Heterologous expression and characterization of thermostable lipase (Lk1) in Pichia pastoris GS115

Journal Pre-proof Heterologous expression and characterization of thermostable lipase (Lk1) in Pichia pastoris GS115 Baiq Repika Nurul Furqan, Akhmaloka PII:

S1878-8181(19)31496-3

DOI:

https://doi.org/10.1016/j.bcab.2019.101448

Reference:

BCAB 101448

To appear in:

Biocatalysis and Agricultural Biotechnology

Received Date: 2 October 2019 Accepted Date: 24 November 2019

Please cite this article as: Nurul Furqan, B.R., Akhmaloka, , Heterologous expression and characterization of thermostable lipase (Lk1) in Pichia pastoris GS115, Biocatalysis and Agricultural Biotechnology (2019), doi: https://doi.org/10.1016/j.bcab.2019.101448. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.

Heterologous Expression and Characterization of Thermostable Lipase (Lk1) in Pichia pastoris GS115 Baiq Repika Nurul Furqan1 and Akhmaloka1,2* 1

Biochemistry Research Group, Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung. 2 Departement of Chemistry, Faculty of Science and Computer, Universitas Pertamina.

Abstract A gene encoding thermostable lipase namely LK1 was successfully sub-cloned into expression vector pPICZ A and integrated into a chromosomal fungal host, Pichia pastoris GS115. The recombinant mut+ clones selected on zeocine-YPD plates were heterologically expressed into Pichia pastoris GS115 using 1% methanol as inducer at 30℃ during 120 h in BMMY medium. The protein was expressed at molecular mass 35.5 kDa following SDS-PAGE analysis. The enzyme still showed lipase activity on pNP as substrate. Thermostable lipase was purified by affinity chromatography using Ni-NTA column with a purification fold of 11,6 and yield of 31,75%. Further characterization of the enzyme showed that the enzyme has highest spesicificity on pNP-laurate as substrate with optimum temperature at 60oC, pH 8. In addition, the enzyme still maintained the activity up to 4 h in incubation at 60oC and maintained 50% activity at 3 h incubation. All of the above data suggested that the enzyme is an alkaline tolerance and thermostable lipase. Keywords: Ni-NTA column chromatography, thermostable lipase, heterologous expression, Pichia pastoris GS115.

*Corresponding author:[email protected]

1. Introduction Lipases are a big kind of hydrolases acting as biocatalyst, the enzyme catalyze hydrolysis reaction of long chain carbon triglycerides into glycerol and fatty acids (Walsh, 2014). These features make lipases commercially used in several industries, such as food industry, cosmetics, detergents, biomedicine, biopolymers, biosurfactants and biodiesel industries (Salihu and Alam, 2014). The fact that lipase is broad application and the world’s increasing need on this enzyme, drive the researcher to explore more lipase from natural resourses. Commercial lipases are generally obtained from thermophilic bacteria producing thermostable lipases (Indrajaya, et al., 2003). Isolation of local strain of thermophilic bacteria producing thermostable lipases were carried out such as isolation from hot springs in Indonesia and also from compost (Madayanti, et al., 2008). The enzyme is crucial in industries since it uses at high temperatures (Leow, et al., 2004). The use of lipases in various industries causes the increasing world demand for the enzyme. The LK1 lipase encoding gene was obtained by the metagenomic approach from previous study (Nurhasanah, et al., 2017). Heterological expression of the LK1 was carried out in Escherichia coli resulting on low specific activity of the enzyme due to form of inclusion body (Nurfadilah, personal commmunication). For this reason expression of the enzyme in other host was carried out in this report. One particular organism that commonly used as host cell is yeast Pichia pastoris showing several advantages such as; high growth speed even when cultured in a small medium, capable of secreting the target protein outside the cell, the better folding of protein which prevent the formation of inclusion body and exhibit ability to do post-translational modifications (Li, et al., 2007). In addition, there were many studies reported on expressing various types of lipases in Pichia pastoris that produce high activity of enzyme, such as Rhizopus oryzae lipase (Resina, et al., 2004), Rhizomucor miehei lipase (Huang, et al., 2014), Fusarium solani NAN103 lipase (Wongwatanapaiboon, et al., 2016) and Pseudomonas fluorescens lipase (Wu, et al., 2017). Therefore, in this study expression, purification and characterization of the Lk1 was performed using P. pastoris as the host cells.

