Hippocampal neuronal apoptosis in type 1 diabetes

Brain Research 946 (2002) 221–231 www.elsevier.com / locate / bres

Research report

Hippocampal neuronal apoptosis in type 1 diabetes Zhen-Guo Li a,d , Weixian Zhang a,d , George Grunberger b,d , Anders A.F. Sima a,c,d , * a

Department of Pathology, Wayne State University School of Medicine, Detroit, MI 48201, USA Department of Internal Medicine, Wayne State University School of Medicine, Detroit, MI 48201, USA c Department of Neurology, Wayne State University School of Medicine, Detroit, MI 48201, USA d Morris J. Hood, Jr. Comprehensive Diabetes Center, Wayne State University School of Medicine, Detroit, MI 48201, USA b

Accepted 9 April 2002

Abstract Duration-related cognitive impairment is an increasingly recognized complication of type 1 diabetes. To explore potential underlying mechanisms, we examined hippocampal abnormalities in the spontaneously type 1 diabetic BB / W rat. As a functional assay of cognition, the Morris water maze test showed significantly prolonged latencies in 8-month diabetic rats not present at 2 months of diabetes. These abnormalities were associated with DNA fragmentation, positive TUNEL staining, elevated Bax / Bcl-x L ratio, increased caspase 3 activities and decreased neuronal densities in diabetic hippocampi. These changes were not caused by hypoglycemic episodes or reduced weight in diabetic animals. To explore potential mechanisms responsible for the apoptosis, we examined the expression of the IGF system. Western blotting and in situ hybridization revealed significant reductions in the expression of IGF-I, IGF-II, IGF-IR and IR preceding (2 months) and accompanying (8 months) the functional cognitive impairments and the apoptotic neuronal loss in hippocampus. These data suggest that a duration-related apoptosis-induced neuronal loss occurs in type 1 diabetes associated with cognitive impairment. The data also suggest that this is at least in part related to impaired insulin and / or IGF activities.  2002 Elsevier Science B.V. All rights reserved. Theme: Neural basis of behavior Topic: Cognition Keywords: Apoptosis; Hippocampus

1. Introduction Cognitive impairments are more common in the diabetic than in the nondiabetic population [6,23]. This is in part due to a higher incidence of cerebrovascular disease, potentially causing multi-infarct dementia [2,39], and to repeated episodes of hypoglycemia particularly in the type 1 diabetic population [1]. Moreover, the incidence of Alzheimer’s disease is almost twice that in a nondiabetic population [27]. The relationship between diabetes and Alzheimer’s disease is not known. In recent years, clinical and experimental studies suggest that hyperglycemia and / or insulin-deficiency itself may be *Corresponding author. Department of Pathology, Wayne State University, H.G. Scott Hall, Rm 9275, 540 East Canfield Ave., Detroit, MI 48201, USA. Tel.: 11-313-577-1150; fax: 11-313-993-6839. E-mail address: [email protected] (A.A.F. Sima).

responsible for impaired cognitive function in type 1 diabetes. Kramer et al. [18] reported in type 1 diabetic patients a duration-dependent decline in cognitive function that was unrelated to hypoglycemic episodes. Similarly, Schoenle et al. [31] demonstrated impaired intellectual and cognitive development in type 1 diabetic children, who had not experienced hypoglycemic episodes. These impairments correlated with diagnosis at young age, male sex and metabolic status at time of diagnosis. Apoptosis occurs in diabetes as well as in its chronic complications. It has been reported in pancreatic beta-cells in type 1 diabetes [11,42], in diabetic retinopathy [4] and nephropathy [48]. However, apoptosis has not previously been demonstrated in the diabetic brain, although it has been implicated in several neurodegenerative disorders like Alzheimer’s disease, Parkinson’s disease, Huntington’s disease and in amyotrophic lateral sclerosis [38]. It is known that IGF-I mediates an anti-apoptotic effect

0006-8993 / 02 / $ – see front matter  2002 Elsevier Science B.V. All rights reserved. PII: S0006-8993( 02 )02887-1

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

222

in a variety of neuronal systems [30,35], and recent studies suggest that insulin itself exerts anti-apoptotic functions [5,19]. Since several aspects of the IGF-system [20] are perturbed in the diabetic state, we examined as to whether apoptosis occurs in the CNS in type 1 diabetes. We investigated acutely (2-month) and chronically (8-month) spontaneously diabetic BB / W rats [25,32,33]. They were tested functionally with respect to spatial learning and memory, using the Morris water maze test [26]. Since the hippocampus plays a central role in declarative memory [17], we examined whether hippocampal apoptosis occurs and if molecular aberrations characteristic of diabetes may underlie an apoptotic phenomenon. In this study, we provide evidence for a duration-dependent neuronal apoptosis in the hippocampus of the type 1 diabetic BB / W-rat that is preceded and accompanied by impaired IGF and insulin activities.

