High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes

Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Contents lists available at ScienceDirect

Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes Kseniya V. Shishova a, Yuriy M. Khodarovich a, Elena A. Lavrentyeva a,b, Olga V. Zatsepina a,n a b

Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Miklukho-Maklaya Street, 16/10, 117997 Moscow, Russian Federation Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, GSP-1, Leninskiye Gory, MSU, 1-73, Office 433, 119991 Moscow, Russian Federation

art ic l e i nf o

a b s t r a c t

Article history: Received 14 May 2015 Received in revised form 23 July 2015 Accepted 25 July 2015

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The “internal” rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5′ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. & 2015 Elsevier Inc. All rights reserved.

Keywords: Nucleolus-like bodies Mouse GV oocytes BrUTP Transcription Pre-rRNA rRNA Nucleolar proteins

1. Introduction Nucleolus-like bodies (NLBs) are morphologically distinct intranuclear entities occurring only in fully-grown (germinal vesicle, GV) mammalian oocytes [21,23,26,47]. Two main types of NLBs have been determined based on their interaction with the adjacent chromatin: the NLBs associated with blocks of heterochromatin, or chromocenters, are termed “non-surrounded NLBs (NSN)”, and those immersed into the chromatin shell – “surrounded NLBs (SN)” [6,8,25,38]. The SN-type NLBs are present in GV oocyte with a higher developmental potency and therefore are considered as more mature [2,9,47]. The NSN-type NLBs, in contrast to the SNtype, are capable to synthesize rRNA but the transcribed rRNA

genes have so far been visualized only at their surface [4,5,27,33,44]. These observations favored the conclusion that unlike the interior of normal nucleoli, the internal mass of oocyte NLBs is devoid of active ribosomal genes. Both, transcriptionally active and inactive NLBs significantly differ from normal nucleoli by the peculiar ultrastructural organization. Unlike the nucleoli, NLBs are large (
10 μm in diameter) roundish and finely filamentous structures that lack the typical tripartite organization [7,8,27,32]. In addition, the NLB mass, unlike the interior of normal nucleoli, is inaccessible to antibodies or FISH (fluorescence in situ hybridization) probes under a standard procedure of oocyte fixation with aldehyde fixatives [12], so that in formalin-fixed oocytes, NLBs usually look as black unstained areas

Abbreviations: GV, germinal vesicle; NLB, nucleolus-like body; NSN, non-surrounded nucleolus; SN, surrounded nucleolus; rDNA, ribosomal DNA; rRNA, ribosomal RNA; pre-rRNA, the 47S precursor rRNA; 5’ETS, 5’-external transcribed spacer; ITS1, internal transcribed spacer 1; ITS2, internal transcribed spacer 2; snoRNA, small nucleolar RNA; PFA, paraformaldehyde (formalin); Br-RNA, BrUTP-substituted RNA. n Corresponding author. E-mail addresses: [email protected] (K.V. Shishova), [email protected] (Y.M. Khodarovich), [email protected] (E.A. Lavrentyeva), [email protected] (O.V. Zatsepina). http://dx.doi.org/10.1016/j.yexcr.2015.07.024 0014-4827/& 2015 Elsevier Inc. All rights reserved.

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

2

impoverished for any labeling ([37] and references therein). These data are inconsistent with observations indicating the requirement of the NLB material for early embryonic development, as embryos obtained from micro surgically enucleolated mouse GV oocytes stop their development at the 2- or 4-cell stages [14,31]. Recently, using a modified protocol for oocyte fixation [14] or by post-fixation treatment of formalin-fixed oocytes with proteinase K [37] it has been shown that mouse NLBs contain several key nucleolar proteins ensuring ribosome biogenesis in somatic cells. These proteins include UBF (the ubiquitous RNA polymerase I transcription factor), fibrillarin (a major early rRNA processing factor and the main nucleolar methyltransferase), NPM1 (B23, nucleophosmin) and nucleolin (both are multifunctional proteins involved in different steps of ribosome assembly), and the ribosomal protein RPL26. Moreover, a dot-like pattern of distribution of UBF and fibrillarin within the NSN-type NLBs was reminiscent of that in active nucleoli that argues in favor of the presence of transcribed ribosomal genes in the NLB mass. However, a FISH technique failed to reveal 18S and 28S rRNAs inside NLBs of GV oocytes [37]. The reason of the discrepancies between the nucleolus-like distribution of UBF/fibrillarin and the virtual absence of rRNA synthesis in the NLB mass remained unclear. It is known from practice that a reagent used for cell fixation can dramatically affect immunofluorescence and FISH labeling of somatic nucleoli. Based on their effects on soluble proteins, all fixing agents are divided into two main groups: denaturing (precipitating, or coagulant) and cross-linking (or non-coagulant) fixatives [11,18,35]. Traditionally, mammalian oocytes are fixed with crosslinking aldehyde fixatives because of their capability to preserve well the cell morphology. Glutaraldehyde, the strongest cross-linking agent, is commonly used in electron microscopy (e.g., [8,21,34]), while paraformaldehyde (formalin) is used in light microscopy studies of mammalian oocytes [12]. In the current work, we assumed that despite obvious advantages of aldehyde fixatives they however can prevent detection of target molecules by forming additional inter- and intra-molecular cross-links in the NLB mass which contains a vast amount of proteins [13,37]. To test this assumption experimentally, we fixed mouse GV oocytes with 70% ethanol – a typical alcohol denaturing fixative that removes and replaces free water and causes a change in the tertiary structure of molecules by destabilizing hydrophobic and hydrophilic bonds [11,35]. Using ethanol-fixed oocytes, we for the first time showed that the NSN-type NLBs, beside active ribosomal genes on their surface, also contain transcribed rDNA in the internal mass. Inside NLBs, we also revealed main constituents of snoRNPs, U3 snoRNA and fibrillarin, which in normal nucleoli serve for rRNA processing, as well as pre-RNAs, 18S and 28S rRNAs. Moreover, distribution of these compounds was very similar to that in nucleoli actively making pre-ribosomes. Therefore, we concluded that not only the occurrence but also a functional phenotype of the NSN-type NLBs in fully-grown mouse (mammalian) oocytes is more similar to normal nucleoli than it is commonly accepted, and that the NSN-type NLBs serve as ribosome factories. Unlike NSN-type NLBs, SN-type NLBs do not contain transcribed rRNA genes, U3 snoRNA and rRNAs. These observations support the conclusion that during development of NSN-oocytes to SN-oocytes, NLBs stop to produce pre-ribosome and become impoverished for rRNAs directly involved in ribosome biogenesis.

