity purification, when high-affinity antisera or ligands are available, and expression-cloning approaches, where libraries are screened to generate receptor function (e.g., [3]). However, one of the most powerful approaches to the selection and identification of associated proteins is that of the yeast two-hybrid (Y2H) system (see [8]). This relies on the functional assembly of a transcription factor in the yeast nucleus as a result of two proteins interacting. Y2H possesses the advantage that it is a relatively easy technique in vivo for the discovery of unknown protein interactions within the context of the living cell, unlike other techniques in vitro such as gel overlay assays and affinity pulldowns. The use of Y2H led to the identification of a strong interaction between GABAB1 and a second related GPCR, called GABAB2 [6,9]. The interaction was mediated through coiled-coil domains located within the C-terminal tails of both receptors [6,9,10]. However, subsequent publications have suggested that the extracellular and transmembrane domains are also involved [11,12]. The initial observation, suggesting receptor heterodimerization, was confirmed biochemically using coimmunoprecipitation. Coexpression of GABAB2 with GABAB1 enabled GABAB1 to be expressed at the cell surface as a mature glycoprotein, which responded to GABAB agonists in functional assays [6,13,14]. This observation of heterodimerization has subsequently been confirmed in vivo by other techniques including coimmunoprecipitation of native receptors and extensive distribution studies using immunohistochemistry and in situ hybridization techniques. Moreover, the mechanism by which GABAB2 trafficks GABAB1 to the cell surface has also been elucidated [11,15,16] and is further described by Margeta-Mitrovic in this issue.
2. Methods 2.1. The yeast two-hybrid system The yeast two-hybrid or Interaction trap system is a powerful genetic approach using engineered strains of the budding yeast Saccharomyces cerevisiae for the discovery and characterization of protein–protein interactions. The method was first developed over a decade ago [17] and has been extensively used for many protein targets [8,18]. In principle, the system relies on the modular nature of transcription factors, with distinct functional domains. One domain, the DNA binding domain (BD), is responsible for binding the transcription factor to a target DNA sequence within a promoter while a second domain, the activation domain (AD), recruits the transcriptional machinery to promote gene transcription. The two-hybrid system exploits the fact that a binding domain is incapable of activating transcription unless it is physically, but not necessarily covalently, attached to an activation domain. Therefore, to establish a two-hybrid interaction, the protein of interest, generally referred to as the bait, is expressed via a yeast expression vector as a fusion with the BD of a transcription factor (Fig. 1). Commonly, the yeast GAL4 BD or Escherichia coli lexA BD is used in conjunction with the appropriate promoter recognition sequences. The expression plasmid, once transformed into the yeast host, expresses the desired BD–bait fusion in the nucleus. The yeast host cell is engineered to possess sensitive reporter genes responsive to the particular BD by the appropriate activating specific sequences being present within the promoter. The BD binds to this promoter, and if the bait fusion protein fails to activate transcription in the absence of other expressed proteins, then it is suitable for Y2H analysis. To identify unknown associated protein partners against particular baits, the bait must be exposed in the yeast cell to a relevant cDNA library of proteins expressed as activation domain (AD) fusions. Typical ADs employed in many of the Y2H systems are S. cerevisiae GAL4, herpes simplex virus VP16, and E. coli B42. Proteins that associate with the bait bring the BD and AD into juxtaposition, creating a functional transcription factor. This hybrid transcription factor thus results in expression from the reporter gene, allowing selection of yeast expressing the interacting protein partners. One of the main advantages of the Y2H system resides in its sensitive and selectable reporter genes that permit interacting proteins to be selected rapidly from the multiple genes present within a cDNA library. Generally, there are two types of reporter genes: those encoding a nutritional requirement, such as the HIS3 or LEU2 gene products, and those encoding genes with an enzymatic activity that can be measured quantitatively. Reporters encoding a nutritional gene allow positive interactors to
J.H. White et al. / Methods 27 (2002) 301–310
Fig. 1. The yeast two-hybrid system. (a) Schematic representation of the Y2H system. Bait protein is expressed in yeast as a fusion with a binding domain such as GAL4BD . Similarly, the potential interactor ‘‘prey’’ protein is expressed as a fusion with an activation domain, such as GAL4AD . Both fusion proteins translocate to the yeast nucleus, where the BD is able to bind its recognition sequence with the promoter of a reporter construct. The BD fusion is unable to activate transcription alone but when the bait and prey proteins interact, a functional transcription factor is formed that activates transcription from the reporter gene. (b) Library screening by Y2H. Plasmids expressing bait–BD fusions and a library of AD–cDNA fusions are cotransformed into a Y2H engineered yeast strain. By means of the activation of selectable nutritional reporter genes, only those yeast transformants coexpressing a functional transcription factor through a bait-and-prey interaction grow to form colonies on selective agar. A second reporter gene encoding b-galactosidase is likewise activated so the yeast colonies will turn blue in the presence of the X-Gal chromagenic substrate. Those yeast cells expressing nonassociating library proteins will not produce a functional transcription factor, will not activate transcription, and therefore will not grow into colonies on the selective agar.
be selected by colony growth in the absence of the exogenous supplement, as the yeast host has the genomic copy of the gene deleted and is thus unable to grow in the absence of a functional Y2H interaction. This results in a powerful positive selection pressure for the preferential growth of a clonal population expressing the interacting library insert. Moreover, use of the HIS3-encoded imidazoleglycerol-phosphate dehydratase reporter gene in the presence of the competitive inhibitor 3-AT 3-amino-
303
1,2,4-triazole (3-AT) allows only those yeast cells expressing sufficient levels of strongly associated two-hybrid interactors to overcome the 3-AT levels and to be growth-selected. This allows the stringency of a screen to be set according to the level of 3-AT added. Typically the LacZ gene, encoding b-galactosidase, is used for the latter type of ‘‘enzymatic activity’’ reporter. b-Galactosidase has the advantage of being extremely stable in yeast and can be readily detected using extremely sensitive chromagenic substrates such as 5-bromo-4-chloro-3-indolyl-b-D -galactopyranoside (X-Gal) and o-nitrophenyl-b-galactopyranoside (ONPG). The main disadvantage is that these substrates are non-cellpermeable and require a lysis step in the assay. A permeable b-galactosidase substrate is now available (X-a-GAL), which enables b-galactosidase activity to be scored in living cells. Once an interaction between two proteins is positively scored from both reporter genes, then polymerase chain reaction (PCR) and/or plasmid rescue and amplification in E. coli can be used to recover cDNA library inserts for sequence analysis. However, some proteins are wellknown promiscuous interactors and either have no obvious relevance to the bait or interact with multiple unrelated baits in a nonspecific manner (otherwise known as false positives). To eliminate these, associations should be confirmed against the original bait, as well as against a panel of unrelated baits to check specificity. Although the specificity checks will eliminate many of false positives, any interactions discovered by the Y2H system need to be verified through independent biochemical and functional assays. Indeed, like all techniques, Y2H possesses several advantages and limitations (Table 1). 2.2. Yeast two-hybrid screening 2.2.1. Yeast strains, plasmids, and media Saccharomyces cerevisiae Y190 [MATa, gal4 gal80, ade2-101, his3, trp1-901, ura3-52, leu2-3, 112, URA3::GAL1-lacZ, LYS2::GAL1-HIS3, cyhR ] was used for all described yeast two-hybrid work [22,23] Gal4BD fusion vectors were either pYTH9 [19] or pYTH16, an episomal version of pYTH9, and the Gal4AD vector used was pACT2 [22]. A total Human Brain MATCHMAKER library (HL4004AH) in pACT2 was purchased from Clontech Laboratories (Palo Alto, CA) and amplified according to the manufacturer’s instructions. All yeast were maintained on standard yeast media [24]. 2.2.2. Construction of bait vectors The GABAB1 C-terminal domain was amplified from the full-length clone, using PCR primers 50 -GTTGTCC CCATGGTGCCCAAGATGCGCAGGCTGATCACC and 50 -GTCCTGCGGCCGCGGATCCTCACTTATA
304
J.H. White et al. / Methods 27 (2002) 301–310
Table 1 Yeast two-hybrid system Advantages • • • • • • • • •
Y2H is an extremely inexpensive technique, requiring no specialized items of equipment. Yeast cells have excellent molecular genetic technologies established and are easy to use. Y2H is a eukaryotic in vivo technology, as opposed to in vitro interaction assays. Y2H is extremely sensitive and can detect weak and/or transient interactions. Several Y2H kits are commercially available together with many premade cDNA libraries from a variety of hosts and tissues. Versions of the Y2H system are available that express from regulated promoters, thus allowing toxic proteins to be examined. Baits can be made up from whole proteins or subdomains. Empirically, subdomains often work better. Y2H allows for rapid and sensitive cDNA library screening for unknown interacting partners. The approach generates information on the interaction domain and yields the cDNA clone as part of the result. Many modifications of the Y2H system have been developed including one-and trihybrid systems. Limitations
• • •
• • •
Yeast is a lower eukaryotic cell and does not mirror the cellular context of higher eukaryotic cells. Bait proteins are transported to the yeast nucleus and this may not be the correct cellular compartment for the type of protein under investigation. Y2H is an overexpression system, with baits expressed as fusion proteins in the (often) foreign context of the yeast nucleus; therefore, it is prone to generate ‘‘false positive.’’ Thereby all Y2H interactions need to be validated by some independent experimentation. Y2H systems exist that use low-copy vectors to try to minimize numbers of false positives. Bait protein must be correctly folded into its native confirmation when expressed as a BD fusion in the nucleus. The position of the fusion junction can markedly influence protein folding and thereby the ability to interact with a protein partner. Certain classes of proteins are generally not amenable to Y2H. This includes transcription factors, proteins spanning the membrane several times over, extracellular domains, and those baits that are able to promote promiscuous transcription. Y2H will not detect associations dependent on certain posttranslational modifications such as glycosylation. However phospho-dependent interactions can be detected by trihybrid screening.