Blood glucose levels were measured weekly using blood glucose test strips (Bayer, Mishawaka, IN, USA) [34]. Diabetic and age-and sex-matched BB / W rats were subjected to Morris water maze tests [26] prior to sacrifice at 2 and 8 months of diabetes. At time of sacrifice, animals were anesthetized with isoflurane. Blood was collected for measurement of serum insulin concentration before the animals were decapitated. The skull was then opened along the midline and the brain was removed and placed on an ice-cooled cutting board. The meninges were carefully removed and hippocampus, frontal cortex, diencephalon and cerebellum were dissected from one hemisphere, snap frozen in liquid nitrogen and stored at 270 8C for extraction of DNA, RNA and protein. For TUNEL staining, in situ hybridization and neuronal counts, the contralateral hemisphere was immediately fixed in PBS buffered 4% paraformaldehyde, paraffin embedded, and sections (6 mm thick) were prepared using standard histology procedures.

2. Materials and methods

2.2. Water maze

2.1. Animals

Water maze testing was performed according to the method described by Mooris [26]. At 2 and 8 months, six rats per group were tested. In addition, six control rats weight-matched to 8-month diabetic rats were tested. The rats were placed in a large circular pool of water (2.04 m in diameter30.40 m in height) in which a platform was hidden 3 cm beneath the surface of the water and located 40 cm away to the edge of the pool. The water temperature was kept constant at 28 8C. The pool area was divided into four quadrants (Q1–Q4) according to four arbitrary points along the pool circumference. On 2 consecutive days each week for 2 weeks, rats were given three acquisition trials per day. In each trial, the rats were placed close to and facing the wall of the pool in the different quadrants (Q1–Q4). They were trained to locate the platform and allowed to stay on it for 30 s before being removed from the water for the next trial. Three days after the final day of training, the rats were put into the water, and the latencies were measured in seconds for reaching the platform from

Prediabetic (n534) and nondiabetes prone (n523) male BB / W rats were obtained from Biomedical Research Models (Rutland, MA, USA). The animals were cared for in accordance with institutional and NIH guidelines (publication no. 85-23, 1995). Urine volume and glucose levels were measured daily to ascertain the onset of diabetes. Following detection at 7264 days of age, all diabetic rats were treated with daily-titrated doses (0.5–3.0 I.U.) of protamine zinc insulin (Blue Ridge Pharmaceuticals, Greensboro, NC, USA) to maintain blood-glucose levels at approximately 20 mmol / l and to prevent ketoacidosis from occurring. To ensure that this regiment was not causing periods of hypoglycemia during the 24-h cycle, blood glucose levels were measured every 2 h in six diabetic BB / W rats over four consecutive 24 h cycles. Body weight, motor nerve conduction velocity (NCV) and insulin serum levels were measured prior to sacrifice.

Table 1 Clinical data from 2- and 8-month diabetic BB / W rats and age- and sex-matched control rats; data are expressed as means6S.D. Body weight (g)

Blood glucose (mmol / l)

2 month control (n510)

369624 (n516)

4.960.2

2 month diabetic (n510)

334619

20.162.1*

8 month control (n57)

492631

5.060.2

8 month diabetic (n57)

357629*

20.762.4*

*, P,0.001 vs. age-matched control rats.

Insulin dose (I.U. / day)

Serum insulin concentration (ng / ml)

]

]

2.860.5

] 2.360.4

]

NCV (m / s) 59.362.2 47.264.5*

2.960.2

62.762.6

0.360.1*

46.165.1*

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

each of the four starting points. Any rat that failed to find the platform within 100 s was lifted out of the water and scored as 100. Increased latencies reflect hippocampal damage resulting from impairments in remembering recent experiences in a familiar environment [37].

2.3. Nerve conduction velocity measurement NCV was measured as previously reported [34]. Animals were anesthetized with ethyl ether and motor NCV was determined in the sciatic-tibial nerve conducting system. Hindlimb skin temperature was monitored by a thermister and maintained between 36 and 38 8C by radiant heat and a warming pad. The left sciatic-tibial nerves were stimulated proximally at the sciatic notch and distally at the ankle via bipolar electrodes with supramaximal stimuli (8 V) at 2 Hz with a pulse width of 100 ms delivered by a Cadwell 5200 A Electromyographer (Cadwell Labs., Kennewick, WA, USA). The latencies of the compound muscle action potentials were recorded from the first interosseous muscle of the hind paw and measured from the stimulus artifact to the onset of the negative M-wave deflection. NCV was calculated by subtracting the distal from the proximal latency measured in milliseconds and the result was divided into the distance between the stimulating and recording electrode measured in millimeters, yielding a value for NCV in m / s. Each recording represented the averaging of 8 or 16 measurements. NCVs were measured at onset of diabetes and prior to sacrifice at 2 and 8 months of diabetes.