2. Materials and methods 2.1. Animals Female C57Bl/6 mice were purchased from the Pushchino Nursery of Laboratory Animals (Pushchino, Russia). The animals

were kept under pathogen-free conditions with a free access to tap water and standard chow. All experiments were performed according to the local law and the principles of Good Laboratory Practices. 2.2. Collection of oocytes Four-to-six-week old females were injected with 7 IU PMSG (pregnant mare serum gonadotropin) (Sigma-Aldrich, USA) and sacrificed 46–48 h later. Oocytes were collected from ovaries by gentle puncturing of follicles with a needle in М2 medium (SigmaAldrich) supplemented with 100 μg/ml dibutyryl-cAMP (dbcAMP, Santa Cruz Biotechnology Inc., USA) to prevent resumption of meiosis. Manipulations with oocytes were executed using strippers with the internal capillary diameter of 150 mm (Origio, Denmark). Overall, over 250 oocytes were examined. 2.3. Hoechst 33342 pre-staining of live oocytes Single isolated oocytes were placed into 50–100 ml drops of 1 μg/ml Hoechst 33342 (Life Technologies, USA) dissolved in M2 medium containing 100 μg/ml dbcAMP and quickly analyzed under an Axiovert200 epifluorescence microscope equipped with a Plan Apochromat phase contrast  20/0.8 numerical aperture objective (Carl Zeiss, Germany). Based on the chromatin configuration, the oocytes were divided into the NSN-type and the SNtype oocytes, which then were examined separately. 2.4. Assessment of RNA synthesis Assessment of rRNA synthesis in NSN- and SN-type oocytes was performed using BrUTP as precursor and the microinjection technique adjusted for mouse oocytes [37]. Unless indicated elsewhere, oocytes were incubated in M2 þdbcAMP medium supplemented with 10 mg/ml α-amanitin (Sigma-Aldrich) at 37 °C for 1 h and microinjected into the cytoplasm with 1 70.5 pl of a solution containing 100 mM 5-bromouridine 5′-triphosphate sodium salt (BrUTP; Sigma-Aldrich), 140 mM KCl, 2 mM Pipes (pH 7.4) and 50 mg/ml α-amanitin. These conditions have previously been shown to ensure the sufficient inhibition of RNA polymerases II but not of RNA polymerase I transcription [4,5,27,39]. To suppress RNA polymerase II and III activities, the NSN-type oocytes were incubated in M2þ dbcAMP containing 100 mg/ml α-amanitin [41] and injected with 5–10 pl of the transcription mix containing 100 mg/ml α-amanitin [33]. RNA polymerase I and RNA polymerase II/III activities were distinguished by incubation of oocytes in the presence of 0.25 mg/ml actinomycin D [3,28]. To inhibit all RNA polymerases, 0.25 mg/ml actinomycin D was added to M2 þ dbcAMP containing 100 mg/ml α-amanitin. In the control experiments, oocytes were cultured in M2 þdbcAMP without any inhibitor (Table 1). 2.5. Immunolabeling The microinjected oocytes were recovered in dbcAMP-supplemented M2 contained or did not contain (the control) inhibitors (Table 1) for 30 min at 37 °C, rinsed in PBS (PBS, 140 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, and 8.1 mM Na2HPO4, рН 7.2) and fixed with 70% ethanol for 20–30 min. In some experiments, BrUTP-labeled oocytes were fixed with 3% PFA and treated with 0.2% Triton X-100 according to Shishova et al. [37]. The oocytes were washed with PBS (3  5 min), placed to the mouse monoclonal antibody against BrdU (Roche, USA) recognizing also BrU for 1 h, washed in PBS (3  10 min) and incubated with Alexa Fluors568 goat anti-mouse IgG (H þL) antibodies (Molecular probes Inc., USA, cat. A-11003) for 45 min. Br-labeling of NLBs was