AAGCAAATGCACTCG. PCR conditions were for Taq polymerase (Perkin–Elmer, Norwalk, CT) and run using a Perkin–Elmer, 9600 PCR cycler for an initial heating of 95 C 3 min; followed by 25 cycles of 95 C 1 min, 55 C 1 min, and 72 C 3 min; followed by 72 C for 10 min and storage at 4 C. PCR product was sizefractionated on 0.8% agarose, gel purified, and restricted with NcoI and NotI restriction enzymes for direct subcloning into pYTH9 polylinker. This construct contains the C-terminal 108 amino acids from the base of TM7. The cloned PCR product was sequenced and confirmed as error free and fused in-frame to yeast GAL4BD . 2.2.3. Construction of screening yeast host strain and library transformation The GAL4BD –GABAB1 C-terminal fusion in pYTH9 was stable integrated into the genome of yeast Y190 at the trp1 locus by targeted homologous recombination (19). Y190 cells expressing the GAL4BD –GABAB1 Cterminal fusion were selected and a high-efficiency yeast transformation protocol was adopted to transform in the brain cDNA library. Briefly, approximately 1 1010 cells were grown to mid-log phase in YEPD at 30 C, washed both in sterile water and in 0.1 M lithium acetate/ 1 TE (pH 7.5), and finally resuspended in 4.0 ml 0.1 M lithium acetate/TE solution. One hundred micrograms of library plasmid, together with 4.0 mg sheared salmon sperm DNA, was added to the cells and 24 ml of 0.1 M lithium acetate/40% polyethylene glycol (PEG) 3350 added. Cells were incubated at 30 C for 30 min, and then heat-shocked at 42 C for 15 min. Cells were harvested,
resuspended in 10 ml sterile water, and plated onto 10 Nunc bioassay dishes containing selective agar plus 20 mM 3-AT. Plates were incubated for several days at 30 C and positive clones, which grew under selection and expressed LacZ, were selected for further analysis. 2.2.4. Freeze-fracture assays Yeast colonies were transferred by replica plating onto Whatman No. 54 filter papers and rapidly lysed by being dipped twice into liquid nitrogen and allowed to thaw inbetween. Each filter was incubated in 2 ml of Z-buffer (60 mM Na2 HPO4 7H2 O, 40 mM NaH2 PO4 H2 O, 10 mM KCl, 0.1 mM MgSO4 7H2 O, pH 7.0) containing 1 mg/ml X-Gal and 0.27% (v/v) 2-mercaptoethanol. Filters are incubated at 37 C until a blue color. 2.2.5. Quantification of b-galactosidase activity Approximately 2 108 cells, grown to logarithmic phase, were harvested, resuspended in 200 ll 0.1 M Tris– Cl, pH 7.5/0.05% Triton X-100, and lysed by twice snapfreezing in liquid nitrogen. An aliquot of each sample (V) depending on lacZ activity was added to 200 ll of 4 mg/ml o-nitrophenyl-b-galactopyranosides (ONPG)/ Z-buffer/0.27% (v/v) 2-mercaptoethanol and incubated at 37 C until a light straw color was observed. The reaction was stopped by addition of 500 ll 1 M Na2 CO3 and A420 values were measured. Cell concentration was estimated by resuspending 20 ll of lysed cell debris in 1 ml H2 O and measuring A600 (W). b–Gal activity (units, U) is measured as U ¼ 100ðA420 Þ=½A600 V T , where T is time of incubation for the assay.
J.H. White et al. / Methods 27 (2002) 301–310
2.3. Y2H screening of the GABAb R1 C terminus (Fig. 2) Approximately 4 106 human brain library cDNAs were transformed against the C terminus of GABAB1 ‘‘bait’’ and grown on selective medium in the presence of 20 mM 3-AT for 3–7 days at 30 C. Yeast showing activation of both HIS3 and LacZ reporter genes were selected; the library plasmid was recovered from the yeast and sequenced. In total, two main interacting proteins were recovered several times, each being confirmed as a strong specific interactor in the confirmatory and specificity assays. The first interacting library cDNA encoded the C terminus of the related GABAB2 receptor and all clones recovered expressed the coiled-coil domain but not the seventh transmembrane (TM) domain of the receptor, as expected since TM domains do not work well in Y2H. Subsequent assays for the LacZ reporter proved that the GABAB1 and GABAB2 C termini associated as a heterodimer but homodimerization could not be detected (Fig. 2). Interestingly, the second associated protein, recovered in greater abundance than GABAB2 C terminus, was the CREB2 or ATF4 transcription factor [20,21].
Fig. 2. Y2H demonstrates herodimerization but not homodimerization between GABAB1 and GABAB2 C termini. b-Galactosidase activity was measured in yeast strain Y190 expressing GABAB1 or GABAB2 C termini or with empty vector as controls, either by (a) freeze-fracture assay or (b) quantified using ONPG relative to cell numbers. (Copyright permission from Nature, http://www.nature.com/.) Of each combination of proteins expressed, the first named represents the GAL4BD fusion and the second is the Gal4AD fusion. GAL4BD and GAL4AD denote empty-vector controls.
305
2.4. Confirmation of yeast two-hybrid interaction following expression in mammalian cells: use of coimmunoprecipitation Based on the identification of the putative interaction using Y2H we next confirmed the interaction by immunoprecipitation studies. Myc-tagged GABAB1b and or hemagglutinin (HA)-tagged GABAB2 was transiently expressed in HEK293T cells. Immunoprecipitation of Myc-GABAB1b from detergent-solubilized cell fractions with Myc antisera led to immunodetection of HA-GABAB2 within immune complexes using HA as the primary antibody, but only on receptor coexpression (Fig. 3, lanes 1–3). GABAB1 and GABAB2 association was also confirmed by coimmunodetection of Myc–GABAB1b from immune complexes captured using the anti-HA antibody, when the two receptor forms were coexpressed (Fig. 3, lanes 4–6). Transfection and immunoprecipitation procedures are outlined below. Cell culture and transfection HEK293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/ v) fetal calf serum and 2 mM glutamine. Cells were seeded in 60-mm culture dishes and grown to 60–80% confluency (18–24 h) prior to transfection with pCDNA3 containing the relevant DNA species using LipofectAMINE reagent. For transfection, 3 lg of DNA was mixed with 10 ll of LipofectAMINE in 0.2 ml of Opti-MEM (Life Technologies) and was incubated at room temperature for 30 min prior to the addition of 1.6 ml of Opti-MEM. Cells were exposed to the LipofectAMINE/DNA mixture for 5 h and 2 ml of 20% (v/v) newborn calf serum in DMEM was then added. Cells were harvested 48–72 h after transfection.
Fig. 3. Coimmunoprecipitation studies of the GABAB heterodimer in HEK293T cells. Lanes 1, 4: immunoprecipitates of cells transfected with Myc–GABAB R1b only; lanes 2, 5: HA–GABAB R2 only; lanes 3, 6: immunoprecipitates of cells transfected with Myc–GABAB R1b together with HA–GABAB R2. Lanes 1–3: lysates immunoprecipitated with 9E10 (Myc) and blotted to 12CA5 (HA); lanes 4–6: lysates immunoprecipitated with 12CA5 (HA) and blotted with 9E10 (Myc). (Copyright permission from Nature, http://www.nature.com/.)
306
J.H. White et al. / Methods 27 (2002) 301–310
2.4.1. Immunoprecipitation procedures Transiently transfected HEK293T cells were harvested as described above. Cells from each dish were resuspended in 1 ml of 50 mM Tris–HCl, 150 mM NaCl, 1% (v/v) Nonidet P-40, 0.5% (w/v) sodium deoxycholate, pH 7.5 (lysis buffer), supplemented with Complete protease inhibitor cocktail tablets (1 tablet/25 ml) (Roche Diagnostics). Cell lysis and membrane protein solubilization were achieved by homogenization for 20 s with a Polytron homogenizer followed by gentle mixing for 30 min at 4 C. Insoluble debris was removed by microcentrifugation at 16,000g for 15 min at 4 C and the supernatant was precleared by incubating with 50 ll of protein A–agarose (Roche Diagnostics) for 3 h at 4 C on a helical wheel to reduce background caused by nonspecific adsorption of cellular proteins. The solubilized supernatant was then divided into 2 500-ll aliquots and 20 ll of either HA or Myc antiserum was added to each. Immunoprecipitation was allowed to proceed for 1 h at 4 C on a helical wheel prior to the addition of 50 ll of protein A–agarose suspension. Capture of immune complexes progressed overnight at 4 C on a helical wheel. Complexes were then collected by microcentrifugation 12,000g for 1 min at 4 C and supernatant was discarded. Beads were then washed by gentle resuspension and agitation sequentially in 1 ml of 50 mM Tris–HCl, pH 7.5, 500 mM NaCl, 0.1% (v/v) Nonidet P-40, and 0.05% (w/v) sodium deoxycholate followed by 1 ml of 50 mM Tris–HCl, pH 7.5, 0.1% (v/v) Nonidet P-40, and 0.05% (w/v) sodium deoxycholate. Immunoprecipitated proteins were released from protein A–agarose by incubation in 30 ll of SDS–PAGE sample buffer at 70 C for 10 min and analyzed by SDS–PAGE followed by immunoblotting. 2.4.2. Cell harvesting and preparation of membranes for 35 [S]GTPcS binding and immunoblotting Transfected cells transiently expressing GABAB receptor subunits R1 and R2 were harvested simply by scraping from the culture dish in phosphate buffered-saline (137 mM NaCl, 2.7 mM KCl, 10 mM Na2 HPO4 , 1.8 mM KH2 PO4 , pH 7.2) (PBS). Cells were then recovered by centrifugation at 2000g for 2 min in a microcentrifuge at 4 C. Cells must be thoroughly washed in PBS to ensure complete removal of any residual serum as this will act as a G-protein stimulator and may interfere with downstream functional assays. Harvested cells may be stored as a pellet at )80 C for up to 2 months or can be used directly for the production of plasma membranes. Plasma membrane-containing P2 particulate fractions were then prepared from the above cell pastes. All procedures were carried out at 4 C. Cell pellets were resuspended in 1 ml of 10 mM Tris–HCl and 0.1 mM EDTA, pH 7.5 (buffer A), and rupture of the cells was achieved by homogenization for 20 s with a Polytron homogenizer followed by passage (five times) through a
25-gauge needle. Cell lysates were centrifuged at 1000g for 10 min in a microcentrifuge to pellet the nuclei and unbroken cells, and P2 particulate fractions were then recovered by microcentrifugation at 16,000g for 30 min. P2 particulate fractions were resuspended in buffer A and stored at )80 C until required. Protein concentrations were determined using the bicinchoninic acid (BCA) procedure [25] using BSA as a standard. It should be noted that most protocols detailing isolation of plasma membranes stipulate a centrifugation step in excess of 40,000g to ensure membrane recovery. However, we have found equivalent yields can be achieved using 16,000g for 30 min which has the advantage of obviating the need for an ultracentrifuge, thus expediting isolation of membranes. 2.5.