2.4. Serum insulin concentration measurement Serum insulin concentration was analyzed using a RIA kit purchased from Linco Research (St. Charles, MO, USA).

223

2.5. Northern blot hybridization Total RNA was isolated by the acid guanidinium thiocynate–phenol–chloroform method [12]. The quantity and purity of RNA were measured spectrophotometricly by absorbance at 260 and 280 nm and the integrity of RNA was further examined by 1.0% agarose gel electrophoresis. Total RNA (20 mg), pooled from three individual animals, was fractionated with 2.2 M formaldehyde, 1% agarose gel electrophoresis in 13 MOPS buffer and transferred onto Nytran membrane (Schleicher and Schuell, Keene, NH, USA). The RNA was immobilized by exposing the blots to UV light at 120 mJ / cm 2 . The immobilized RNA was prehybridized with 50% formamide, 53 SSC, 0.1% SDS, 53 Denhardt’s solution and salmon sperm DNA 100 mg / ml for 4 h at 42 8C, followed by hybridization with a 32 P-labelled probe (10 6 cpm / cm 2 ) overnight at 42 8C. The blots were washed with 23 SSC, 0.1% SDS at 37 8C for 30 min, followed twice with 0.13 SSC, 0.1% SDS at 55 8C for 30 min, and exposed to Kodak XAR film (Eastman Kodak, Rochester, NY, USA). The Northern blots were quantitated using Scion IMAGE analysis software (Scion, Fredrick, MD, USA). The radiolabeled probes were prepared using a PCRbased method [24]. Briefly, the PCR reaction contained 10 ng of supercoiled plasmid containing target cDNA, 5 ml of a 32 P-dCTP (3000 Ci / mmol, ICN Biochemicals, Irvine, CA, USA), 20 mM Tris–HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl 2 , 20 mM each of dATP, dGTP and dTTP, 0.25 mM of each primer, and 2.5 units of Taq polymerase in a total volume of 20 ml. After an initial denaturation at 94 8C for 5 min, 30 cycles of 94 8C for 1 min, 54 8C for 1 min and 72 8C for 2 min were performed. Unincorporated radioisotopes, nucleotides and PCR primers were removed by using chroma spin columns-10 (Clontech, Palo Alto, CA, USA).

Fig. 1. Twenty-four hour blood glucose profile representing the mean6S.D. of six diabetic animals followed over four consecutive 24-h cycles. At no time-point during the 24-h did diabetic rats reach hypoglycemic or even euglycemic levels. Insulin is administered at 3:00 p.m. and the dark cycle lasts from 6:00 p.m. to 6:00 a.m.

224

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

Cloned rat IGF-II cDNA in pUC9 was a gift from Dr. Douglas Ishii (Colorado State University, Fort Collins, CO, USA). Clones containing IGF-I and IGF-IR in pGEM were gifts from Dr. Derek LeRoith (NIH, Bethesda, MD, USA). Clones containing IR cDNA was constructed as previously described [40]. Manipulation of clones and preparation of supercoiled plasmids were achieved following standard molecular biology techniques [3]. The primer sets for PCR labeling were one set of SP6-T7 promoter primers 59-GATTTAGGTGACACTATAG and 59TAATACGACTCACTATAGGG for the pGEM vector and another set of 59-TCTCATCTCTTTGGCCTTCG and 59-CTGAACGCTTCGAGCTCTTT for the pUC9 vector.

2.6. Ligation-mediated PCR assay Genomic DNA was extracted according to Ausubel et al. [3]. Nucleosomal DNA ladder was detected by the LMPCR method [36] following the manufacturer’s instruction (Clontech). The resulting nucleosomal ladders were visualized by a 1.4% agarose gel electrophoresis. For amplification of internal control, we used a primer set for human GAPDH cDNA: 59-ACCACAGTCCATGCCATCAC and 59-TCCACCACCCTGTTGCTGTA (Clontech). Vender amplified genomic DNA with these primers yielded a band of 452 bp.

2.7. Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling assay We used NeuroTACS II kits (Trevigen, Gaithersburg, MD, USA) to perform the TUNEL assay on paraformaldehyde-fixed paraffin sections from four animals at each time point as described above. Briefly, paraffin sections were deparaffinized with xylene, rehydrated in graded ethanol and washed with PBS before incubation with NeuroPore for 15–30 min. The endogenous hydrogenase was quenched by incubating the slides in 3% hydrogen peroxide for 5 min. After washing with PBS, the sections were incubated with TdT labeling buffer containing dNTP mix, Mn 21 and TdT enzyme for 60 min at 37 8C to incorporate biotinylated nucleotides at the sites of DNA breaks. The reaction was stopped with 0.1 M EDTA (pH 8.0), and the incorporated biotinylated nucleotides were incubated with (strep)avidin–HPR. DAB (3,39diamonobenzidine tetrahydrochloride) and hydrogen peroxide were used as chromogen to indicate DNA breaks. The sections were counterstained with hematoxylin and observed microscopically.