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

abolished by exposure of fixed oocytes to 1 mg/ml RNase A (Sigma-Aldrich) for 1 h at room temperature. For double immunolabeling, ethanol-fixed oocytes were incubated in a mixture of anti-BrdU antibody and rabbit polyclonal anti-fibrillarin antibody (Abcam, ab5821) for 1 h, washed in PBS (3  10 min) and placed to a mixture of Alexa Fluors568 goat antimouse IgG (HþL) and Alexa Fluors488 goat anti-rabbit IgG (Hþ L) (Molecular probes Inc., cat. A-11034) for 45 min. The UBF and BrRNA were simultaneously immunolabeled in a mixture of human autoimmune serum P419 ([43]; dilution 1:200 in PBS) and antiBrdU antibody followed by oocyte incubation in a mixture of antihuman IgG (whole molecule) conjugated with FITC (Sigma-Aldrich, F3512) and Alexa Fluors568 goat anti-mouse IgG. Immunolabeling of UBF and fibrillarin was performed in a mixture of P419 serum and anti-fibrillarin antibodies, followed by incubation in a mixture of the anti-human IgG-FITC conjugate and the Alexa Fluors 568 goat anti-rabbit IgG. The antibodies were dissolved in PBS and handled at room temperature. The commercially available antibodies were applied in concentrations recommended by the suppliers. Before mounting in Vectashields (Vector Laboratories, USA), chromatin was counterstained with 1 μg/ml Hoechst 33342 for 15 min. 2.6. Fluorescence in situ hybridization Fluorescence in situ hybridization (FISH) was performed with the antisense oligonucleotide probes listed in Table 2. The probes hybridized with the short-lived 5′-external transcribed spacer (5′ ETS) segment, the internal transcribed spacers 1 and 2 (ITS1 and ITS2, respectively) or with the 18S and 28S rRN+A regions of the mouse 47S pre-rRNA [30,40]. The probes were designed with AlleleID 7.7 software (Premier Biosoft, USA). Two probes targeting the mouse U3 snoRNA (U3(1) and U3(2)) were used according to Azum-Gélade et al. [1]. The probes were synthesized by DNASynthesis LLC (Moscow, Russia), labeled at the 5’-terminal end and had the stock concentration 2 μg/μl. The probes “5’ETS”, “ITS1”, “ITS2” were conjugated with Cy3 and emitted red fluorescence, and the probes “28S”, “18S”, “U3(1)” and “U3(2)” were conjugated with FAM and emitted green fluorescence. The sense probes were used for the negative controls (Table 2). The oocytes were fixed with 70% ethanol for 30 min at room temperature, washed in PBS (3  10 min) and then in the saline– sodium citrate buffer (2  SSC, 0.3 M NaCl, 0.03 M Na3С6Н5О7, рН 7.0; 2  10 min) and placed into the hybridization mix solution. The hybridization mix contained 50% deionized formamide (Sigma-Aldrich), 10% dextran sulfate (Loba Feinchemie GMBH, Austria), 5% 20  SSC (3 M NaCl, 0.3 M Na3С6Н5О7, pH 7.0), and 8 ng/ml probes. Hybridization was performed in a wet chamber for 18 h at 42 °C. After hybridization, oocytes were sequentially washed with 50% formamide (Panreac, Spain) in 2  SSC (3  10 min) at 42 °C, 2  SSC at 42 °C (10 min), and 2  SSC (10 min) at room temperature. The oocytes were counterstained with 1 μg/ml Hoechst 33342 for 15 min, washed in PBS for 5 min, and mounted in Vectashields.

3

Table 1 Inhibitors used to suppress RNA polymerase I, RNA polymerase II and RNA polymerase III activities in the BrUTP-microinjection experiments (see Materials and methods for detail). AA–α-amanitin, actD–actinomycin D, NLBs–nucleolus like bodies, n–the number of examined oocytes. Conditions favoring visualization of Brlabeled RNA in the NSN-type NLBs are shadowed. In control NSN-oocytes, only fuzzy signals were observed in NLBs, albeit the surrounding nucleoplasm was intensely labeled. The SN-type NLBs were unlabeled under all conditions used. Target RNA polymerase

Pre-incubation 1h

Microinjection

Post-incubation 30 min

Control NSN-oocytes (n=10) SN-oocytes (n=10) RNA polymerase II NSN-oocytes (n=12) SN-oocytes (n=10) RNA polymerase II, RNA polymerase III NSN-oocytes (n=8) SN-oocytes (n=10) RNA polymerase I, RNA polymerase II NSN-oocytes (n=12) RNA polymerase I, RNA polymerase II, RNA polymerase III NSN-oocytes (n=5)

No inhibitors

No inhibitors, 1±0.5 pl

No inhibitors

10 µg/ml AA

50 µg/ml AA, 1±0.5 pl

10 µg/ml AA

100 µg/ml AA

100 µg/ml AA, 5–10 pl

100 µg/ml AA

0.25 µg/ml actD 10 µg/ml AA

50 µg/ml AA, 1±0.5 pl

0.25 µg/ml actD 10 µg/ml AA

0.25 µg/ml act D, 100 µg/ml AA

100 µg/ml AA, 5–10 pl

0.25 µg/ml act D, 100 µg/ml AA

Table 2 Oligonucleotide probes used for detection of rRNAs and U3 snoRNA by FISH with indication of the rRNA probe positions along the mouse 47S pre-rRNA. Antisense probes

Sequence 5′ to 3′

5′ETS

Cy3ATCGGGAGAAACAAGCGAGATAGGAATGTCTTA Cy3-AAACCTCCGCGCCGGAACGCGACAGCTAGG FAM-ATCGAAAGTTGATAGGGCAGACGTTCGAAT Cy3-CAGACAACCGCAGGCGACCGACCGGCC FAM-GAGGGAACCAGCTACTAGATGGTTCGATTA FAM -TCCTCGTGGTTTCGGGTGCT

ITS1 18S ITS2 28S U3 snoRNA (1)a U3 snoRNA (2)a

Sense probes (control) 5′ETS ITS1 18S ITS2 28S a

FAM -AGAGCCGGCTTCACGCTCAGGAG

Position

602–634 6391–6420 4351–4380 7471–7500 9571–9600 65–84 101–123

Sequence 5′–3′ Cy3-TAAGACATTCCTATCTCGCTTGTTTCTCCCGAT Cy3-CCTAGCTGTCGCGTTCCGGCGCGGAGGTTT FAM-ATTCGAACGTCTGCCCTATCAACTTTCGAT Cy3-GGCCGGTGGGTCGCCTGCGGTTGTCTG FAM-TAATCGAACCATCTAGTAGCTGGTTCCCTC

According to Azum-Gelade et al. [1].

2.8. Confocal imaging 2.7. NIH/3T3 fibroblasts Mouse embryo NIH/3T3 fibroblasts were purchased from the Russian Cell Culture Collection (Institute of Cytology RAS, St.-Petersburg, Russia), were free of micoplasma and cultured in DMEM medium containing 10% calf fetal serum and antibiotics at 5% CO2 and 37 °C as recommended by the supplier. The cells were fixed with 70% ethanol for 15 min at room temperature and processed for immunolabeling and FISH as described above for oocytes. BrUTP labeling of nascent rRNA was performed essentially as described by Masson et al. [27].

Eight-bit digital images were acquired using a DuoScanMeta LSM510 laser-scanning microscope (Carl Zeiss, Germany) equipped with a Plan-Apochromat 63  /1.40 (numerical aperture) oil Ph3 objective. The image acquisition parameters were as follows: for green fluorescence: excitation at 488 nm and emission at 505– 550 nm, for red fluorescence: excitation at 561 nm, emission at 575 nm. Z-series of optical sections were collected through the 0.5 mm interval that yielded approximately 20 sections from an NLB of 10 mm in diameter.