35
[S]GTPcS binding
Activated receptors increase the rate of exchange of GDP for GTP on the G-protein a subunit and thereby increase the rate of GTP hydrolysis [26,27]. Members of the Gi family of G-proteins possess the highest rates of guanine nucleotide exchange of all the heterotrimeric Gproteins [27]. This property exclusively allows the function of only Gi G-proteins in a complex membrane mixture activated by specific agonists to be assessed by measuring the exchange of GDP for GTP and/or the subsequent hydrolysis of GTP. Agonist-stimulated binding of an 35 S-labeled form of the poorly hydrolyzable analog of GTP, GTPcS ([35 S]GTPcS) [28], lends itself perfectly as a suitable functional assay to measure activation of the GABAB receptor. This assay can be performed using two techniques which differ only in the means by which bound nucleotide is separated from free: (1) using wheat germ agglutinnin scintillation proximity assay (SPA) bead technology; (2) using traditional separation of bound from free nucleotide by filtration. The assay using SPA technology is more convenient than the filtration assay and is detailed herein with particular relevance to the GABAB receptor. Assays were performed in 96-well format using a method modified from that described in Weiland and Jakobs [28]. Membranes (10 lg per point) were diluted to 0.083 mg/ml in assay buffer (20 mM Hepes, 100 mM NaCl, 10 mM MgCl2 , pH7.4) supplemented with saponin (10 mg/liter) and preincubated with 10 lM GDP. Various concentrations of GABA were then added followed by [35 S]GTPcS (1170 Ci/mmol, Amersham) at 0.3 nM (total volume of 100 ll) and binding was allowed to proceed at room temperature for 30 min. Nonspecific binding was determined by the inclusion of 0.6 mM GTP. Wheat germ agglutinin SPA beads (Amersham) (0.5 mg) in 25 ll assay buffer were added and the whole was incubated at room temperature for 30 min with agitation. Plates were centrifuged at 1500g for 5 min and [35 S]GTPcS bound was determined by scintillation
J.H. White et al. / Methods 27 (2002) 301–310
307
Fig. 4. Coexpression of GABAB R1 and GABAB R2 receptors in HEK293T cells leads to GABA-mediated stimulation of [35 S]GTPcS binding activity. [35 S]GTPcS binding activity was measured from membranes expressing Go1 a together with GABAB receptor subunits. (A) [35 S]GTPcS binding in the absence (open bars) or presence (filled bars) of GABA (10 mM). (B) The ability of varying concentrations of GABA to stimulate the binding of [35 S]GTPcS in membranes expressing either Go1 a and HA-GABAB2 alone (open circles) or in combination with either GABAB1a (closed squares) or GABAB1b (closed triangles). The data shown are the means SD of triplicate measurements and are representative of three independent experiments. (Copyright permission from Nature, http://www.nature.com/.)
308
J.H. White et al. / Methods 27 (2002) 301–310
counting on a Wallac 1450 Microbeta Trilux scintillation counter. Fig. 4 demonstrates such an assay using membranes from HEK293T cells transiently transfected to express Go1 a in combination with either GABAB1 or GABAB2 or with both receptor subunits (Fig. 4A). The figure shows that coexpression of both subunits is required to provide an agonist concentration-dependent stimulation of [35 S]GTPcS binding ðEC50 ¼ 7:8 0:4 10 5 MÞ (Fig. 4B). These values are equivalent to those of GABA-mediated stimulation of [35 S]GTPcS binding to rat brain membranes (5:9 0:4 10 5 M) (data not shown). Hence, coexpression of GABAB1 and GABAB2 resulted in the generation of a functional GABAB receptor. Note: To generate a significant agonist-mediated response in transient systems it is often necessary to cotransfect receptor with additional Gi =Go G-protein.
diluted 1:30 for 15 min at room temperature. For permeabilized cells, the Fix and Perm Kit (Caltag) was used. FACS analysis was performed on a Coulter Elite FACS cytometer. Thirty thousand cells were analyzed in each experiment. Fig. 5 shows that in intact cells expressing Myc–GABAB1b alone, no cell surface anti-Myc immunoreactivity was detected. In contrast, immunoreactivity toward Myc was detected in 35% of permeabilized cells, reflecting intracellular expression of GABAB1b . However, when GABAB2 was cotransfected with Myc–GABAB1b , 20% of intact cells displayed cell surface anti-Myc immunoreactivity. Hence, these data indicate that, in the presence of GABAB2 , GABAB1b is efficiently moved to the cell surface. Interestingly, 14% of HEK293T cells transfected with HA–GABAB2 showed surface immunoreactivity (Fig. 5c), suggesting that this receptor can be efficiently trafficked to the cell surface in the absence of GABAB R1.
2.6. FACS analysis 2.7. Immunological studies and receptor glycosylation Flow-cytometry analysis (FACS) is a powerful tool that can be used to study the cellular distribution of immunotagged proteins. Hence, this technique was employed to study the cellular localization of GABAB receptor subunits expressed in isolation and in combination. HEK293T cells were transiently transfected with cDNA as described. Forty-eight to seventy-two hours following transfection cells were recovered and washed twice in PBS supplemented with 0.1% (w/v) NaN3 and 2.5% (v/v) fetal calf serum (FACS buffer). Cells were resuspended in FACS buffer and incubated with primary antibody 9E10 (c-myc) or HA for 15 min at room temperature. Following three further washes with PBS, cells were incubated with secondary antibody (sheep antimouse Fab2 coupled with fluorescein isothiocyanate)
Endoglycosidases F and H can be used to differentiate between immature, core glycosylated, and terminally glycosylated N-linked glycoproteins that have passed through the Golgi apparatus [3]. Therefore, these enzymes were used to examine the glycosylation status of both GABAB1 and GABAB2 . Membranes from transfected cells were treated with either endoglycosidase F or H and expressed GABAB receptors were characterized by immunoblotting to compare relative electrophoretic mobilities of the receptors (Fig. 6). Cell membranes expressing either GABAB1a or GABAB1b produced distinct bands of Mr 130K and 100K, respectively (Fig. 6, lanes 1 and 4), which, following endoglycosidase F treatment, decreased in size to single immunoreactive species of Mr
Fig. 5. Cell surface localization of GABAB R1 receptor is dependent on coexpression with GABAB R2. (A) FACS analysis using anti-c-Myc as primary antibody on intact cells: (a) mock transfected; (b) GABAB1b ; (c) GABAB1b þ GABAB2 . (B) FACS analysis using anti-c-Myc as primary antibody on permeabilized cells: (a) mock transfected; (b) GABAB1b ; (c) GABAB1b þ GABAB2 . (C) FACS analysis using anti-HA as primary antibody: (a) mock transfected; (b) GABAB2 . (Copyright permission from Nature, http://www.nature.com/.)
J.H. White et al. / Methods 27 (2002) 301–310
Fig. 6. Coexpression of GABAB1 variants with GABAB2 receptors in HEK293T cells results in terminal glycosylation of GABAB1 . Membrane fractions from cells transfected with either GABAB1a (lanes 1–3), GABAB1b (lanes 4–6), or HA-GABAB2 (lanes 13–15), or with 1 lg each of HA-GABAB2 in combination with 1 lg of either GABAB1a (lanes 7– 9, 16–18) or GABAB1b (lanes 10–12, 19–21). Glycosylation status of transfected receptors was assessed following treatment with either vehicle (lanes 1, 4, 7, 10, 13, 16, 19), endoglycosidase F (lanes 2, 5, 8, 11, 14, 17, 20), or endoglycosidase H (lanes 3, 6, 9, 12, 15, 18, 21), Upper: Antiserum 501 was used as primary reagent to allow identification of both GABAB1a and GABAB1b . Lower: Anti-HA antiserum was employed to permit identification of HA-epitope-tagged GABAB2 . (Copyright permission from Nature, http://www.nature.com/.)
110K and 80K (Fig. 6, lanes 2 and 5). This showed that recombinant GABAB1a and GABAB1b are glycoproteins, in agreement with the observations of Kaupmann et al. [5]. However, both forms were also sensitive to endoglycosidase H treatment, indicating that the expressed proteins were only core glycosylated (lanes 3 and 6) and lacked terminal glycosylation. This observation, together with that of the FACS analysis, suggested that the proteins were immaturely glycosylated and retained on internal membranes. Significantly, when either GABAB1a (lanes 7–9) or GABAB1b (lanes 10–12) was coexpressed with HA–GABAB2 , a component of GABAB1 was resistant to endoglycosidase H digestion, suggesting that when coexpressed with GABAB R2, a significant fraction of GABAB1 was now a mature glycoprotein (lanes 9 and 12). Similar studies with HA–GABAB1 gave an immunoreactive species of Mr 120K (Fig. 6, lanes 13, 16, 19) which was sensitive to endoglycosidase F (lanes 14, 17, 20) but resistant to endoglycosidase H (lanes 15, 18, 21) treatment, whether expressed alone or in combination with GABAB1 . Thus, these data indicated that expressed HA– GABAB2 was a mature glycoprotein whose glycosylation status was not affected by coexpression with GABAB R1. Hence, the deglycosylation studies suggested that heterodimerization, possibly occurring in the Golgi complex, could be a prerequisite for maturation and transport of
309
GABAB R1 to the plasma membrane. Immunoblotting and deglycosylation protocols are described below. Antiserum 501 was raised against a synthetic peptide corresponding to the C-terminal 15 amino acids of the GABAB1 receptor and was produced in a sheep, using a conjugate of this peptide and keyhole limpet hemocyanin (Calbiochem) as antigen. Membrane samples (30– 60 lg) were resolved by SDS–PAGE using 10% (w/v) acrylamide. Following electrophoresis, proteins were subsequently transferred to nitrocellulose (HybondECL, Amersham), probed with antiserum 501 at 1:1000 dilution, and visualized by enhanced chemiluminescence (ECL, Amersham). Epitope tags were visualized by immunoblotting with anti-Myc (1:100 dilution) or antiHA (1:500) monoclonal antibodies. Enzymatic removal of asparagine-linked (N-linked) carbohydrate moieties with endoglycosidases F and H was performed essentially according to the manufacturer’s (Roche Diagnostics) instructions using 50 lg of membrane protein per enzyme reaction. GABAB receptor glycosylation status was then studied following SDS–PAGE/immunoblotting of samples.