2.8. Caspase 3 activity The method described by Gillardon et al. [14] was used with modifications. Hippocampi were homogenized in 500 ml of lysis buffer containing 20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100,

1 mM PMSF, 1 mg / ml pepstatin, 1 mg / ml leupeptin and 1 mg / ml aprotinin. Homogenates were centrifuged at 15 000 rpm for 30 min at 4 8C. The supernatants were aliquoted and stored at270 8C. Protein contents were measured using BCA protein assay reagents (Pierce, Rockford, IL, USA). Caspase catalytic activities were measured on synthetic tetrapeptide fluorogenic substrate Ac-DEVDAMC (BD Biosciences, San Diego, CA, USA). For each reaction, tissue extract (300 mg protein) was added to reaction buffer (20 mM HEPES, pH 7.5, 10% glycerol, 2 mM DTT) with a final volume of 500 ml. The enzymatic reaction was started by the addition of 20 mM substrate in the presence / absence of caspase-3 inhibitor, Ac-DEVDCHO (100 nM as suggested by the manufacturer, BD Sciences) and incubated at 37 8C. Measurement of substrate cleavage was monitored at various time points (15 min to 3 h) in a Spectra Max Gemini spectrophotometer (Molecular Devices, Sunnyvale, CA, USA) at an excitation wavelength of 380 nm and an emission wavelength of 460 nm. Controls were assayed in parallel, including extract, buffer, substrate and inhibitor alone. The inhibitable caspase 3 activities in control and diabetic hippocampus were compared.

2.9. In situ hybridization In situ hybridization was performed according to Yamanouchi et al. [46] with modifications. Briefly, deparaffinized sections were prepared as described above, rinsed in graded ethanol and incubated with 1% proteinase K in 5 mM EDTA and 10 mM Tris–HCl, pH 8.0 at 37 8C for 30 min. They were prehybridized in 50% deionized formamide and 13 SSC at 37 8C for 1 h and hybridized overnight at 60 8C with digoxigen-labelled IGF-IR or IR riboprobe in a solution containing 23 SSC, 50% deionized formamide, 10% dextran sulfate, 13 Denhardt’s solution, 0.5 mg / ml tRNA, and 10 mM dithiothreitol. After incubaTable 2 Morris water maze latencies in s in diabetic and control rats; data are expressed as means6S.D. Animals

Latencies (s) Q1

Q2

Q3

Q4

2-month BB / W control (n56) 2-month BB / W diabetic (n56) 8-month BB / W control (n56) 8-month BB / W diabetic (n56) (357629 g) Weight-matched controls (n56) (349623 g)

70.7612.8

39.5616.3

22.266.5

16.865.3

75.0612.5

42.5612.6

24.865.8

18.364.5

73.5617.4

44.2616.5

24.0611.6

17.067.1

90.566.4*

61.569.0*

42.8611.3*

33.268.2**

71.7613.9

43.0610.9

25.767.8

18.764.8

*, P,0.05 vs. the age- and weight-matched controls. **, P,0.01 vs. the age- and weight-matched controls.

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

tion, the slides were treated with RNase A (20 mg / ml in 500 mM NaCl, 10 mM Tris–HCl, pH 7.4) at room temperature for 30 min, washed twice with 23 SSC at room temperature for 15 min each, washed once in 0.53 SSC at 45 8C for 30 min and then incubated at room temperature with 1:500 anti-DIG antibody conjugated with alkaline phosphatase (Roche Molecular Systems. Branchburg, NJ, USA) for 1 h. Nitroblue tetrazolium chloride was used as chromogen to visualize hybridized signals.

225

2.12. Statistical methods All data are expressed as mean6S.D. Comparisons were made using unpaired t-test.

3. Results

3.1. Clinical data 2.10. Immunoblotting Immunoblotting was performed as previously described [21]. Protein lysates (40 mg per lane) prepared individually from three hippocampi from each group were resolved by SDS–PAGE under reducing conditions, and transferred onto 0.45-mm polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The rabbit antiBax, anti-Bcl-xL, anti-IGF-IR, anti-IR and anti-IGF-II antibodies, goat anti-IGF-I antibody and HRP-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The enhanced chemiluminescence (ECL) detection system was obtained from Amersham (Piscataway, NJ, USA) and exposed to Kodak X-OMAT blue film (Eastman Kodak). The immunoblots were quantitated using Scion IMAGE analysis software.

2.11. Neuronal density count Hemotoxylin–eosin stained paraffin sections were prepared from four individual animals at each time point. Images of serial sections, 50 mm apart and 6 mm thick, were captured and analyzed using an Olympus BH-2 microscope and IMAGE-PRO PLUS 3.0 image analysis software (Media Cybemetics, Silver Spring, MD, USA). Only neurons that contained visible nuclei were counted and their number was expressed per area unit. Regions of hippocampus (CA 1 , CA 2 , CA 3 and CA 4 ) were identified according to Paxinos and Watson [28] (Fig. 2).