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

4

3. Results 3.1. Localization of transcribed rRNA genes in GV oocytes Our pilot experiments designed to stain GV oocytes with a DNA-binding dye (DAPI, Hoechst 33258 or Hoechst 33342) following oocyte fixation with 70% ethanol showed that ethanol, in contrast to PFA, rather poorly preserved the chromatin configuration which made it impossible to ascertain the oocyte type. Therefore, we applied a strategy of identification of the NSN- and SN-type oocytes following pre-fixation staining of isolated oocytes with the vital chromatin dye Hoechst 33342 and by examining two groups of the oocytes separately. Control experiments were carried out in the NSN-type oocytes fixed with PFA under standard

conditions as described previously [37]. Fig. 1 demonstrates that irrespective of the number and size, all NLBs present in nuclei of PFA-fixed NSN-type oocytes are active in rDNA transcription. It is noteworthy, that Br-RNA signals are seen only on the NLB surface, while the NLB interior remains unlabeled. These observations are entirely consistent with the data which were obtained in single-NLB oocytes of the NSN-type and described thus far [5,10,27,33,44]. However, incorporation of BrUTP into NLBs became clearly visible when NSN-oocytes were fixed with 70% ethanol (Fig. 2a), despite their chromatin configuration (Fig. 2a′) and morphology (Fig. 2a‴) became less preserved than in PFA-fixed oocytes (Fig. 1, insets). In ethanol-fixed oocytes, NLBs can only be identified by immunolabeling with antibodies to a marker NLB protein, e.g., to

Fig. 1. Immunolocalization of Br-RNA in mouse GV oocytes of the NSN-type fixed with PFA and containing one (a), two (b) or four (c) nucleolus-like bodies (NLBs). Insets – phase contrast images of the NLBs. Labeling of nascent RNA with BrUTP was performed according a standard procedure [5,37]. Br-RNA clearly visible at the NLB surface is nascent rRNA (arrows). Bars, 10 μm.

Fig. 2. Immunolocalization of Br-RNA (a, b, red) and nucleolin (a″, b″, green) in GV mouse oocytes of the NSN-type (a–a‴) and the SN-type (b–b‴) fixed with 70% ethanol. Hoechst 33342 staining is shown in a′ and b′. RNA labeling with BrUTP was performed in the presence of 10 mg/ml α-amanitin as described in Section 2. BrUTP incorporation into the NLB mass is observed in the NSN-oocyte (a) and is absent from the SN-oocyte (b). NLBs can be identified by immunostaining for nucleolin (a″, b″) but are indistinguishable under phase contrast (a‴, b‴). Note, Br-RNA signals are not visible in the nucleoplasm. NLB – nucleolus-like body, arrows – BrUTP incorporation sites. Bars, 10 μm.

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

nucleolin (Fig. 2a″ and b″). In Fig. 3a–f, the topology of Br-RNA inside the NLB of the oocyte shown in Fig. 2 at a low magnification is demonstrated with a higher resolution and in a z-series of optical sections. One can see that inside the NLB, Br-RNA signals form extended rod-like structures (Fig. 3a–f), in which distinct beads can be resolved (Fig. 3g–i). Discrete Br-RNA sites are also well seen at the NLB surface (Fig. 3f and i, arrows). The signals were observed inside all NLBs present in multi-NLB nuclei excluding the smallest ones, which usually associated with one surface Br-RNA dot (Fig. 3g–i). Moreover, the pattern of BrUTP-labeling of the NLB mass was similar to that of nucleoli in NIH/3T3 fibroblasts (Fig. 7a): in both cases, nascent RNAs form discrete foci located inside the entities. In total, we microinjected with BrUTP and fixed with 70% ethanol 46 oocytes of the NSN-type. In all of them incorporation of the precursor into the NLB mass was observed. However, we did not detect the presence of nascent RNA in oocytes which, based on their vital staining with Hoechst 33342, belonged to the SN-type (Fig. 2b–b‴). In total, 37 SN-oocytes were investigated.

5

To examine whether Br-RNA signals observed in the NSN-type NLBs correspond to nascent ribosomal RNA, several control experiments were conducted (Table 1). Actinomycin D in a low doze (0.25 μg/ml) was added to culture medium to specifically inhibit RNA polymerase I activity [3], and 10 μg/ml α-amanitin was used to suppress RNA polymerase II transcription [5,27]. A higher concentration of α-amanitin (100 μg/ml) was used to distinguish between RNA polymerase I and RNA polymerase II/III activities ([19,41] and refs therein). The results showed that BrUTP labeling of NSN-type NLBs was completely blocked in the presence actimomycin D under the conditions favoring visualization of nascent rRNA with BrUTP in somatic cells [27,41], oocytes [5,44] and embryos [46]. Incorporation of BrUTP in the NSN-type NLBs also retained in the presence of 100 μg/ml α-amanitin that suppressed both RNA polymerase II and III activities. Overall, these results proved that incorporation of BrUTP in the NLB mass was blocked by inactivation of RNA polymerase I but it was insensitive to inhibition of RNA polymerases II and III transcription. Therefore, we concluded that Br-RNA signals observed inside the NSN-type NLBs

Fig. 3. Immunolocalization of Br-RNA (a–g, i, red) and nucleolin (f, h, i, green) in 70% ethanol-fixed oocytes of the NSN-type containing one NLB (a–f) and four NLBs (g–i). a–e – serial high-resolution confocal images of the NLB shown in Fig. 2a–a″ at a low magnification. The labeled rRNA is observed inside all large NLBs. In the smallest NLB present in the four-NLB nucleus Br-rRNA is seen as a single peripheral dot (i, asterisk). NLB – nucleolus-like body. Bars, 10 μm.