2

2. Methods 2.1. Transformation of P. pastoris using Recombinant Plasmid pPICZαA-LK1 recombinant plasmid was constructed by subcloning LK1 gene from pET3Oa-LK1 into pPICZαALK1. The plasmid was linearized using SacI enzyme. Linear plasmids were integrated into P.pastoris GS115 using electroporation methods which were then grown on YPD solid medium (1% yeast extract, 2% peptone and 2% dextrose) with the addition of 100 µg/mL zeocine antibiotics and then incubated at 30oC for 2 days (Glick and Pasternak, 2003). Growing transformants were then transferred into YPD solid medium with the addition of zeocine 1000 µg/mL and 2000 µg/mL. Transformants that growing YPD medium with the addition of zeocine 2000 µg/mL were then amplified with primers AOX1 R (GCAAATGGCATTCTGACATCC) and AOX1 F (GACTGGTTCCAATTGACAAGC) (Schleif, 1993). The PCR condition for ampilification of LK1 gene is available in the invitrogen manual (Simatupang, personal communication). 2.2. Expression of Recombinant Plasmid in P. pastoris GS115 Single colony of mut+ transformants grown on YPD solid media with the addition of 2000 µg/mL zeocine was then inoculated to 10 mL YPD culture for overnight at 30oC with 150 rpm. The culture then transferred to 50 mL of BMGY media (1% yeast extract, 1.34% YNB, 2% peptone, 1% glycerol, 100mM sodium phosphate buffer pH 6, 4x10-5% biotin) in the 500 mL Erlenmeyer until the OD600nm = 0.05 then incubated at 30oC with stirring speed of 150 rpm to obtain OD600nm = 2-8. The yeast cells were centrifuged and the pellets were resuspended using 50 mL of BMMY media (1% yeast extract, 1.34% YNB, 2% peptone, 1% methanol, 100mM sodium phosphate buffer pH 6, 4x10-5% biotin). The culture was induced with 1% (v/v) methanol every 24 h and incubated at 30oC for up to 5 days. The cells were harvested and centrifuged at 3000 x g for 10 minutes and the supernatant was collected to measure the activity of crude extract of Lk1 protein (Sambrook and Russel, 2001). 2.3. Purification of Protein using Chromatography Ni-NTA Purification was carried out by gravity flow method without centrifugation at room temperature. A suspension of NiNTA agarose resin was put into the column, then waited until the resin had settled and separated from the solvent. The column was washed with 2 x 6 mL miliQ sterile. The binding buffer (0.05M sodium phosphate buffer pH 8, 0.1M NaCl and 0.1% (v/v) Triton X) of 3 x 15 mL was then passed into the column. 1mL of protein solution (crude extract) was then placed into the column periodically and allowed to stand for 5 minutes then passed along the column. The resin was washed with buffer solution (0.05M sodium phosphate buffer pH 8, 0.1M NaCl) as much as 2 x 20 mL, the bound protein was then eluted with an elution buffer containing 80 mM imidazole (0.05M sodium phosphate buffer pH 8, 300mM NaCl, and 80mM imidazole) as much as 5 ml for 15 mL of crude extract. Finally, the column was eluted with 250 mM elution buffer (0.05 M sodium phosphate buffer pH 8, 100mM NaCl, 250mM imidazole). Dialysis was performed to remove imidazole. Pure protein was then analyzed using SDS-PAGE (Nurhasanah, et al., 2017). 2.4. Characterization of Lk1 Protein Lipase activity was determined by modified colorimetric method using p-nitrophenyl-fatty acid substrate (pNP-fatty acid). The substrate solution consists of a phosphate buffer, absolute ethanol, 0.1 mM pNP-fatty acid with a volume ratio of 95: 4: 1. 200 µL of sodium phosphate buffer was added into 900 µL of substrate solution and then incubated at 50oC for 30 seconds, then 100 mL of enzyme solution was then added and re-incubated at 50oC for 15 minutes. The enzyme reaction was stopped by inserting microtube containing the reaction mixture into the ice, and absorbance measurement was immediately carried out using spectrophotometer at a wavelength of 405 nm (Sambrook and Russel, 2001). Concentration of protein was determined by using Bradford method (Bradford, 1976). All the tests were conducted repeatedly 2-3 times. A standard curve was created by determining the absorbance of a p-nitrophenol solution at a concentration of 2-8 µg/mL. Substrate specificity testing was carried out using 5 kinds of substrates (pNP-butyrate, pNP-decanoate, pNP-Laurate, pNP-myristate and pNP-palmitate) under test conditions at pH 8, 50oC, 15 minutes incubation time. Optimum temperature testing was determined by using substrate in the form of pNP-laurate under standard activity test conditions (pH 8, incubation for 15 minutes) with varying temperatures from 40oC – 90oC. The optimum pH testing is carried out in the pH range of 6-11 using 0.05M sodium phosphate buffer (pH 6-9) and a 0.0 M NaOH buffer (pH 10-11). Thermostability of the enzyme was carried out by incubating the enzyme at the optimum temperature for 1-5 hours and then used to test the activity at the optimum conditions that have been obtained in previously (Nurhasanah, et al., 2017).