Diabetic and age- and sex-matched nondiabetic control rats were examined at 2 and 8 months’ duration of diabetes. In 2-month diabetic rats, blood glucose levels were increased (P,0.001) and NCVs were decreased (P, 0.001) (Table 1). Body weights, insulin serum contents and NCVs were significantly reduced in 8-month diabetic rats (P,0.001), whereas blood glucose levels were elevated (P,0.001) (Table 1). To ascertain that daily insulin treatment did not cause periods of hypoglycemia during the 24-h cycle, the blood glucose levels were monitored every 2 h. As shown in Fig. 1, blood glucose levels fluctuated between 15 and 22 mmol / l, which are well above euglycemic levels.

3.2. Cognitive deficits in diabetic BB /W rats The Morris water maze analysis was performed in diabetic BB / W rats and nondiabetic control rats at both 2 and 8 months of diabetes. As shown in Table 2, the latencies to reach the platform from all four quadrants were not significantly different in 2-month diabetic rats from those in age-matched control rats. However, in 8month diabetic rats the latencies from all four quadrants were significantly prolonged vs. age- and sex-matched control rats. When 8-month diabetic rats were compared to weight-matched control rats, the latencies were still significantly prolonged in diabetic BB / W rats. These results indicate progressive learning and memory deficiencies in diabetic animals that are unrelated to body weight.

Table 3 Quantitative measures of positive TUNEL neurons expressed as percent apoptotic cells and neuronal densities in the various hippocampal areas (CA 1 –CA 4 ; see Fig. 2A) in 2- and 8-month diabetic BB / W rats and age- and sex-matched control rats; data are expressed as means6S.D. CA 1

CA 2

CA 3

CA 4

Duration of diabetes (months)

2

8

2

8

2

8

2

8

Percent apoptotic cells (%) Diabetic (n54) Control (n54)

0 0

3.961.0 0

0 0

0.660.5 0

0 0

0 0

0 0

0 0

Neuronal density (no. / mm 2 ) Diabetic (n54) Control (n54)

27746339 29086123

18136182*** ‡‡‡ 28756278

23736271 26056174

17946377* ‡‡ 23616495

20476157 2210698

17346444 20496122

15906166 18866212

13226267 ‡‡ 16506254

*, P,0.05; ***, P,0.001 vs. age-matched controls. ‡‡, P,0.01; ‡‡‡, P,0.001 vs. weight-matched controls (2 months).

226

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

Fig. 2. (A) Various sectors CA 1 –CA 4 , dentate fascia (DF) and subiculum (Sub) of the rat hippocampus. The framed areas show those selected for counts of TUNEL positive neurons; CA 1 in (B) and (C) and CA 3 in (D) and (E). In situ hybridization of IGF-IR message in CA 1 are shown in (F) and (G) and that of IR in (H) and (I). Note TUNEL positive neurons in CA 1 in 8-month diabetic rats (arrows, C) but not in age-matched controls (B). No TUNEL positive neurons were detectable in CA 3 of diabetic (E) or control rats (D). The expression of IGF-IR and IR was decreased in 8-month diabetic rats (G and I) compared to that in control rats (F and H). Magnifications: (A) 22.53; (B–I) 9803.

3.3. Hippocampal neuronal apoptosis At 2 months, TUNEL positive neurons were not demonstrable in any of the hippocampal regions in either diabetic or control animals (Table 3). TUNEL positive neurons were present in hippocampal pyramidal cells of CA 1 and CA 2 in 8-month diabetic rats, but not in control rats (Fig. 2B and C; Table 3). No TUNEL positive neurons were seen in CA 3 (Fig. 2D and E), CA 4 , or the dentate gyrus. However, occasional TUNEL-positive neurons were seen

in CA 2 , but their number did not reach statistical significance (Table 3). The LM-PCR method [36] was used to amplify nucleosomal DNA fragmentation by ligating adaptors (48 bp total) to DNA break sites. Therefore, the resultant DNA ladders were slightly larger than those seen by conventional DNA laddering. In 2-month animals, DNA ladders were not detected in any of the CNS regions of either diabetic or control rats (Fig. 3, left upper panel). In 8-month diabetic BB / W rats, DNA ladder was detected in the hippocampus

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

227

Fig. 3. LM-PCR assay in 2- and 8-month diabetic BB / W rats and age-matched control animals. The PCR amplification products were visualized on 1.4% agarose gel electrophoresis. The gels are representative of three experiments. Areas of the brain represented by the various lanes are indicated for control and diabetic rats at 2 and 8 months of diabetes. A ladder pattern of DNA is evident in hippocampus and frontal cortex in 8-month (right upper panel) but not in 2-month diabetic animals (left upper panel). Equal amounts of GAPDH genomic DNA were amplified in diabetic and control animals (lower panels).