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

6

Fig. 4. Co-localization of the primary 47S pre-rRNA transcripts (a, a″, b, b″, red) with fibrillarin (a′, a″, green) or U3 snoRNA (b′, b″, green), and co-localization of U3 snoRNA (c, c″, green) with fibrillarin (c′, c″, red) in the NSN-type GV oocytes fixed with 70% ethanol. In the insets, outlined fragments of the merged images are shown at a high magnification. The 47S pre-rRNA was recognized with a Cy3-conjugated oligonucleotide probe to the short-lived 5′ETS end of the primary rRNA transcript, U3 snoRNA – with a mixture of the two FAM-conjugated oligonucleotide probes indicated in Table 1, and fibrillarin was immunolabeled with the specific antibodies. The 47S pre-rRNA and fibrillarin are located in a close proximity but do not overlap completely (a″, inset, fibrillarin-containing regions (solely green in color) are indicated by arrowheads). U3 snoRNA and fibrillarin sites coincide (c″, inset, some merged foci (orange in color) are indicated by arrowheads). NLB – nucleolus-like body; in (a, a′, b, b′, c, c′) arrows indicate the most well resolved foci. Bars, a–c″ – 10 μm, insets – 1 μm.

correspond to nascent ribosomal RNA. In the control oocytes, the nucleoplasm was intensely labeled but only weak and fuzzy BrRNA signals were observed inside NLBs. The pattern of the nucleoplasmic labeling was largely similar to that in PFA-fixed oocytes [5,10,27,33,39]. We did not observe incorporation of BrUTP in NLBs of the SNtype oocytes (Fig. 2b–b‴), albeit they were processed for microinjections, fixation and Br-RNA immunolabeling under the same experimental conditions as the NSN-type oocytes (Fig. 2a–a‴). 3.2. FISH analysis of rRNAs inside NLBs To examine whether NLBs contain the nascent 47S pre-rRNA, we hybridized ethanol-fixed GV oocytes with a probe to the leader short-lived 5′ETS segment of the 47S primary transcript that in mouse somatic cells has a half-life of 1–2 min [22,30]. Co-localization of 5′ETS signals with fibrillarin and U3 snoRNA is shown in

Fig. 4a–a″ and b–b″, correspondingly. In both cases, 5′ETS signals were arranged into rod-like structures comprising discrete foci which overlapped with fibrillarin and U3 snoRNA foci (Fig. 4a″ and b″). A very similar pattern of distribution of 5′ETS and fibrillarin signals was also observed in nucleoli of NIH/3T3 fibroblasts (Fig. 7b–b″). In addition, in the NSN-type NLBs, U3 snoRNA and fibrillarin sites well coincided (Fig. 4c–c″) as it occurs in active nucleoli (Fig. 7c–c″), where U3 snoRNA and fibrillarin form functional snoRNP complexes required for rRNA processing [15,36]. Moreover, like in nucleoli (Fig. 7d–d″), inside NLBs fibrillarin was located adjacently to the RNA polymerase I machinery traced with the serum to its specific transcription factor UBF (Fig. 5a–a″, inset). UBF foci in turn well coincided with BrU-labeled rRNA (Fig. 5b–b″, inset). Finally, we used ethanol-fixed oocytes to examine a putative presence of the rRNAs, which remained undetectable in the NLB mass of PFA-fixed NSN-oocytes even after exposure of the oocytes to

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

7

Fig. 5. Double immunolabeling of the NSN-type oocytes fixed with 70% ethanol for UBF (a, a″, insets, green) and fibrillarin (a′, a″, inset, red) or Br-RNA (b, b″, inset, red) and UBF (b′, b″, inset, green). In (b–b″), RNA labeling with BrUTP was performed in the presence of 100 mg/ml α-amanitin as described in Section 2. UBF forms numerous and small foci (a, b′), immersed to larger patches formed by fibrillarin (a′) and Br-RNA (b). Several coincided sites are indicated by arrows. The regions outlined in (a″, b″) are shown in the insets at a higher magnification. Bars, a–b″ – 10 μm, insets – 1 μm.

proteinase K [37]. In a full agreement with our previous observations, in the current work we also failed to detect any rRNA in the NLB mass of PFA-fixed NSN-oocytes (Fig. 6a and a′). However, prerRNAs (Fig. 6b and c), 18S rRNA (Fig. 6b′), 28S rRNA (Fig. 6c′) signals became well recognized with the same probes in NLBs of ethanolfixed NSN-oocytes. Interestingly, distribution of pre-rRNAs and 18S/ 28S rRNAs was “complementary”, so that the areas with more intense ITS1 and ITS2 signals corresponded to the zones with a less bright 18S/28S rRNA labeling (Fig. 6b′ and c′, insets, arrows). This makes the NLBs look differently from normal nucleoli, where prerRNAs and 18S/28S rRNAs were rather well co-localized (Fig. 7e–e″). Incomplete co-localization of unprocessed rRNAs (detected with the ITS1 and ITS2 probes) and the rRNAs detected with the probes targeting 18S and 28S rRNA supports the conclusion that in a part the latter signals correspond to processed 18S and 28S rRNAs. Particularly we would like to stress that neither the rRNAs or U3 snoRNA were detected in NLBs of the SN-type oocytes, as is illustrated for the probes targeting ITS2 and 18S rRNA in Fig. 6d and d′, correspondingly.

4. Discussion The main findings of the current work are evidences for the occurrence of rRNA synthesis and rRNA processing inside NLBs of fully-grown mammalian (mouse) oocytes of the NSN-type. The occurrence of rDNA transcription was demonstrated by two independent approaches: by microinjections of BrUTP as precursor of RNA synthesis and by FISH with the probe targeting the shortlived 5′ETS fragment of the 47S precursor rRNA (Figs. 2a, 3, 4a and b and 5b). However, transcribed rRNA genes were only detectable in the NSN-type NLBs fixed with a denaturing fixative, 70% ethanol. In the PFA-fixed oocytes, incorporation of BrUTP was regularly