3. Conclusions The techniques described here enabled the observation that the fully functional GABAB receptor was an obligate heterodimer, comprising two closely related and interacting GPCRs. Since these initial experimental data, many more GPCRs have been reported to dimerize [1,2], and indeed, the idea of other GPCR-associated proteins is now coming to the fore [29]. However, sensitive biochemical studies in mammalian recombinant systems, which generate compelling data suggesting dimerization between receptors in various combinations, should be used with care as misleading data can be easily generated. For example with immunoprecipitation strategies, due to the hydrophobic nature of the seventransmembrane helices of GPCRs, stringent controls should be put in place to exclude nonspecific interactions between receptor pairs that may result following detergent dissolution of cellular membranes. This may be a significant problem when overexpression systems are employed to study dimerization. Indeed, more recent studies have used various forms of time-resolved fluorescence resonance energy transfer and bioluminescence resonance energy transfer to study GPCR homo- and heterooligomerization in living cells [30–32, this issue]. It is critically important to go back to native tissue and confirm that the observed GPCR dimerization is of physiological significance. Clearly for receptors to form heterodimers, the two partnering GPCRs should be coexpressed in the same cell and indeed in the same subcellular compartment for some point during their life cycle. Colocalization at a cellular level is therefore
310
J.H. White et al. / Methods 27 (2002) 301–310
necessary for in vivo confirmation, using either in situ hybridization or preferably immunohistochemistry. Coimmunoprecipitation from native tissue also provides superior evidence for a physiological interaction. Receptors that are capable of heterodimerization in overexpressed cell systems with resulting alterations to their pharmacological profile may not actually do so in real tissue. For orphan receptors coexpression data may themselves provide the initial evidence for receptor dimerization. In the case of the GABAB receptor conclusive evidence for the importance of heterodimerization in vivo has been demonstrated by the GABAB1 receptor knockout which loses all responses to GABAB agonists despite expressing GABAB2 [33,34]. References [1] M. Bouvier, Nat. Rev. Neurosci. 2 (2001) 274–286. [2] G. Milligan, J. Cell Sci. 114 (2001) 1265–1271. [3] L.M. McLatchie, N.J. Fraser, M.J. Main, A. Wise, J. Brown, N. Thompson, R. Solari, M.G. Lee, S.M. Foord, Nature 393 (1998) 333–339. [4] N.G. Bowery, Annu. Rev. Pharmacol. Toxicol. 33 (1993) 109–147. [5] K. Kaupmann, K. Huggel, J. Heid, P.J. Flor, S. Bischoff, S.J. Mickel, G. McMaster, C. Angst, H. Bittiger, W. Froestl, B. Bettler, Nature 386 (1997) 239–246. [6] J.H. White, A. Wise, M. Main, A. Green, N.J. Fraser, G.H. Disney, A.A. Barnes, P. Emson, S.M. Foord, F.H. Marshall, Nature 396 (1998) 679–682. [7] A. Couve, A.K. Filippov, C.N. Connolly, B. Bettler, D.A. Brown, S.J. Moss, J. Biol. Chem. 273 (1998) 26361–26367. [8] P.L. Bartel, S. Fields, The Yeast Two Hybrid System, Oxford Univ. Press, London, 1997. [9] R. Kuner, G. Kohr, S. Grunewald, G. Eisenhardt, A. Bach, H.C. Kornau, Science 283 74–77. [10] R.A. Kammerer, S. Frank, T. Schulthess, R. Landwehr, A. Lustig, J. Engel, Biochemistry 38 (1999) 13263–13269. [11] M. Margeta-Mitrovic, Y.N. Jan, L.Y. Jan, Neuron 27 (2000) 97– 106. [12] D.A. Schwarz, G. Barry, S.D. Eliasof, R.E. Petroski, P.J.Conlon, R.A. Maki, J. Biol. Chem. 275 32174–32181. [13] K.A. Jones, B. Borowsky, J.A. Tamm, D.A. Craig, M.M. Durkin, M. Dai, W.J. Yao, M. Johnson, C. Gunwaldsen, L.Y. Huang, C. Tang, Q.R. Shen, J.A. Salon, K. Morse, T. Laz, K.E. Smith, D. Nagarathnam, S.A. Noble, T.A. Branchek, C. Gerald, Nature 396 (1998) 674–679. [14] K. Kaupmann, B. Malitschek, V. Schuler, J. Heid, W. Froestl, P. Beck, J. Mosbacher, S. Bischoff, A. Kulik, R. Shigemoto, A. Karschin, B. Bettler, Nature 396 (1998a) 683–687.
[15] A. Pagano, G. Rovelli, J. Mosbacher, T. Lohmann, B. Duthey, D. Stauffer, D. Ristig, V. Schuler, I. Meigel, C. Lampert, T. Stein, L. Prezeau, J. Blahos, J. Pin, W. Froestl, R. Kuhn, J. Heid, K. Kaupmann, B. Bettler, J. Neurosci. 21 (2000) 1189–1202. [16] A.R. Calver, M.J. Robbins, C. Cosio, S.Q. Rice, A.J. Babbs, W.D. Hirst, I. Boyfield, M.D. Wood, R.B. Russell, G.W. Price, A. Couve, S.J. Moss, M.N. Pangalos, J. Neurosci. 21 (2001) 1203– 1210. [17] S. Fields, O. Song, Nature 340 (1989) 245–246. [18] G.G. Toby, E.A. Golemis, Methods 24 (2001) 201–217. [19] K.J. Fuller, M.A. Morse, J.H. White, S.A. Dowell, M.J. Sims, Biotechniques 25 (1998) 85–92. [20] J.H. White, R.A. McIllhinney, A. Wise, F. Ciruela, W.Y. Chan, P.C. Emson, A. Billinton, F.H. Marshall, Proc. Natl. Acad. Sci. USA 97 (2000) 13967–13972. [21] R.B. Nehring, H.P. Horikawa, O. El Far, M. Kneussel, J.H. Brandstatter, S. Stamm, E. Wischmeyer, H. Betz, A. Karschin, J. Biol. Chem. 275 (2001) 35185–35191. [22] T. Durfee, K. Becherer, P. Chen, S. Yeh, Y. Yang, A. Kilburn, W. Lee, S.J. Elledge, Genes Dev. 7 (1993) 555–569. [23] J.W. Harper, G.R. Adami, N. Wei, K. Keyomarsi, S.J. Elledge, Cell 75 (1993) 805–816. [24] F.M. Ausubel, R. Brent, R.E. Kingston, J. Moore, G. Seidman, J.A. Smith, K. Sruhl (Eds.), Current Protocols in Molecular Biology, Wiley, New York, 1994. [25] P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D. Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson, D.C. Klenk, Anal. Biochem. 150 (1985) 76–85. [26] H.R. Bourne, D.A. Sanders, F. McCormick, Nature 348 (1990) 125–132. [27] A.G. Gilman, Annu. Rev. Biochem. 56 (1987) 615–649. [28] T. Weiland, K.H. Jakobs, Methods Enzymol. 237 (1994) 3– 13. [29] G. Milligan, J.H. White, Trends Pharmacol. Sci. 10 (2001) 513– 518. [30] S. Angers, A. Salahpour, E. Joly, D. Chelsky, M. Dennis, M. Bouvier, Proc. Natl. Acad. Sci. USA 97 (2000) 3684–3689. [31] M. Rocheville, D.C. Lange, U. Kumar, R. Sasi, R.C. Patel, Y.C. Patel, Science 288 (2000) 154–157. [32] M. McVey, D. Ramsay, E. Kellett, S. Rees, S. Wilson, A.J. Pope, G. Milligan, J. Biol. Chem. 276 (2001) 14092–14099. [33] V. Schuler, C. Luscher, C. Blanchet, N. Klix, G. Sansig, K. Klebs, M. Schmutz, J. Heid, C. Gentry, L. Urban, A. Fox, W. Spooren, A.L. Jaton, J. Vigouret, M. Pozza, P.H. Kelly, J. Mosbacher, W. Froestl, E. Kaslin, R. Korn, S. Bischoff, K. Kaupmann, H. van derPutten, B. Settler, Neuron 31 (1) (2001) 47–58. [34] H.M. Prosser, C.H. Gill, W.D. Hirst, E. Grau, M. Robbins, A. Calver, E.M. Soffin, C.E. Farmer, J. Gray, E. Schenck, B.S. Warmerdam, C. Clapham, C. Reavill, D.C. Rogers, T. Stean, N. Upton, K. Humphreys, A. Randall, M. Geppert, C.H. Davies, M.N. Pangalos, Mol. Cell. Neurosci. 17 (2001) 1059– 1070.
Heterodimerization of c-aminobutyric acid B receptor subunits as revealed by the yeast two-hybrid system Julia H. White,a,* Alan Wise,b and Fiona H. Marshallc a
Pathway Discovery, GlaxoSmithKline, Gunnels Wood Road, Stevenage, Hertfordshire, SG1 2NY, UK Systems Research, GlaxoSmithKline, Gunnels Wood Road, Stevenage, Hertfordshire, SG1 2NY, UK Molecular Pharmacology, Millennium Pharmaceuticals Ltd., Granta Park, Great Abington, Cambridge, CB1 6ET, UK b
c
Accepted 4 June 2002
Abstract Several lines of evidence suggested that the first c-aminobutyric acid B receptor to be cloned required an additional factor for functional expression. GABAB1 was retained within the endoplasmic reticulum and failed to couple to signal transduction pathways on stimulation with agonists. In radioligand binding experiments it was found that although the affinity of antagonists showed a close agreement between rat brain membranes and membranes expressing the cloned receptor, agonist ligands were significantly weaker at recombinant receptors. Using the C-terminal tail as bait, a yeast two-hybrid screen was run against a human brain cDNA library and identified a second receptor, GABAB2 , as a major interacting protein. This interaction was confirmed by coimmunoprecipitation as well as extensive colocalization studies. Coexpression of the two seven-transmembrane proteins generated a fully functional receptor, which was expressed at the cell surface confirming the importance of receptor heterodimerization for GABAB receptor activity. 2002 Elsevier Science (USA). All rights reserved. Keywords: c-Aminobutyric acid B receptor; Coimmunoprecipitation; Glycosylation; Yeast two-hybrid system; GTPcS binding
1. Introduction It is now well established that G-protein-coupled receptors (GPCRs) are able to oligomerize into both homodimers and heterodimers and that this can result in changes in the ligand specificity, pharmacology, and signaling of receptors [1,2]. This has important implications for understanding and characterizing receptor function and also for developing new drugs acting on this protein superfamily. The c-aminobutyric acid B ðGABAB Þ heterodimeric receptor is, to date, the only known example where two seven-transmembrane receptors must come together to form an obligate heterodimer, where neither of the receptor subunits is functional when expressed alone. A similar situation, however, exists with the CGRP and adrenomedullin receptors where a GPCR must heterodimerize with single-transmembrane proteins known as RAMPs to form fully functional receptors [3]. Within the human *
Corresponding author. E-mail address: [email protected] (J.H. White).