and frontal cortex, but not in diencephalon or cerebellum. Age-matched control rats showed no DNA laddering in any of the above regions (Fig. 3, right upper panel). A single band of GAPD cDNA was present with equal density in control and diabetic animals, indicating that an equal amount of genomic DNA was used (Fig. 3, lower panels). To further confirm neuronal death in diabetic hippocampi, neuronal counts of pyramidal cells were performed in the various hippocampal regions. No significant differences were demonstrated between 2-month diabetic and age-matched control rats (Table 3). In 8-month diabetic animals, however, there was a 37% (P,0.001) loss of pyramidal cells in CA 1 , and a 24% (P,0.05) loss in CA 2. Other hippocampal regions showed nonsignificant decreases in neuronal densities (Table 3). Since the body weights of 2-month control rats were comparable with those of 8-month diabetic rats (369624 vs. 357629, (NS) Table 1), comparisons were made between neuronal densities in 8-month diabetic rats and 2-month control rats.

These comparisons revealed that neuron densities of CA 1 and CA 2 in 8-month diabetic rats were significantly decreased compared to weight-matched nondiabetic animals. To determine changes in apoptosis-related proteins in hippocampus, we examined Bax, a protein facilitating apoptotic cell death, Bcl-x L , a protein protective of apoptotic cell death, and the activity of caspase 3, an effector caspase for apoptosis. In 2-month diabetic and control rats, there were no notable changes in contents of Bax and Bcl-x L (Fig. 4). In 8-month diabetic animals, the Bax expression was significantly increased compared to agematched control rats (2.3-fold; P,0.001), whereas the expression of Bcl-x L was not significantly altered. The resulting ratio of Bax / Bcl-x L was increased 2.4 times (P,0.001), compared to that of control animals (Fig. 4). Furthermore, the inhibitable activity of caspase 3 was increased 3.3-fold (P,0.02) in hippocampal extracts from 8-month diabetic rats compared with those obtained from age-matched control animals (Fig. 5).

228

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

7). In situ hybridization of IGF-IR and IR at 8-months of diabetes showed decreased signal intensities in the CA 1 region as compared to those in age-matched control rats (Fig. 2F–I).

4. Discussion

Fig. 4. Western blot analysis of Bax and Bcl-x L in 2- and 8-month diabetic and age-matched control rats (representative of three blots). There is increased content of Bax in 8-month diabetic BB / W rats compared to control rats, (A; right lanes D vs. C) but not in 2-month diabetic rats (A; left lanes D vs. C). Amounts of Bcl-x L were unchanged in diabetic hippocampi compared to control rats at both 2- and 8-month groups (lower panel A). The ratio of Bax / Bcl-x L is presented in (B), showing a significantly (P,0.01) elevated ratio in 8-month diabetic hippocampi. C, control rats; D, diabetic BB / W rats.

3.4. Alteration in IGF expression in diabetic hippocampus In 2-month diabetic animals, mRNA expression of IGFI, IGF-II IGF-IR and IR was reduced to 50.864.7, 43.062.7, 44.965.9 and 46.664.7%, respectively, of agematched control values (all P,0.001; Fig. 6). The protein expression of IGF-I, IGF-II, IGF-IR and IR were examined in 2- and 8-month diabetic rats. At both time-points all showed significant decreases (P,0.001) as compared to age-matched controls as shown by immunoblotting (Fig.

In this study we show that neuronal apoptosis occurs in hippocampus of type 1 diabetic BB / W rats and that it is associated with cognitive impairments and prior perturbations of the IGF system. The characteristic ladder pattern of genomic DNA only became evident in 8-month diabetic BB / W rats and was associated with an elevated Bax / Bcl-x L ratio, increased caspase 3 activity and neuronal loss in hippocampus. These abnormalities were not present in 2-month diabetic BB / W rats, indicating that neuronal apoptosis occurs only after a prolonged duration of diabetes and that it may be asynchronous and duration-related. Functionally, these findings correlated with increased latencies of the Morris water maze tests in 8-month diabetic rats, indicative of impaired spatial learning and memory. They were also associated with, and preceded by, significant decreases in hippocampal expression of IGF-I, IGF-II, IGF-IR and IR. It may be argued that the neuronal loss, particularly of CA 1 , could be the result of hypoglycemia, which is known to affect this region of hippocampus as well as neurons of cortical layers 3 and 5 and cerebellar Purkinje cells [1]. However, this explanation is unlikely, since 24-h monitoring of glycemic levels showed levels well in the hyperglycemic range at all times. Also, it is unlikely that the present results could be due to the general emaciation of the diabetic animals, since they remained impaired when compared to weight-matched control animals. Hippocampal neurons encode series of events and spatial orientation as animals perform learning and memory tasks, storing sequences of events that compose episodic memories [13,43]. The present results are in keeping with the findings by Biessels et al. [8] who demonstrated either a lack of inducible long-term potentiation of CA 1 or a decreased slope of excitory postsynaptic potentials from the same field, suggesting both pre- and postsynaptic impairments of CA 1 [10]. It is possible that duration-dependent cognitive deficits and impaired cognitive development in type 1 diabetic patients [18,31] are reflective of changes similar to those described here. Apoptosis can be induced via several cellular mechanisms, such as ischemia with intracytoplasmic calcium accumulation and mitochondrial dysfunction [44], receptor-mediated or nonreceptor-mediated mechanisms [22] or suppression of IGF activity [29]. Although brain blood flow is compromised in experimental diabetes [16], it does not appear to compromise energy metabolism even after 8