seen only at the NLB surface (Fig. 1), that was entirely consistent with literature data obtained previously [5,27,33,44]. In our hands, rRNA synthesis was observed inside all NLBs excluding the smallest ones (about 1 mm in size; Fig. 3f and i) which were apparently formed by the smallest chromosomal nucleolar organizing regions. Br-rRNA sites were also clearly visible on the surface of the large NLBs (Fig. 3f and i, arrows) despite diminution of the NLB optical density in ethanol-fixed oocytes (Fig. 2a‴ and b‴) as compared to that in formalin-fixed oocytes (Fig. 1, insets). In the NLB mass, nascent rRNA was revealed either as continuous rod-like structures (Fig. 3a–f) or as rows of discrete dots fairy uniform in size (0.5–1.5 mm in diameter) (Fig. 3g–i). Different patterns of Br-rRNA distribution apparently resulted from a different efficiency of the rRNA labeling with BrUTP or from displacement of the labeled rRNA from the sites of its synthesis to other domains. Discrete rRNA synthesis foci were better resolved with the 5’ETS leader probe when approximately one hundred foci per NLB could be counted (Fig. 4a). Since the total number of rDNA repeats per haploid genome in the mouse is 100 [24] and GV oocytes are in prophase I of meiosis and therefore are tetraploid, one can assume that each oocyte may contain up to 400 transcribed rRNA genes. However, such a high number of distinct 5’ETS signals per NLB was never been observed. Therefore, we assumed that in active NLBs either not all rRNA genes are transcribed, or the active genes are located in a very close proximity and therefore are spatially unresolved. Both options are desribed in normal nucleoli, where single rDNA cistrons are not resolved by light microscopy and a half of the rRNA genes are silent [29,30]. Beside transcribed ribosomal genes, in active NLBs we also detected the specific RNA polymerase I transcription factor UBF [29] that co-localized with Br-rRNA (Fig. 5b″) as well as U3 snoRNA that coincided with fibrillarin sites (Fig. 4c″). U3 snoRNA and fibrillarin are known to comprise the box C/D snoRNPs involved in

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

8

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Fig. 6. Fluorescence in situ hybridization of NSN-oocytes (a–c′) and an SN-oocyte (d, d′) with the Cy3-conjugated oligonucleotide probes targeting the ITS1 (a, c, red), ITS2 (b, d, red), 18S rRNA (b′, d′) or 28S rRNA (a′, c′) regions of 47S pre-rRNA after fixation of the oocytes with PFA (a, a′) or 70% ethanol (b–d′). In the PFA-fixed NSN-oocyte that is shown for reference, pre-rRNA and 28S rRNA are only seen on the NLB surface (a, a′). In the ethanol-fixed oocytes (b–d′), the probes intensely decorate NLBs of the NSN-type oocytes (b–c′) but do not hybridize with the NLB mass of the SN-type oocyte (d, d′). In the insets, incomplete co-localization of the ITS1 and ITS2 signals with the 28S and 18S rRNA signals is shown at a high magnification and indicated by arrows. NLB – nucleolus-like body. Bars, a′–d′ – 10 μm, insets – 5 μm.

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

9

Fig. 7. Localization of Br-RNA (a), fibrillarin (a′, b′, c′, d′), 47S pre-rRNA detected with the probe targeting 5′ETS (b), U3 snoRNA (c), UBF (d), ITS1 (e) and 28S rRNA (e′) in nucleoli of NIH/3T3 mouse fibroblasts fixed with 70% ethanol and processed for immunolabeling or FISH as GV oocytes. In (a″, b″, c″, d″, e″) the merge images are shown. Dotted lines define the contours of nuclei. Bars, 10 μm.

excision of the 5’ETS leading end of the pre-rRNA transcripts and in rRNA methylation [17,42]. Moreover, U3 snoRNA/fibrillarin sites well coincide with 47S precursor rRNA (Fig. 4a″ and b″) and UBF (Fig. 5a″) foci. Thus, not only the presence but also the mutual distribution of transcribed ribosomal genes (5′ETS and Br-rRNA signals), the rDNA transcription (UBF) and the early rRNA processing (U3 snoRNA and fibrillarin) machineries is very similar to that in active nucleoli of various mammalian somatic cells [16] including NIH/3T3 fibroblasts (Fig. 7a″–d″). These observations are in a good accordance with the presence of unprocessed rRNAs recognized with the probes targeting ITS1, ITS2, 18S and 28S rRNA (Fig. 6b, b′, c and c′) as well as of the nucleolar proteins indispensable for ribosome production such as UBF, fibrillarin and nucleolin (e.g., Figs. 3h and 5a–a″). Previously, in the NSN-type

NLBs we also described such pre-ribosomal proteins as NPM1, nucleolin and RPL26 [37]. Altogether, the presence and general topology of transcribed rRNA genes and the key rRNA processing players strongly evidence in support of a capability of the NSNtype NLBs to transcribe rDNA, to process rRNA and to produce preribosomes similar to normal nucleoli. An essential difference between NLBs and somatic nucleoli is a restricted accessibility of the NLB internal molecular constituents to antibodies and FISH probes in oocytes fixed with formalin (PFA). Most likely, this is caused by an extraordinary high concentration of proteins in the NLB mass (1.6 ng/NLB; [13]). In PFA-fixed oocytes, NLB proteins can readily form additional intra- and intermolecular bonds making the target molecules inaccessible to specific probes. In contrast to formalin, 70% ethanol does not form

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

10

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎

cross-links, facilitates extraction of water-soluble proteins [11], causes unfolding of rRNA molecules [35] and thereby facilitates penetration of the probes to the NLB interior. Another difference between NLBs and normal nucleoli is the absence of tripartite organization that is an essential morphological feature of active somatic nucleoli [16]. Indeed, NLBs lack the typical fibrillar centers, the dense fibrillar component, and the granular compartment. Nevertheless, in the NSN-type NLBs, territories formed by particles resembling pre-ribosomes in size (
20 nm) have been described by electron microscopy [7,8,34]. These areas may correspond to 18S and 28S rRNA-containing clumps observed presently (Fig. 6b′ and c′). A severe diminution of fibrillar centers is known to accompany activation of rDNA transcription [20,45] and a similar event may occur in the NSN-type NLBs. It is also probable that numerous proteins, which comprise the NLB mass, mask its tripartite organization. Overall, the results of our work support the conclusion that NLBs of the NSN-type GV mammalian oocytes are entities that are capable to transcribe rDNA, to process rRNA and to assemble preribosomes like normal nucleoli. In this sense, the NSN-type NLBs remarkably differ from the SN-type NLBs, which do not contain active rRNA genes and rRNAs. The latter means that in a process of transition of the NSN-oocytes to the SN-oocytes, a capability of NLBs to produce pre-ribosomes switches off and NLBs become impoverished for rRNA despite they yet contain nucleolar proteins [37]. One can assume that in the SN-type oocytes, NLBs serve as reservoirs to store and protect nucleolar proteins from degradation. In fertilized embryos, these proteins can be utilized to form novel nucleoli, as it has been suggested [26]. Indeed, at the MII stage, when NLBs are dissolved and their content is released to the cytoplasm, the level of such nucleolar proteins as RPA116, UBF, fibrillarin and nucleolin noticeably diminishes as compared to their content in GV oocytes which contain NLBs [14,44].