genome more than 700 GPCRs have been identified, around half of which remain orphan receptors despite extensive screening against large numbers of candidate ligands. One possibility is that some of these orphan receptors like the GABAB receptor require another partner to be functional. By considering the techniques that led to the recognition that the GABAB receptor requires an additional ‘‘factor’’ to be functional, we can begin to assess whether other orphan receptors may be candidates for heterodimerization or RAMP-like accessory proteins. The GABAB receptor was described [4] many years prior to cloning and its pharmacology, localization, and signaling mechanisms were well characterized using native tissue. The first GABAB receptor (GABAB1 ) was expression cloned in 1997 [5]. However, from the outset, there were clearly discrepancies between the recombinant receptor and the endogenous receptor, as characterized from brain membranes. First, in radioligand binding studies, agonist affinities were found to be around 100-fold weaker in membranes prepared from cells expressing GABAB1 compared with those prepared
1046-2023/02/$ - see front matter 2002 Elsevier Science (USA). All rights reserved. PII: S 1 0 4 6 - 2 0 2 3 ( 0 2 ) 0 0 0 8 7 - 7
302
J.H. White et al. / Methods 27 (2002) 301–310
from rat brain. Second, only very weak functional responses in an adenylyl cyclase assay were described. In our hands GABAB1 failed to respond to GABA or other known GABAB agonists using a variety of different functional readouts. Assuming there are no errors in the cDNA construct, the most likely reason a receptor fails to respond to agonists as expected is either a low level of protein expression or a lack of receptor expression at the cell surface. Both of these possibilities can be studied using Western blotting or flow cytometry comparing intact and permeabilized cells. This can be done using antibodies raised to the native protein or, more commonly, using antibodies to N-terminal epitope tags. In the case of the GABAB receptor, GABAB1 was not expressed at the cell surface and further studies examining the glycosylation status of the protein suggested that it was retained within the endoplasmic reticulum (ER) [7,8]. This suggested that an associated protein was required to traffic the receptor to the plasma membrane. To identify such receptor-associated cofactors, a number of approaches can be employed, each with its advantages and drawbacks. These include affinity purification, when high-affinity antisera or ligands are available, and expression-cloning approaches, where libraries are screened to generate receptor function (e.g., [3]). However, one of the most powerful approaches to the selection and identification of associated proteins is that of the yeast two-hybrid (Y2H) system (see [8]). This relies on the functional assembly of a transcription factor in the yeast nucleus as a result of two proteins interacting. Y2H possesses the advantage that it is a relatively easy technique in vivo for the discovery of unknown protein interactions within the context of the living cell, unlike other techniques in vitro such as gel overlay assays and affinity pulldowns. The use of Y2H led to the identification of a strong interaction between GABAB1 and a second related GPCR, called GABAB2 [6,9]. The interaction was mediated through coiled-coil domains located within the C-terminal tails of both receptors [6,9,10]. However, subsequent publications have suggested that the extracellular and transmembrane domains are also involved [11,12]. The initial observation, suggesting receptor heterodimerization, was confirmed biochemically using coimmunoprecipitation. Coexpression of GABAB2 with GABAB1 enabled GABAB1 to be expressed at the cell surface as a mature glycoprotein, which responded to GABAB agonists in functional assays [6,13,14]. This observation of heterodimerization has subsequently been confirmed in vivo by other techniques including coimmunoprecipitation of native receptors and extensive distribution studies using immunohistochemistry and in situ hybridization techniques. Moreover, the mechanism by which GABAB2 trafficks GABAB1 to the cell surface has also been elucidated [11,15,16] and is further described by Margeta-Mitrovic in this issue.
2. Methods 2.1. The yeast two-hybrid system The yeast two-hybrid or Interaction trap system is a powerful genetic approach using engineered strains of the budding yeast Saccharomyces cerevisiae for the discovery and characterization of protein–protein interactions. The method was first developed over a decade ago [17] and has been extensively used for many protein targets [8,18]. In principle, the system relies on the modular nature of transcription factors, with distinct functional domains. One domain, the DNA binding domain (BD), is responsible for binding the transcription factor to a target DNA sequence within a promoter while a second domain, the activation domain (AD), recruits the transcriptional machinery to promote gene transcription. The two-hybrid system exploits the fact that a binding domain is incapable of activating transcription unless it is physically, but not necessarily covalently, attached to an activation domain. Therefore, to establish a two-hybrid interaction, the protein of interest, generally referred to as the bait, is expressed via a yeast expression vector as a fusion with the BD of a transcription factor (Fig. 1). Commonly, the yeast GAL4 BD or Escherichia coli lexA BD is used in conjunction with the appropriate promoter recognition sequences. The expression plasmid, once transformed into the yeast host, expresses the desired BD–bait fusion in the nucleus. The yeast host cell is engineered to possess sensitive reporter genes responsive to the particular BD by the appropriate activating specific sequences being present within the promoter. The BD binds to this promoter, and if the bait fusion protein fails to activate transcription in the absence of other expressed proteins, then it is suitable for Y2H analysis. To identify unknown associated protein partners against particular baits, the bait must be exposed in the yeast cell to a relevant cDNA library of proteins expressed as activation domain (AD) fusions. Typical ADs employed in many of the Y2H systems are S. cerevisiae GAL4, herpes simplex virus VP16, and E. coli B42. Proteins that associate with the bait bring the BD and AD into juxtaposition, creating a functional transcription factor. This hybrid transcription factor thus results in expression from the reporter gene, allowing selection of yeast expressing the interacting protein partners. One of the main advantages of the Y2H system resides in its sensitive and selectable reporter genes that permit interacting proteins to be selected rapidly from the multiple genes present within a cDNA library. Generally, there are two types of reporter genes: those encoding a nutritional requirement, such as the HIS3 or LEU2 gene products, and those encoding genes with an enzymatic activity that can be measured quantitatively. Reporters encoding a nutritional gene allow positive interactors to
J.H. White et al. / Methods 27 (2002) 301–310
Fig. 1. The yeast two-hybrid system. (a) Schematic representation of the Y2H system. Bait protein is expressed in yeast as a fusion with a binding domain such as GAL4BD . Similarly, the potential interactor ‘‘prey’’ protein is expressed as a fusion with an activation domain, such as GAL4AD . Both fusion proteins translocate to the yeast nucleus, where the BD is able to bind its recognition sequence with the promoter of a reporter construct. The BD fusion is unable to activate transcription alone but when the bait and prey proteins interact, a functional transcription factor is formed that activates transcription from the reporter gene. (b) Library screening by Y2H. Plasmids expressing bait–BD fusions and a library of AD–cDNA fusions are cotransformed into a Y2H engineered yeast strain. By means of the activation of selectable nutritional reporter genes, only those yeast transformants coexpressing a functional transcription factor through a bait-and-prey interaction grow to form colonies on selective agar. A second reporter gene encoding b-galactosidase is likewise activated so the yeast colonies will turn blue in the presence of the X-Gal chromagenic substrate. Those yeast cells expressing nonassociating library proteins will not produce a functional transcription factor, will not activate transcription, and therefore will not grow into colonies on the selective agar.
be selected by colony growth in the absence of the exogenous supplement, as the yeast host has the genomic copy of the gene deleted and is thus unable to grow in the absence of a functional Y2H interaction. This results in a powerful positive selection pressure for the preferential growth of a clonal population expressing the interacting library insert. Moreover, use of the HIS3-encoded imidazoleglycerol-phosphate dehydratase reporter gene in the presence of the competitive inhibitor 3-AT 3-amino-
303
1,2,4-triazole (3-AT) allows only those yeast cells expressing sufficient levels of strongly associated two-hybrid interactors to overcome the 3-AT levels and to be growth-selected. This allows the stringency of a screen to be set according to the level of 3-AT added. Typically the LacZ gene, encoding b-galactosidase, is used for the latter type of ‘‘enzymatic activity’’ reporter. b-Galactosidase has the advantage of being extremely stable in yeast and can be readily detected using extremely sensitive chromagenic substrates such as 5-bromo-4-chloro-3-indolyl-b-D -galactopyranoside (X-Gal) and o-nitrophenyl-b-galactopyranoside (ONPG). The main disadvantage is that these substrates are non-cellpermeable and require a lysis step in the assay. A permeable b-galactosidase substrate is now available (X-a-GAL), which enables b-galactosidase activity to be scored in living cells. Once an interaction between two proteins is positively scored from both reporter genes, then polymerase chain reaction (PCR) and/or plasmid rescue and amplification in E. coli can be used to recover cDNA library inserts for sequence analysis. However, some proteins are wellknown promiscuous interactors and either have no obvious relevance to the bait or interact with multiple unrelated baits in a nonspecific manner (otherwise known as false positives). To eliminate these, associations should be confirmed against the original bait, as well as against a panel of unrelated baits to check specificity. Although the specificity checks will eliminate many of false positives, any interactions discovered by the Y2H system need to be verified through independent biochemical and functional assays. Indeed, like all techniques, Y2H possesses several advantages and limitations (Table 1). 2.2. Yeast two-hybrid screening 2.2.1. Yeast strains, plasmids, and media Saccharomyces cerevisiae Y190 [MATa, gal4 gal80, ade2-101, his3, trp1-901, ura3-52, leu2-3, 112, URA3::GAL1-lacZ, LYS2::GAL1-HIS3, cyhR ] was used for all described yeast two-hybrid work [22,23] Gal4BD fusion vectors were either pYTH9 [19] or pYTH16, an episomal version of pYTH9, and the Gal4AD vector used was pACT2 [22]. A total Human Brain MATCHMAKER library (HL4004AH) in pACT2 was purchased from Clontech Laboratories (Palo Alto, CA) and amplified according to the manufacturer’s instructions. All yeast were maintained on standard yeast media [24]. 2.2.2. Construction of bait vectors The GABAB1 C-terminal domain was amplified from the full-length clone, using PCR primers 50 -GTTGTCC CCATGGTGCCCAAGATGCGCAGGCTGATCACC and 50 -GTCCTGCGGCCGCGGATCCTCACTTATA
304
J.H. White et al. / Methods 27 (2002) 301–310
Table 1 Yeast two-hybrid system Advantages • • • • • • • • •
Y2H is an extremely inexpensive technique, requiring no specialized items of equipment. Yeast cells have excellent molecular genetic technologies established and are easy to use. Y2H is a eukaryotic in vivo technology, as opposed to in vitro interaction assays. Y2H is extremely sensitive and can detect weak and/or transient interactions. Several Y2H kits are commercially available together with many premade cDNA libraries from a variety of hosts and tissues. Versions of the Y2H system are available that express from regulated promoters, thus allowing toxic proteins to be examined. Baits can be made up from whole proteins or subdomains. Empirically, subdomains often work better. Y2H allows for rapid and sensitive cDNA library screening for unknown interacting partners. The approach generates information on the interaction domain and yields the cDNA clone as part of the result. Many modifications of the Y2H system have been developed including one-and trihybrid systems. Limitations
• • •
• • •
Yeast is a lower eukaryotic cell and does not mirror the cellular context of higher eukaryotic cells. Bait proteins are transported to the yeast nucleus and this may not be the correct cellular compartment for the type of protein under investigation. Y2H is an overexpression system, with baits expressed as fusion proteins in the (often) foreign context of the yeast nucleus; therefore, it is prone to generate ‘‘false positive.’’ Thereby all Y2H interactions need to be validated by some independent experimentation. Y2H systems exist that use low-copy vectors to try to minimize numbers of false positives. Bait protein must be correctly folded into its native confirmation when expressed as a BD fusion in the nucleus. The position of the fusion junction can markedly influence protein folding and thereby the ability to interact with a protein partner. Certain classes of proteins are generally not amenable to Y2H. This includes transcription factors, proteins spanning the membrane several times over, extracellular domains, and those baits that are able to promote promiscuous transcription. Y2H will not detect associations dependent on certain posttranslational modifications such as glycosylation. However phospho-dependent interactions can be detected by trihybrid screening.