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

229

Fig. 5. Caspase 3 activity assayed from hippocampi of 8-month diabetic BB / W rats and age-matched control rats. The percentage of total caspase 3 inhibited by Ac-DEVD-CHO (see Materials and methods) was approximately 50% (P,0.02) in diabetic rats and significantly greater (P,0.03) than that in control rats. In control rats there was no significant inhibition of caspase 3 activity. The bars represent the mean6S.D. of three experiments.

months of STZ-induced diabetes [9]. Receptor mediated caspase activation by FAS, TNF receptor or TNF-related apoptosis-inducing ligand (TAIL) receptor has not been examined in brain and can therefore not be excluded as a possible mechanism for the present findings. However, numerous studies have suggested that IGF-IR / IR mediates anti-apoptotic function in a variety of tissues including the nervous system [30,35]. IGF-I protects against apoptosis of dorsal root ganglia and neuroblastoma SH-SY5Y cells exposed to high glucose [30,35]. In the pcd mouse, Purkinje cell apoptosis is associated with decreased IGF-I expression [47]. Ishii [15] proposed that decreased IGF activities might contribute to CNS abnormalities in the streptozotocin (STZ)-induced diabetic rat. It was recently demonstrated [41] that the expression of IGF-I, IGF-IR and IR is reduced in susceptible hippocampal areas in Alzheimer’s disease, a disorder in which apoptosis has been invoked as a mechanism. In the present study, impaired IGF and insulin activities preceded the development of apoptosis. This agrees with reports on the STZinduced type 1 diabetic rat in whom IGF activity is reduced in the brain [45]. TUNEL positive neurons as well as neuronal loss were found predominantly in the CA 1 region, where the in situ IGF-IR and IR expression was reduced, suggesting a linkage between declining IGF and insulin activities and the development of apoptosis. Since the hippocampal CA 1 is especially susceptible and closely related to learning and memory, apoptotic cell death of this

limbic structure is likely to contribute to cognitive deficits and are in keeping with impaired synaptic integrity [7,8], which may precede and accompany neuronal apoptosis and loss. Diabetes-related cognitive dysfunction has been controversial as to its underlying cause, whether it is the result of cerebrovascular accidents, hypoglycemic episodes with subsequent neuronal loss, or hyperglycemia per se. It is known from experimental hypoglycemia that a delayed loss particularly of CA 1 neurons occurs. However, this is associated with an accompanying loss of dentate granule cells and degeneration of the stratum radiatum [1], changes which were not evident in the present study. It is unlikely that the present changes could be ascribed to hypoglycemic episodes, also because 24-h blood sugar monitoring revealed levels well above normal. Therefore both clinical and experimental data support the notion that the brain is not spared from the hyperglycemic and / or insulinopenic complications of diabetes. From these data we conclude that type 1 diabetes in the BB / W rat causes a duration-related programmed neuronal cell death in hippocampus and to a lesser extent in the frontal cortex coupled with cognitive impairments. Preceding and accompanying perturbations of IGF and insulin activities may contribute to apoptotic neuronal death. These findings may therefore provide a mechanism for the duration-related cognitive decline seen in type 1 diabetic patients.

230

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

Fig. 6. (A) Northern blot hybridization (representative of three blots). The mRNA levels of IGF-I, IGF-II, IGF-IR and IR were significantly reduced in hippocampi of 2-month diabetic BB / W rats compared to age-matched control rats (B). Control values are arbitrarily set to 100. Position of 28 s ribosome is indicated. Arrows indicate the mRNA bands of IGF-I (7.5 kb), IGF-II (3.8 kb), IGF-IR (11 kb) and IR (11 kb) in (A). The GAPDH bands of the corresponding gel show that equal amounts of RNA was loaded into each lane. C, control; D, diabetic. *, P,0.001 vs. control.

Fig. 7. Western blots of IGF-I, IGF-II, IGF-IR and IR in 2-month diabetic and control rats (A) and in 8-month diabetic and control rats (B). Note weaker expression of all four proteins in diabetic rats at both time-points as compared to the respective control rats. The quantitative expression of the proteins is expressed in arbitrary units (controls5100). *, P,0.001 vs. control.