Acknowledgments The study was funded by the Russian Scientific Foundation (Grant no. 14-14-00856). The authors are grateful to Dr. Anastasia Mironova (Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry RAS, Moscow, Russia) for her help with fluorescence in situ hybridization with the 5′ETS probe and to Dr. Vladimir Mikoyan (the Moscow CRDF Global office) for critical reading of the manuscript.

References [1] M. Azum-Gélade, J. Noaillac-Depeyre, M. Caizergues-Ferrer, N. Gas, Cell cycle redistribution of U3 snRNA and fibrillarin, J. Cell Sci. 107 (1994) 463–475. [2] M. Bellone, M. Zuccotti, C.A. Redi, S. Garagna, The position of the germinal vesicle and the chromatin organization together provide a marker of the developmental competence of mouse antral oocytes, Reproduction 138 (2009) 639–643. [3] O. Bensaude, Inhibiting eukaryotic transcription: which compound to choose? How to evaluate its activity? Transcription 2 (2011) 103–108. [4] C. Bouniol, E. Nguyen, P. Debey, Endogenous transcription occurs at the 1-cell stage in the mouse embryo, Exp. Cell Res. 218 (1995) 57–62. [5] C. Bouniol-Baly, L. Hamraoui, J. Guibert, N. Beaujean, M.S. Szöllösi, P. Debey, Differential transcriptional activity associated to chromatin configuration in fully-grown GV mouse oocytes, Biol. Reprod. 60 (1999) 580–587. [6] A. Bonnet-Garnier, P. Feuerstein, M. Chebrout, R. Fleurot, H.U. Jan, P. Debey, N. Beaujean, Genome organization and epigenetic marks in mouse germinal vesicle oocytes, Int. J. Dev. Biol. 56 (2012) 877–887. [7] L.A. Chouinard, A light- and electron-microscopic study of the nucleolus during growth of the oocyte in the prepubertal mouse, J. Cell Sci. 9 (1971) 637–663. [8] P. Debey, M.S. Szöllösi, D. Szöllösi, D. Vautier, A. Girousse, D. Besombes, Competent mouse oocytes isolated from antral follicles exhibit different chromatin organization and follow different maturation dynamics, Mol. Reprod. Dev. 36 (1993) 59–74. [9] R. De La Fuente, Chromatin modifications in the germinal vesicle (GV) of mammalian oocytes, Dev. Biol. 292 (2006) 1–12.