AAGCAAATGCACTCG. PCR conditions were for Taq polymerase (Perkin–Elmer, Norwalk, CT) and run using a Perkin–Elmer, 9600 PCR cycler for an initial heating of 95 C 3 min; followed by 25 cycles of 95 C 1 min, 55 C 1 min, and 72 C 3 min; followed by 72 C for 10 min and storage at 4 C. PCR product was sizefractionated on 0.8% agarose, gel purified, and restricted with NcoI and NotI restriction enzymes for direct subcloning into pYTH9 polylinker. This construct contains the C-terminal 108 amino acids from the base of TM7. The cloned PCR product was sequenced and confirmed as error free and fused in-frame to yeast GAL4BD . 2.2.3. Construction of screening yeast host strain and library transformation The GAL4BD –GABAB1 C-terminal fusion in pYTH9 was stable integrated into the genome of yeast Y190 at the trp1 locus by targeted homologous recombination (19). Y190 cells expressing the GAL4BD –GABAB1 Cterminal fusion were selected and a high-efficiency yeast transformation protocol was adopted to transform in the brain cDNA library. Briefly, approximately 1 1010 cells were grown to mid-log phase in YEPD at 30 C, washed both in sterile water and in 0.1 M lithium acetate/ 1 TE (pH 7.5), and finally resuspended in 4.0 ml 0.1 M lithium acetate/TE solution. One hundred micrograms of library plasmid, together with 4.0 mg sheared salmon sperm DNA, was added to the cells and 24 ml of 0.1 M lithium acetate/40% polyethylene glycol (PEG) 3350 added. Cells were incubated at 30 C for 30 min, and then heat-shocked at 42 C for 15 min. Cells were harvested,
resuspended in 10 ml sterile water, and plated onto 10 Nunc bioassay dishes containing selective agar plus 20 mM 3-AT. Plates were incubated for several days at 30 C and positive clones, which grew under selection and expressed LacZ, were selected for further analysis. 2.2.4. Freeze-fracture assays Yeast colonies were transferred by replica plating onto Whatman No. 54 filter papers and rapidly lysed by being dipped twice into liquid nitrogen and allowed to thaw inbetween. Each filter was incubated in 2 ml of Z-buffer (60 mM Na2 HPO4 7H2 O, 40 mM NaH2 PO4 H2 O, 10 mM KCl, 0.1 mM MgSO4 7H2 O, pH 7.0) containing 1 mg/ml X-Gal and 0.27% (v/v) 2-mercaptoethanol. Filters are incubated at 37 C until a blue color. 2.2.5. Quantification of b-galactosidase activity Approximately 2 108 cells, grown to logarithmic phase, were harvested, resuspended in 200 ll 0.1 M Tris– Cl, pH 7.5/0.05% Triton X-100, and lysed by twice snapfreezing in liquid nitrogen. An aliquot of each sample (V) depending on lacZ activity was added to 200 ll of 4 mg/ml o-nitrophenyl-b-galactopyranosides (ONPG)/ Z-buffer/0.27% (v/v) 2-mercaptoethanol and incubated at 37 C until a light straw color was observed. The reaction was stopped by addition of 500 ll 1 M Na2 CO3 and A420 values were measured. Cell concentration was estimated by resuspending 20 ll of lysed cell debris in 1 ml H2 O and measuring A600 (W). b–Gal activity (units, U) is measured as U ¼ 100ðA420 Þ=½A600 V T , where T is time of incubation for the assay.
J.H. White et al. / Methods 27 (2002) 301–310
2.3. Y2H screening of the GABAb R1 C terminus (Fig. 2) Approximately 4 106 human brain library cDNAs were transformed against the C terminus of GABAB1 ‘‘bait’’ and grown on selective medium in the presence of 20 mM 3-AT for 3–7 days at 30 C. Yeast showing activation of both HIS3 and LacZ reporter genes were selected; the library plasmid was recovered from the yeast and sequenced. In total, two main interacting proteins were recovered several times, each being confirmed as a strong specific interactor in the confirmatory and specificity assays. The first interacting library cDNA encoded the C terminus of the related GABAB2 receptor and all clones recovered expressed the coiled-coil domain but not the seventh transmembrane (TM) domain of the receptor, as expected since TM domains do not work well in Y2H. Subsequent assays for the LacZ reporter proved that the GABAB1 and GABAB2 C termini associated as a heterodimer but homodimerization could not be detected (Fig. 2). Interestingly, the second associated protein, recovered in greater abundance than GABAB2 C terminus, was the CREB2 or ATF4 transcription factor [20,21].
Fig. 2. Y2H demonstrates herodimerization but not homodimerization between GABAB1 and GABAB2 C termini. b-Galactosidase activity was measured in yeast strain Y190 expressing GABAB1 or GABAB2 C termini or with empty vector as controls, either by (a) freeze-fracture assay or (b) quantified using ONPG relative to cell numbers. (Copyright permission from Nature, http://www.nature.com/.) Of each combination of proteins expressed, the first named represents the GAL4BD fusion and the second is the Gal4AD fusion. GAL4BD and GAL4AD denote empty-vector controls.
305
2.4. Confirmation of yeast two-hybrid interaction following expression in mammalian cells: use of coimmunoprecipitation Based on the identification of the putative interaction using Y2H we next confirmed the interaction by immunoprecipitation studies. Myc-tagged GABAB1b and or hemagglutinin (HA)-tagged GABAB2 was transiently expressed in HEK293T cells. Immunoprecipitation of Myc-GABAB1b from detergent-solubilized cell fractions with Myc antisera led to immunodetection of HA-GABAB2 within immune complexes using HA as the primary antibody, but only on receptor coexpression (Fig. 3, lanes 1–3). GABAB1 and GABAB2 association was also confirmed by coimmunodetection of Myc–GABAB1b from immune complexes captured using the anti-HA antibody, when the two receptor forms were coexpressed (Fig. 3, lanes 4–6). Transfection and immunoprecipitation procedures are outlined below. Cell culture and transfection HEK293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/ v) fetal calf serum and 2 mM glutamine. Cells were seeded in 60-mm culture dishes and grown to 60–80% confluency (18–24 h) prior to transfection with pCDNA3 containing the relevant DNA species using LipofectAMINE reagent. For transfection, 3 lg of DNA was mixed with 10 ll of LipofectAMINE in 0.2 ml of Opti-MEM (Life Technologies) and was incubated at room temperature for 30 min prior to the addition of 1.6 ml of Opti-MEM. Cells were exposed to the LipofectAMINE/DNA mixture for 5 h and 2 ml of 20% (v/v) newborn calf serum in DMEM was then added. Cells were harvested 48–72 h after transfection.
Fig. 3. Coimmunoprecipitation studies of the GABAB heterodimer in HEK293T cells. Lanes 1, 4: immunoprecipitates of cells transfected with Myc–GABAB R1b only; lanes 2, 5: HA–GABAB R2 only; lanes 3, 6: immunoprecipitates of cells transfected with Myc–GABAB R1b together with HA–GABAB R2. Lanes 1–3: lysates immunoprecipitated with 9E10 (Myc) and blotted to 12CA5 (HA); lanes 4–6: lysates immunoprecipitated with 12CA5 (HA) and blotted with 9E10 (Myc). (Copyright permission from Nature, http://www.nature.com/.)