3

3. Result and Discussion 3.1. Screening and Verification of lipase Producing Clones Recombinant plasmids pPICZαA - LK1 was used to transform P. pastoris through the integration of expression tapes into chromosomes at specific loci to produce genetically stable transformants. Integration of recombinant plasmids into the P. pastoris genome was obtained by linearising the plasmid at specific site of the AOX1 gene (Li, et al., 2007). In this study the recombinant plasmid was linearized using the SacI restriction enzyme. The development of genetically stable expression lines is highly desirable, with vector loss rate less than 1% per generation without the use of selective markers (Inan and Meagher, 2001).

M

K

M 1 3 9 12

2200 bp 1500 bp

Figure 1

Agarose gel electrophoregram of PCR colony of P.pastoris transformants with AOX1 primers. M(DNA ladder 1kb, marker), K (negative control without LK1 gene inserted), 1,3,9,12 (colony transformants).

The P. pastoris transformant carrying recombinant pPICZαA - LK1 plasmids with the phenotypic of Mut+ showed by 2 bands at 1500 bp (936 bp is LK1 gene size that encoded 312 amino acid; 564 is signal α-factor gene size) and 2200 bp (1636 is AOX1 gene size; 564 is signal α-factor gene size) on electrophoregrams following PCR colonies with AOX1 primers. The appearance of these 2 (Figure 1) bands indicated that the AOX1 gene was not deletion (Li et al., 2007). 3.2. Expression and Purification of Lk1 Protein The expression of recombinant plasmid in P. pastoris was carried out using Mut+ transformant with 1% induction of methanol for 5 days at 30oC and 150 rpm. Following SDS analysis of the supernatant showed that the thick band of the protein was appeared (Figure 2, Lane 2). The crude extract still showed lypolytic activity at 0.157 U/mg. Induction with methanol was performed since the AOX1 promoter is regulated by the presence of methanol in medium. The presence of methanol expressing Prm1 and Mit1 activators in AOX1 (De Schutter, et al., 2009). 1 2 3

35.5 kDa

4

Figure 2

SDS-PAGE electrophoregram of Lk1 protein; 1 (protein marker), 2 (crude extract), 3 (purified LK1 protein).

The purification of recombinant protein was performed using Ni-NTA affinity chromatography. A clear single band with the size ± 35.5 kDa appeared following SDS-PAGE (Figure 2, Lane 3), this corresponds to the amino acid of LK1 of 312 which will weigh 35 kDa. The enzyme showed higher activity compared to that the crude extract at around 11.6 fold (1.82 U/mg) (Table 1). Table 1 Activity test of crude extract and purified protein Total Total Specific Yield (%) Purification protein activity activity (Fold) (x) (mg) (U) (U/mg) Crude extract 16.002 2.52 0.157 ± 0.07 100 1 Purified 0.396 0.8 1.82 ± 0.05 31.75 11.6 One unit of activity is defined as the amount of enzymes that can release 1µL pNP (p-nitrophenol) per minute (molar extension coefficient is 1.547 x 105 cm2 mol-1 under test conditions). Protein

The specific activity of the enzyme obtained from P. pastoris is higher compared to that the Lk1 expressed in E. coli BL21 where the the specific activity of crude extract and purified protein were 0.0015 U/mg and 0.0035 U/mg (Nurfadilah, personal communication) respectively. 3.3. Substrate Preference of the Enzyme A few substrate analog namely pNP-butyrate (C4), pNP-decanoate (C10), pNP-laurate (C12), pNP-myristate (C14), and pNP-palmitate (C16) were used to probe the preference of the enzyme to use variation of substrate from C4-C16. The result showed that the highest activity of the enzyme was appeared on pNP-laurate (C12) as substrate (Figure 3). The result is suggested that the enzyme prefer a medium long chain substrate. The above data supported by the sequence of the gene which was belong to the family I.1 (true lipase) (Nurhasanah, et al., 2017). 1.8

Spesific Activity (U/mg)

1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 Butyrate

Decanoate

Laurate

Myristate

Palmitate

Substrate pNPFigure 3

Specific activities of the enzyme on various different length of substrates. The reaction condition at 50°C and pH 8.