[10] R. De La Fuente, J.J. Eppig, Transcriptional activity of the mouse oocyte genome: companion granulosa cells modulate transcription and chromatin remodeling, Dev. Biol. 229 (2001) 224–236. [11] I. Eltoum, J. Fredenburgh, R.B. Myers, W.E. Grizzle, Introduction to the theory and practice of fixation of tissues, J. Histotechnol. 24 (2001) 173–190. [12] M. Flemr, P. Svoboda, Ribonucleoprotein localization in mouse oocytes, Methods 53 (2011) 136–141. [13] H. Fulka, S. Martinkova, H. Kyogoku, A. Langerova, J. Fulka, Production of giant mouse oocyte nucleoli and assessment of their protein content, J. Reprod. Dev. 58 (2012) 371–376. [14] H. Fulka, A. Langerova, The maternal nucleolus plays a key role in centromere satellite maintenance during the oocyte to embryo transition, Development 141 (2014) 1694–1704. [15] S. Granneman, J. Vogelzangs, R. Lührmann, W. Venrooij, G.J.M. Pruijn, N. J. Watkins, Role of pre-rRNA base pairing and 80S complex formation in subnucleolar localization of the U3 snoRNP, Mol. Cell Biol. 24 (2004) 8600–8610. [16] D. Hernandez-Verdun, P. Roussel, M. Thiry, V. Sirri, D.L.J. Lafontaine, The nucleolus: structure/function relationship in RNA metabolism, Wiley Interdiscip. Rev. RNA 1 (2010) 415–431. [17] R. Herrera-Esparza, L. Kruse, M. von Essen, L. Campos, O. Barbosa, J.J. Bollain, I. Badillo, E. Avalos-Díaz, U3 snoRNP associates with fibrillarin a component of the scleroderma clumpy nucleolar domain, Arch. Dermatol. Res. 294 (2002) 310–317. [18] D. Hopwood, Fixation and fixatives, in: J. Bancroft, A. Stevens (Eds.), Theory and Practice of Histological Techniques, Churchill Livingstone, New York, 1996. [19] D.A. Jackson, A.B. Hassan, R.J. Errington, P.R. Cook, Visualization of focal sites of transcription within human nuclei, EMBO J. 12 (1993) 1059–1065. [20] E.G. Jordan, J.H. McGovern, The quantitative relationship of the fibrillar centres and other nucleolar components to changes in growth conditions, serum deprivation and low doses of actinomycin D in cultured diploid human fibroblasts (strain MRC-5), J. Cell Sci. 52 (1981) 373–389. [21] V. Kopecny, M. Biggiogera, J. Laurincik, J. Pivko, P. Grafenau, T.E. Martin, X. D. Fu, S. Fakan, Fine structural cytochemical and immunocytochemical analysis of nucleic acids and ribonucleoprotein distribution in nuclei of pig oocytes and early preimplantation embryos, Chromosoma 104 (1996) 561–574. [22] I.B. Lazdins, M. Delannoy, B. Sollner-Webb, Analysis of nucleolar transcription and processing domains and pre-rRNA movements by in situ hybridization, Chromosoma 105 (1997) 481–495. [23] B. Lefèvre, The nucleolus of the maternal gamete is essential for life, Bioessays 30 (2008) 613–616. [24] E.O. Long, I.B. Dawid, Repeated genes in eukaryotes, Annu. Rev. Biochem. 49 (1980) 727–764. [25] A.M. Luciano, F. Franciosi, C. Dieci, V. Lodde, Changes in large-scale chromatin structure and function during oogenesis: a journey in company with follicular cells, Anim. Reprod. Sci. 149 (2014) 3–10. [26] P. Maddox-Hyttel, B. Bjerregaard, J. Laurincik, Meiosis and embryo technology: renaissance of the nucleolus, Reprod. Fertil. Dev. 17 (2005) 3–14. [27] C. Masson, C. Bouniol, N. Fomproix, M.S. Szöllösi, P. Debey, D. HernandezVerdun, Conditions favoring RNA polymerase I transcription in permeabilized cells, Exp. Cell Res. 226 (1996) 114–125. [28] G.P. Moore, The RNA polymerase activity of the preimplantation mouse embryo, J. Embryol. Exp. Morphol. 34 (1975) 291–298. [29] B. McStay, I. Grummt, The epigenetics of rRNA genes: from molecular to chromosome biology, Annu. Rev. Cell Dev. Biol. 24 (2008) 131–157. [30] S.-T. Mullineux, D.L.J. Lafontaine, Mapping the cleavage sites on mammalian pre-rRNAs: Where do we stand? Biochimie 94 (2012) 1521–1532. [31] S. Ogushi, C. Palmieri, H. Fulka, M. Saitou, T. Miyano, J. Fulka, The maternal nucleolus is essential for early embryonic development in mammals, Science 319 (2008) 613–616. [32] V.N. Parfenov, G. Pochukalina, L. Dudina, D. Kostyuchek, M. Gruzova, Human antral follicles: oocyte nucleus and the karyosphere formation (electron microscopic and autoradiographic data), Gamete Res. 22 (1989) 219–231. [33] A. Pesty, F. Miyara, P. Debey, B. Lefevre, C. Poirot, Multiparameter assessment of mouse oogenesis during follicular growth in vitro, Mol. Hum. Reprod. 13 (2007) 3–9. [34] G. Pochukalina, V.N. Parfenov, Nucleolus transformation in oocytes of mouse antral follicles: distribution of coilin and components of RNA-polymerase I complex, Cell Tissue Biol. 2 (2008) 522–530. [35] P. Prentø, Staining of macromolecules: possible mechanisms and examples, Biotech. Histochem. 84 (2009) 139–158. [36] S.L. Reichow, T. Hamma, A.R. Ferré-D'Amaré, G. Varani, The structure and function of small nucleolar ribonucleoproteins, Nucleic Acids Res. 35 (2007) 1452–1464. [37] K.V. Shishova, E.A. Lavrentyeva, J.W. Dobrucki, O.V. Zatsepina, Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA, Dev. Biol. 397 (2015) 267–281. [38] J.H. Tan, H.L. Wang, X.S. Sun, Y. Liu, H.S. Sui, J. Zhang, Chromatin configurations in the germinal vesicle of mammalian oocytes, Mol. Hum. Reprod. 15 (2009) 1–9. [39] M. Waksmundzka, P. Debey, Electric field-mediated BrUTP uptake by mouse oocytes, eggs, and embryos, Mol. Reprod. Dev. 58 (2001) 173–179. [40] M. Wang, L. Anikin, D.G. Pestov, Two orthogonal cleavages separate subunit RNAs in mouse ribosome biogenesis, Nucleic Acids Res. 42 (2014) 11180–11191.

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i

K.V. Shishova et al. / Experimental Cell Research ∎ (∎∎∎∎) ∎∎∎–∎∎∎ [41] D.G. Wansink, W. Schul, I. van der Kraan, B. van Steensel, R. van Driel, L. de Jong, Fluorescent labeling of nascent RNA reveals transcription by RNA polymerase II in domains scattered throughout the nucleus, J. Cell Biol. 122 (1993) 283–293. [42] N. Watkins, M. Bohnsack, The box C/D and H/ACA snoRNPs: key players in the modification, processing and the dynamic folding of ribosomal RNA, Wiley Interdiscip. Rev. RNA 3 (2012) 397–414. [43] O.V. Zatsepina, R. Voit, I. Grummt, H. Spring, M.V. Semenov, M. F. Trendelenburg, The RNA polymerase I-specific transcription initiation factor UBF is associated with transcriptionally active and inactive ribosomal genes, Chromosoma 102 (1993) 599–611. [44] O.V. Zatsepina, C. Bouniol-Baly, C. Amirand, P. Debey, Functional and molecular reorganization of the nucleolar apparatus in maturing mouse oocytes, Dev. Biol. 223 (2000) 354–370.

11

[45] O.V. Zatsepina, P.V. Chelidze, Y.S. Chentsov, Changes in the number and volume of fibrillar centres with the inactivation of nucleoli at erythropoiesis, J. Cell Sci. 91 (1988) 439–448. [46] O. Zatsepina, C. Baly, M. Chebrout, P. Debey, The step-wise assembly of a functional nucleolus in preimplantation mouse embryos involves the Cajal (Coiled) body, Dev. Biol. 253 (2003) 66–83. [47] M. Zuccotti, S. Garagna, V. Merico, M. Monti, C.A. Redi, Chromatin organization and nuclear architecture in growing mouse oocytes, Mol. Cell Endocrinol. 234 (2005) 11–17.

Please cite this article as: K.V. Shishova, et al., High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like..., Exp Cell Res (2015), http://dx.doi.org/10.1016/j.yexcr.2015.07.024i