306
J.H. White et al. / Methods 27 (2002) 301–310
2.4.1. Immunoprecipitation procedures Transiently transfected HEK293T cells were harvested as described above. Cells from each dish were resuspended in 1 ml of 50 mM Tris–HCl, 150 mM NaCl, 1% (v/v) Nonidet P-40, 0.5% (w/v) sodium deoxycholate, pH 7.5 (lysis buffer), supplemented with Complete protease inhibitor cocktail tablets (1 tablet/25 ml) (Roche Diagnostics). Cell lysis and membrane protein solubilization were achieved by homogenization for 20 s with a Polytron homogenizer followed by gentle mixing for 30 min at 4 C. Insoluble debris was removed by microcentrifugation at 16,000g for 15 min at 4 C and the supernatant was precleared by incubating with 50 ll of protein A–agarose (Roche Diagnostics) for 3 h at 4 C on a helical wheel to reduce background caused by nonspecific adsorption of cellular proteins. The solubilized supernatant was then divided into 2 500-ll aliquots and 20 ll of either HA or Myc antiserum was added to each. Immunoprecipitation was allowed to proceed for 1 h at 4 C on a helical wheel prior to the addition of 50 ll of protein A–agarose suspension. Capture of immune complexes progressed overnight at 4 C on a helical wheel. Complexes were then collected by microcentrifugation 12,000g for 1 min at 4 C and supernatant was discarded. Beads were then washed by gentle resuspension and agitation sequentially in 1 ml of 50 mM Tris–HCl, pH 7.5, 500 mM NaCl, 0.1% (v/v) Nonidet P-40, and 0.05% (w/v) sodium deoxycholate followed by 1 ml of 50 mM Tris–HCl, pH 7.5, 0.1% (v/v) Nonidet P-40, and 0.05% (w/v) sodium deoxycholate. Immunoprecipitated proteins were released from protein A–agarose by incubation in 30 ll of SDS–PAGE sample buffer at 70 C for 10 min and analyzed by SDS–PAGE followed by immunoblotting. 2.4.2. Cell harvesting and preparation of membranes for 35 [S]GTPcS binding and immunoblotting Transfected cells transiently expressing GABAB receptor subunits R1 and R2 were harvested simply by scraping from the culture dish in phosphate buffered-saline (137 mM NaCl, 2.7 mM KCl, 10 mM Na2 HPO4 , 1.8 mM KH2 PO4 , pH 7.2) (PBS). Cells were then recovered by centrifugation at 2000g for 2 min in a microcentrifuge at 4 C. Cells must be thoroughly washed in PBS to ensure complete removal of any residual serum as this will act as a G-protein stimulator and may interfere with downstream functional assays. Harvested cells may be stored as a pellet at )80 C for up to 2 months or can be used directly for the production of plasma membranes. Plasma membrane-containing P2 particulate fractions were then prepared from the above cell pastes. All procedures were carried out at 4 C. Cell pellets were resuspended in 1 ml of 10 mM Tris–HCl and 0.1 mM EDTA, pH 7.5 (buffer A), and rupture of the cells was achieved by homogenization for 20 s with a Polytron homogenizer followed by passage (five times) through a
25-gauge needle. Cell lysates were centrifuged at 1000g for 10 min in a microcentrifuge to pellet the nuclei and unbroken cells, and P2 particulate fractions were then recovered by microcentrifugation at 16,000g for 30 min. P2 particulate fractions were resuspended in buffer A and stored at )80 C until required. Protein concentrations were determined using the bicinchoninic acid (BCA) procedure [25] using BSA as a standard. It should be noted that most protocols detailing isolation of plasma membranes stipulate a centrifugation step in excess of 40,000g to ensure membrane recovery. However, we have found equivalent yields can be achieved using 16,000g for 30 min which has the advantage of obviating the need for an ultracentrifuge, thus expediting isolation of membranes. 2.5.
35
[S]GTPcS binding
Activated receptors increase the rate of exchange of GDP for GTP on the G-protein a subunit and thereby increase the rate of GTP hydrolysis [26,27]. Members of the Gi family of G-proteins possess the highest rates of guanine nucleotide exchange of all the heterotrimeric Gproteins [27]. This property exclusively allows the function of only Gi G-proteins in a complex membrane mixture activated by specific agonists to be assessed by measuring the exchange of GDP for GTP and/or the subsequent hydrolysis of GTP. Agonist-stimulated binding of an 35 S-labeled form of the poorly hydrolyzable analog of GTP, GTPcS ([35 S]GTPcS) [28], lends itself perfectly as a suitable functional assay to measure activation of the GABAB receptor. This assay can be performed using two techniques which differ only in the means by which bound nucleotide is separated from free: (1) using wheat germ agglutinnin scintillation proximity assay (SPA) bead technology; (2) using traditional separation of bound from free nucleotide by filtration. The assay using SPA technology is more convenient than the filtration assay and is detailed herein with particular relevance to the GABAB receptor. Assays were performed in 96-well format using a method modified from that described in Weiland and Jakobs [28]. Membranes (10 lg per point) were diluted to 0.083 mg/ml in assay buffer (20 mM Hepes, 100 mM NaCl, 10 mM MgCl2 , pH7.4) supplemented with saponin (10 mg/liter) and preincubated with 10 lM GDP. Various concentrations of GABA were then added followed by [35 S]GTPcS (1170 Ci/mmol, Amersham) at 0.3 nM (total volume of 100 ll) and binding was allowed to proceed at room temperature for 30 min. Nonspecific binding was determined by the inclusion of 0.6 mM GTP. Wheat germ agglutinin SPA beads (Amersham) (0.5 mg) in 25 ll assay buffer were added and the whole was incubated at room temperature for 30 min with agitation. Plates were centrifuged at 1500g for 5 min and [35 S]GTPcS bound was determined by scintillation
J.H. White et al. / Methods 27 (2002) 301–310
307
Fig. 4. Coexpression of GABAB R1 and GABAB R2 receptors in HEK293T cells leads to GABA-mediated stimulation of [35 S]GTPcS binding activity. [35 S]GTPcS binding activity was measured from membranes expressing Go1 a together with GABAB receptor subunits. (A) [35 S]GTPcS binding in the absence (open bars) or presence (filled bars) of GABA (10 mM). (B) The ability of varying concentrations of GABA to stimulate the binding of [35 S]GTPcS in membranes expressing either Go1 a and HA-GABAB2 alone (open circles) or in combination with either GABAB1a (closed squares) or GABAB1b (closed triangles). The data shown are the means SD of triplicate measurements and are representative of three independent experiments. (Copyright permission from Nature, http://www.nature.com/.)
308
J.H. White et al. / Methods 27 (2002) 301–310
counting on a Wallac 1450 Microbeta Trilux scintillation counter. Fig. 4 demonstrates such an assay using membranes from HEK293T cells transiently transfected to express Go1 a in combination with either GABAB1 or GABAB2 or with both receptor subunits (Fig. 4A). The figure shows that coexpression of both subunits is required to provide an agonist concentration-dependent stimulation of [35 S]GTPcS binding ðEC50 ¼ 7:8 0:4 10 5 MÞ (Fig. 4B). These values are equivalent to those of GABA-mediated stimulation of [35 S]GTPcS binding to rat brain membranes (5:9 0:4 10 5 M) (data not shown). Hence, coexpression of GABAB1 and GABAB2 resulted in the generation of a functional GABAB receptor. Note: To generate a significant agonist-mediated response in transient systems it is often necessary to cotransfect receptor with additional Gi =Go G-protein.
diluted 1:30 for 15 min at room temperature. For permeabilized cells, the Fix and Perm Kit (Caltag) was used. FACS analysis was performed on a Coulter Elite FACS cytometer. Thirty thousand cells were analyzed in each experiment. Fig. 5 shows that in intact cells expressing Myc–GABAB1b alone, no cell surface anti-Myc immunoreactivity was detected. In contrast, immunoreactivity toward Myc was detected in 35% of permeabilized cells, reflecting intracellular expression of GABAB1b . However, when GABAB2 was cotransfected with Myc–GABAB1b , 20% of intact cells displayed cell surface anti-Myc immunoreactivity. Hence, these data indicate that, in the presence of GABAB2 , GABAB1b is efficiently moved to the cell surface. Interestingly, 14% of HEK293T cells transfected with HA–GABAB2 showed surface immunoreactivity (Fig. 5c), suggesting that this receptor can be efficiently trafficked to the cell surface in the absence of GABAB R1.
2.6. FACS analysis 2.7. Immunological studies and receptor glycosylation Flow-cytometry analysis (FACS) is a powerful tool that can be used to study the cellular distribution of immunotagged proteins. Hence, this technique was employed to study the cellular localization of GABAB receptor subunits expressed in isolation and in combination. HEK293T cells were transiently transfected with cDNA as described. Forty-eight to seventy-two hours following transfection cells were recovered and washed twice in PBS supplemented with 0.1% (w/v) NaN3 and 2.5% (v/v) fetal calf serum (FACS buffer). Cells were resuspended in FACS buffer and incubated with primary antibody 9E10 (c-myc) or HA for 15 min at room temperature. Following three further washes with PBS, cells were incubated with secondary antibody (sheep antimouse Fab2 coupled with fluorescein isothiocyanate)
Endoglycosidases F and H can be used to differentiate between immature, core glycosylated, and terminally glycosylated N-linked glycoproteins that have passed through the Golgi apparatus [3]. Therefore, these enzymes were used to examine the glycosylation status of both GABAB1 and GABAB2 . Membranes from transfected cells were treated with either endoglycosidase F or H and expressed GABAB receptors were characterized by immunoblotting to compare relative electrophoretic mobilities of the receptors (Fig. 6). Cell membranes expressing either GABAB1a or GABAB1b produced distinct bands of Mr 130K and 100K, respectively (Fig. 6, lanes 1 and 4), which, following endoglycosidase F treatment, decreased in size to single immunoreactive species of Mr
Fig. 5. Cell surface localization of GABAB R1 receptor is dependent on coexpression with GABAB R2. (A) FACS analysis using anti-c-Myc as primary antibody on intact cells: (a) mock transfected; (b) GABAB1b ; (c) GABAB1b þ GABAB2 . (B) FACS analysis using anti-c-Myc as primary antibody on permeabilized cells: (a) mock transfected; (b) GABAB1b ; (c) GABAB1b þ GABAB2 . (C) FACS analysis using anti-HA as primary antibody: (a) mock transfected; (b) GABAB2 . (Copyright permission from Nature, http://www.nature.com/.)
J.H. White et al. / Methods 27 (2002) 301–310
Fig. 6. Coexpression of GABAB1 variants with GABAB2 receptors in HEK293T cells results in terminal glycosylation of GABAB1 . Membrane fractions from cells transfected with either GABAB1a (lanes 1–3), GABAB1b (lanes 4–6), or HA-GABAB2 (lanes 13–15), or with 1 lg each of HA-GABAB2 in combination with 1 lg of either GABAB1a (lanes 7– 9, 16–18) or GABAB1b (lanes 10–12, 19–21). Glycosylation status of transfected receptors was assessed following treatment with either vehicle (lanes 1, 4, 7, 10, 13, 16, 19), endoglycosidase F (lanes 2, 5, 8, 11, 14, 17, 20), or endoglycosidase H (lanes 3, 6, 9, 12, 15, 18, 21), Upper: Antiserum 501 was used as primary reagent to allow identification of both GABAB1a and GABAB1b . Lower: Anti-HA antiserum was employed to permit identification of HA-epitope-tagged GABAB2 . (Copyright permission from Nature, http://www.nature.com/.)