3.4. Temperature and pH Optimum By using pNP-laurate as substrate the enzyme was assayed on various differences temperature from 40°C up to 90°C. The result showed that the activity of the enzyme increased with increasing temperature up to 60° C however the activity decreased when the temperature was raised from 60°C – 90°C (Figure 4). The activity of the enzyme was still remained 80% at 70°C and maintained its activity almost 50% at 80°C. Further characterization to probe the optimum pH of the enzyme was carried out with pNP-laurate as substrat, at 60°C on variation of pH from pH 6-11. The result showed that the highest activity at pH 8 (Figure 5), however the enzyme still remained 70% of the activity at pH 9. Bacterial lipases generally showed an opimum temperature at 30°C – 60°C and neutral pH (Gupta, et al., 2004) based on the sequence analysis of LK1 gene was close to lipase gene from Psedomonas stutzeri (Nurhasanah, et al.,

5

2017). Lipase from Psedomonas stutzeri was reported to have optimum activity at 30°C and pH 8 (Cao, et al., 2012). Since LK1 gene was cloned directly from compost at thermogenic stage (Nurhasanah, et al., 2017). Lk1 lipase might be difference lipase compared than the lipase previous reported (Gupta, et al., 2004). 120

Relative Activity (%)

100

80

60

40

20

0 40

50

60

70

80

90

Temprature (℃) Figure 4

Relative activity of the enzyme on various temperature. The reactions were performed at pH 8 and pNP-laurate as subtrate. 120

Relative Activity (%)

100 80 60 40 20 0 6

7

8

9

10

11

pH Figure 5

Relative activity at the enzyme at various pH. The reaction were performed at 60°C and pNP-laurate as substrate.

3.5. Thermostability and Alkali Tolerant of Lk1 Lipase 120

Residual Activity (%)

100 80 60 40 20 0 0

1

2

3

Incubation time (h)

4

5

6

6

Figure 6

Residual activity of the enzyme at various incubation time at 60°C and pH 8. The reaction were performed at 60°C, pH 8, and pNP-laurate as substrate.