110K and 80K (Fig. 6, lanes 2 and 5). This showed that recombinant GABAB1a and GABAB1b are glycoproteins, in agreement with the observations of Kaupmann et al. [5]. However, both forms were also sensitive to endoglycosidase H treatment, indicating that the expressed proteins were only core glycosylated (lanes 3 and 6) and lacked terminal glycosylation. This observation, together with that of the FACS analysis, suggested that the proteins were immaturely glycosylated and retained on internal membranes. Significantly, when either GABAB1a (lanes 7–9) or GABAB1b (lanes 10–12) was coexpressed with HA–GABAB2 , a component of GABAB1 was resistant to endoglycosidase H digestion, suggesting that when coexpressed with GABAB R2, a significant fraction of GABAB1 was now a mature glycoprotein (lanes 9 and 12). Similar studies with HA–GABAB1 gave an immunoreactive species of Mr 120K (Fig. 6, lanes 13, 16, 19) which was sensitive to endoglycosidase F (lanes 14, 17, 20) but resistant to endoglycosidase H (lanes 15, 18, 21) treatment, whether expressed alone or in combination with GABAB1 . Thus, these data indicated that expressed HA– GABAB2 was a mature glycoprotein whose glycosylation status was not affected by coexpression with GABAB R1. Hence, the deglycosylation studies suggested that heterodimerization, possibly occurring in the Golgi complex, could be a prerequisite for maturation and transport of
309
GABAB R1 to the plasma membrane. Immunoblotting and deglycosylation protocols are described below. Antiserum 501 was raised against a synthetic peptide corresponding to the C-terminal 15 amino acids of the GABAB1 receptor and was produced in a sheep, using a conjugate of this peptide and keyhole limpet hemocyanin (Calbiochem) as antigen. Membrane samples (30– 60 lg) were resolved by SDS–PAGE using 10% (w/v) acrylamide. Following electrophoresis, proteins were subsequently transferred to nitrocellulose (HybondECL, Amersham), probed with antiserum 501 at 1:1000 dilution, and visualized by enhanced chemiluminescence (ECL, Amersham). Epitope tags were visualized by immunoblotting with anti-Myc (1:100 dilution) or antiHA (1:500) monoclonal antibodies. Enzymatic removal of asparagine-linked (N-linked) carbohydrate moieties with endoglycosidases F and H was performed essentially according to the manufacturer’s (Roche Diagnostics) instructions using 50 lg of membrane protein per enzyme reaction. GABAB receptor glycosylation status was then studied following SDS–PAGE/immunoblotting of samples.
3. Conclusions The techniques described here enabled the observation that the fully functional GABAB receptor was an obligate heterodimer, comprising two closely related and interacting GPCRs. Since these initial experimental data, many more GPCRs have been reported to dimerize [1,2], and indeed, the idea of other GPCR-associated proteins is now coming to the fore [29]. However, sensitive biochemical studies in mammalian recombinant systems, which generate compelling data suggesting dimerization between receptors in various combinations, should be used with care as misleading data can be easily generated. For example with immunoprecipitation strategies, due to the hydrophobic nature of the seventransmembrane helices of GPCRs, stringent controls should be put in place to exclude nonspecific interactions between receptor pairs that may result following detergent dissolution of cellular membranes. This may be a significant problem when overexpression systems are employed to study dimerization. Indeed, more recent studies have used various forms of time-resolved fluorescence resonance energy transfer and bioluminescence resonance energy transfer to study GPCR homo- and heterooligomerization in living cells [30–32, this issue]. It is critically important to go back to native tissue and confirm that the observed GPCR dimerization is of physiological significance. Clearly for receptors to form heterodimers, the two partnering GPCRs should be coexpressed in the same cell and indeed in the same subcellular compartment for some point during their life cycle. Colocalization at a cellular level is therefore
310
J.H. White et al. / Methods 27 (2002) 301–310
necessary for in vivo confirmation, using either in situ hybridization or preferably immunohistochemistry. Coimmunoprecipitation from native tissue also provides superior evidence for a physiological interaction. Receptors that are capable of heterodimerization in overexpressed cell systems with resulting alterations to their pharmacological profile may not actually do so in real tissue. For orphan receptors coexpression data may themselves provide the initial evidence for receptor dimerization. In the case of the GABAB receptor conclusive evidence for the importance of heterodimerization in vivo has been demonstrated by the GABAB1 receptor knockout which loses all responses to GABAB agonists despite expressing GABAB2 [33,34]. References [1] M. Bouvier, Nat. Rev. Neurosci. 2 (2001) 274–286. [2] G. Milligan, J. Cell Sci. 114 (2001) 1265–1271. [3] L.M. McLatchie, N.J. Fraser, M.J. Main, A. Wise, J. Brown, N. Thompson, R. Solari, M.G. Lee, S.M. Foord, Nature 393 (1998) 333–339. [4] N.G. Bowery, Annu. Rev. Pharmacol. Toxicol. 33 (1993) 109–147. [5] K. Kaupmann, K. Huggel, J. Heid, P.J. Flor, S. Bischoff, S.J. Mickel, G. McMaster, C. Angst, H. Bittiger, W. Froestl, B. Bettler, Nature 386 (1997) 239–246. [6] J.H. White, A. Wise, M. Main, A. Green, N.J. Fraser, G.H. Disney, A.A. Barnes, P. Emson, S.M. Foord, F.H. Marshall, Nature 396 (1998) 679–682. [7] A. Couve, A.K. Filippov, C.N. Connolly, B. Bettler, D.A. Brown, S.J. Moss, J. Biol. Chem. 273 (1998) 26361–26367. [8] P.L. Bartel, S. Fields, The Yeast Two Hybrid System, Oxford Univ. Press, London, 1997. [9] R. Kuner, G. Kohr, S. Grunewald, G. Eisenhardt, A. Bach, H.C. Kornau, Science 283 74–77. [10] R.A. Kammerer, S. Frank, T. Schulthess, R. Landwehr, A. Lustig, J. Engel, Biochemistry 38 (1999) 13263–13269. [11] M. Margeta-Mitrovic, Y.N. Jan, L.Y. Jan, Neuron 27 (2000) 97– 106. [12] D.A. Schwarz, G. Barry, S.D. Eliasof, R.E. Petroski, P.J.Conlon, R.A. Maki, J. Biol. Chem. 275 32174–32181. [13] K.A. Jones, B. Borowsky, J.A. Tamm, D.A. Craig, M.M. Durkin, M. Dai, W.J. Yao, M. Johnson, C. Gunwaldsen, L.Y. Huang, C. Tang, Q.R. Shen, J.A. Salon, K. Morse, T. Laz, K.E. Smith, D. Nagarathnam, S.A. Noble, T.A. Branchek, C. Gerald, Nature 396 (1998) 674–679. [14] K. Kaupmann, B. Malitschek, V. Schuler, J. Heid, W. Froestl, P. Beck, J. Mosbacher, S. Bischoff, A. Kulik, R. Shigemoto, A. Karschin, B. Bettler, Nature 396 (1998a) 683–687.
[15] A. Pagano, G. Rovelli, J. Mosbacher, T. Lohmann, B. Duthey, D. Stauffer, D. Ristig, V. Schuler, I. Meigel, C. Lampert, T. Stein, L. Prezeau, J. Blahos, J. Pin, W. Froestl, R. Kuhn, J. Heid, K. Kaupmann, B. Bettler, J. Neurosci. 21 (2000) 1189–1202. [16] A.R. Calver, M.J. Robbins, C. Cosio, S.Q. Rice, A.J. Babbs, W.D. Hirst, I. Boyfield, M.D. Wood, R.B. Russell, G.W. Price, A. Couve, S.J. Moss, M.N. Pangalos, J. Neurosci. 21 (2001) 1203– 1210. [17] S. Fields, O. Song, Nature 340 (1989) 245–246. [18] G.G. Toby, E.A. Golemis, Methods 24 (2001) 201–217. [19] K.J. Fuller, M.A. Morse, J.H. White, S.A. Dowell, M.J. Sims, Biotechniques 25 (1998) 85–92. [20] J.H. White, R.A. McIllhinney, A. Wise, F. Ciruela, W.Y. Chan, P.C. Emson, A. Billinton, F.H. Marshall, Proc. Natl. Acad. Sci. USA 97 (2000) 13967–13972. [21] R.B. Nehring, H.P. Horikawa, O. El Far, M. Kneussel, J.H. Brandstatter, S. Stamm, E. Wischmeyer, H. Betz, A. Karschin, J. Biol. Chem. 275 (2001) 35185–35191. [22] T. Durfee, K. Becherer, P. Chen, S. Yeh, Y. Yang, A. Kilburn, W. Lee, S.J. Elledge, Genes Dev. 7 (1993) 555–569. [23] J.W. Harper, G.R. Adami, N. Wei, K. Keyomarsi, S.J. Elledge, Cell 75 (1993) 805–816. [24] F.M. Ausubel, R. Brent, R.E. Kingston, J. Moore, G. Seidman, J.A. Smith, K. Sruhl (Eds.), Current Protocols in Molecular Biology, Wiley, New York, 1994. [25] P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D. Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson, D.C. Klenk, Anal. Biochem. 150 (1985) 76–85. [26] H.R. Bourne, D.A. Sanders, F. McCormick, Nature 348 (1990) 125–132. [27] A.G. Gilman, Annu. Rev. Biochem. 56 (1987) 615–649. [28] T. Weiland, K.H. Jakobs, Methods Enzymol. 237 (1994) 3– 13. [29] G. Milligan, J.H. White, Trends Pharmacol. Sci. 10 (2001) 513– 518. [30] S. Angers, A. Salahpour, E. Joly, D. Chelsky, M. Dennis, M. Bouvier, Proc. Natl. Acad. Sci. USA 97 (2000) 3684–3689. [31] M. Rocheville, D.C. Lange, U. Kumar, R. Sasi, R.C. Patel, Y.C. Patel, Science 288 (2000) 154–157. [32] M. McVey, D. Ramsay, E. Kellett, S. Rees, S. Wilson, A.J. Pope, G. Milligan, J. Biol. Chem. 276 (2001) 14092–14099. [33] V. Schuler, C. Luscher, C. Blanchet, N. Klix, G. Sansig, K. Klebs, M. Schmutz, J. Heid, C. Gentry, L. Urban, A. Fox, W. Spooren, A.L. Jaton, J. Vigouret, M. Pozza, P.H. Kelly, J. Mosbacher, W. Froestl, E. Kaslin, R. Korn, S. Bischoff, K. Kaupmann, H. van derPutten, B. Settler, Neuron 31 (1) (2001) 47–58. [34] H.M. Prosser, C.H. Gill, W.D. Hirst, E. Grau, M. Robbins, A. Calver, E.M. Soffin, C.E. Farmer, J. Gray, E. Schenck, B.S. Warmerdam, C. Clapham, C. Reavill, D.C. Rogers, T. Stean, N. Upton, K. Humphreys, A. Randall, M. Geppert, C.H. Davies, M.N. Pangalos, Mol. Cell. Neurosci. 17 (2001) 1059– 1070.