To probe the thermostability and alkali tolerant, the enzyme was incubated at 60°C and pH 8 for period of time up to 5 hours. The activity of the enzyme was remained half for 3 hours incubation (Figure 6). A few other lipase were reported to maintain its activity up to 2 hour incubation at the optimum temperature and optimum pH (Lizumi, et al., 1990). 4. Conclusion The LK1 gene was successfully integrated on the chromosomal of P.pastoris GS115. The gene was best expressed with the induction of 1% methanol for 5 days. The enzyme with the size of 35.5 kDa was successfully purified by NiNTA affinity chromatography. From all of the data obtained suggested that Lk1 lipase is truly thermostable and alkali tolerant lipase. Acknowledgements We would like to thank to P3MI research program of ITB and LPDP (scholarship to BRNF) to make this research possible to be carried out. References Bradford M.M. 1976. A Rapid and Sensitive Method for The Quantitation of Microgram Quantities of Protein Utilizing The Principle of Protein-Dye Binding. Analytical Biochemistry. 72, 248-254. Cao, Y., Zhuang, Y., Yao, C., Wu, B., and He, B., 2012. Purification and Characterization of an Organic Solvent-Stable Lipase from Pseudomonas stutzeri LC2-8 and Its Application for Efficient Resolution of (R,S)-1-Phenylethanol. Biochemical Engineering Journal. 64, 55–60. http://dx.doi.org/10.1016/j.bej.2012.03.004. De Schutter, K., Yao-Cheng, L., P. Tiels, A., Van Hecke, S., Glinka, J., Weber-Lehmann, P., Rouze, Y., Van de Peer and Callewaert, N., 2009. Genome sequence of the recombinant protein production host Pichia pastoris. Nat. Biotechnol. 27, 561-569. http://www.nature.com/doifinder/10.1038/nbt.1544. Glick, B.R., and Pasternak, J.J., 2003. Molecular biotechnology, principles and applications of recombinant DNA. ASM Press, Washington DC. Gupta, R., Gupta, N., and Rathi, P., 2004. Bacterial Lipases: An overview of Production, Purification and Biochemical Properties. Applied Microbiology and Biotechnology. 64, 763-781. https://link.springer.com/article/10.1007%2Fs00253-004-1568-8. Huang, J., Xia, J., Yang, Z., Guan, F., Cui, D., Guan, G., Jiang, W., and Li, Y., 2014. Improved production of a recombinant Rhizomucor miehei lipase expressed in Pichia pastoris and its application for conversion of microalgae oil to biodiesel. Biotechnology for Biofuels. 7, 111-122. https://doi.org/10.1186/1754-6834-7-111. Inan, M., and Meagher, M.,M., 2001. Non-repressing carbon sources for alcohol oxidase (AOX1) promoter of Pichia pastoris. J. Biosci. Bioengng. 92, 585–589. https://doi.org/10.1016/S1389-1723(01)80321-2. Indrajaya, Warganegara, F., and Akhmaloka., 2003. Isolasi dan identifikasi mikroorganisme termofil isolat kawah wayang. Indonesian Journal for Microbiology. 8, 53-56. https://jurnal.ipb.ac.id/index.php/mikrobiologi/article/view/602. Leow, T.C., Rahman, R.N.Z.R.A., Basri, M., and Salleh, A.B., 2004. High Level Expression of Thermostable Lipase from Geobacillus, sp. Strain T1. Biosci. Biotech. Biochem. 68, 96-103. https://doi.org/10.1271/bbb.68.96. Li P., Anumanthan A., Gao X-G., Ilangovan K., Suzara V.V., Düzgüneş N., and Renugopalakrishnan V., 2007. Expression of Recombinant Proteins in Pichia Pastoris. Appl Biochem Biotechnol. 142, 105–124. https://doi.org/10.1007/s12010-007-0003-x. Lizumi, T., Nakamura, K., and Fukase, T., 1990. Purification and Characterization of a Thermostable Lipase from Newly Isolated Pseudomonas sp. KWI-56. Agric. Biol. Chem. 54, 12531258. https://doi.org/10.1080/00021369.1990.10870128. Madayanti, F., El Vierra, B.V., Widhiatuty, M.P., and Akhmaloka., 2008. Characterization and Identification of Thermophilic Lipase Producing Bacteria from Thermogenic Compost. Journal of Pure and Applied Microbiology. 2, 325-332. http://ijib.classicrus.com/trns/9933311569973901.pdf. Nurhasanah. Nurbaiti, S., Madayanti, F., and Akhmaloka., 2017. Heterologous Expression of Gene Encoded Thermostable Lipase and Lipolytic Activity. Journal of Pure and Applied Microbiology. 11, 135139. http://dx.doi.org/10.22207/JPAM.11.1.18. Resina, D., Serrano, A., Valero, F., and Ferrer, P., 2004. Expression of a Rhizopus oryzae lipase in Pichia pastoris under control of the nitrogen source-regulated formaldehyde dehydrogenase promoter. J. Biotechno. 109, 103-116. https://doi.org/10.1016/j.jbiotec.2003.10.029.

7

Salihu, A., and Alam, M.Z., 2014. Thermostable Lipases: An Overview of Production, Purification and Characterization, Biosciences Biotechnology Research Asia. 11, 1095-1107. http://www.biotechasia.org/vol11no3/thermostable-lipases-an-overview-of-production-purification-and-characterization/. Sambrook, J., and Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual 3rd edition. Cold Spring Harbor Laboratory Press, New York. Schleif, R., 1993. Genetics and Molecular Biology, second edition. The Johns Hopkins University Press, London. Walsh, G., 2014. Proteins: Biochemistry and Biotechnology, Second Edition. John Wiley & Sons, USA. Wongwatanapaiboon, J., Malilas, W., Thummadetsak, G., Chulalaksananukul, S., Marty, A., Chulalaksananukul, W., and Marty, A., 2016. Overexpression of Fusarium solani lipase in Pichia pastoris and its application in lipid degradation. Biotechnology & Biotechnological Equipment. 30, 885-893. https://doi.org/10.1080/13102818.2016.1202779. Wu, L., Menggang, L., and Yunjun, Y., 2017. Heterologous expression and characterization of a new lipase from Pseudomonas fluorescens Pf0–1 and used for biodiesel production. Sci Rep. 7, 1-11. https://doi.org/10.1038/s41598-017-16036-7.