Acknowledgements These studies were supported by grants from the Thomas Foundation, Juvenile Diabetes Research Foundation (AAFS) and the Morris Hood Jr. Diabetes Center (ZL).

[4]

[5]

References ¨ The distribution of [1] R.N. Auer, T. Wieloch, Y. Olsson, B.K. Siesjo, hypoglycemic brain damage, Acta Neuropathol. (Berl). 64 (1984) 177–191. ¨ [2] K. Asplund, E. Hagg, C. Helmers, F. Lithner, T. Strand, P.O. Wester, The natural history of stroke in diabetic patients, Acta Med. Scand. 207 (1980) 417–427. [3] F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman,

[6]

[7]

[8]

J.A. Smith, K. Struhl (Eds.), Current Protocols in Molecular Biology, Greene–Wiley, New York, 1994. A.J. Barber, E. Lieth, S.A. Khin, D.A. Antonetti, A.G. Buchanan, T.W. Gardner, Neural apoptosis in the retina during experimental and human diabetes. Early onset and effect of insulin, J. Clin. Invest. 102 (1998) 783–791. F. Bertrand, A. Atfi, A. Cadoret, G. L’Allemaia, H. Robin, O. Lascols, J. Capeau, G. Cherqui, A role for nuclear factor KB in the antiapoptotic function of insulin, J. Biol. Chem. 273 (1998) 3931– 3938. G.J. Biessels, A.C. Kappelle, B. Bravenboer, D.W. Erkelens, W.H. Gispen, Cerebral function in diabetes mellitus, Diabetologia 37 (1994) 643–650. G.J. Biessels, A. Kamal, G.M. Ramakers, I.J. Urban, B.M. Spruijt, D.W. Erkelens, W.H. Gispen, Place learning and hippocampal synaptic plasticity in streptozotocin-induced diabetic rats, Diabetes 45 (1996) 1259–1266. G.J. Biessels, A. Kamal, I.J. Urban, B.M. Spruijt, D.W. Erkelens, W.H. Gispen, Water maze learning and hippocampal synaptic

Z.G. Li et al. / Brain Research 946 (2002) 221 – 231

[9]

[10] [11] [12]

[13]

[14]

[15] [16]

[17]

[18]

[19]

[20] [21]

[22] [23] [24]

[25]

[26] [27]

[28] [29]

plasticity in streptozotocin-diabetic rats: effects of insulin treatment, Brain Res. 800 (1998) 125–135. G.J. Biessels, K.P. Braun, R.A. de Graaf, P. van Eijsden, W.H. Gispen, K. Nicolay, Cerebral metabolism in streptozotocin-diabetic rat: an in vivo magnetic resonance spectroscopy study, Diabetologia 44 (2001) 346–353. T.V. Bliss, G.L. Collingridge, A synaptic model of memory: longterm potentiation in the hippocampus, Nature 361 (1993) 31–39. D.A. Carson, J. M Ribeiro, Apoptosis and disease, Lancet 341 (1993) 1251–1254. P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction, Anal. Biochem. 162 (1987) 156–159. H. Eichenbaum, P. Dudchenko, E. Wood, M. Shapiro, H. Tanila, The hippocampus, memory, and place cells: is it spatial memory or a memory space?, Neuron 23 (1999) 209–226. F. Gillardon, B. Bottiger, B. Schmitz, M. Zimmermann, K.A. Hossmann, Activation of CPP-32 protease in hippocampal neurons following ischemia and epilepsy, Mol. Brain Res. 50 (1997) 16–22. D.N. Ishii, Implication of insulin-like growth factors in the pathogenesis of diabetic neuropathy, Brain Res. Rev. 20 (1995) 47–67. J. Jakobsen, M. Nedergaard, M. Aarslew-Jensen, N.H. Diemer, Regional brain glucose metabolism and blood flow in streptozocininduced diabetic rats, Diabetes 39 (1990) 437–440. E.R. Kandel, J.H. Schwartz, T.M. Jessell (Eds.), Essentials of Neural Science and Behavior, Appleton and Lange, Stanford, 1995, pp. 651–666, Chapter 35. L. Kramer, P. Fasching, C. Madl, B.B. Schneider, P. Damjancic, W. ¨ Waldhausl, K. Irsigler, G. Grimm, Previous episodes of hypoglycemic coma are not associated with permanent cognitive brain dysfunction in IDDM patients on intensive insulin treatment, Diabetes 47 (1998) 1909–1914. W. Lee-Kwon, D. Park, P.V. Baskar, S. Kole, M. Bernier, Antiapoptotic signaling by the insulin receptor in Chinese hamster ovary cells, Biochemistry 37 (1998) 15747–15757. D. LeRoith, Insulin-like growth factor, Horm. Metab. Res. 31 (1999) 41–42. Z.G. Li, X. Qiang, A.A.F. Sima, G. Grunberger, C-peptide attenuates protein tyrosine phosphatase activity and enhances glycogen synthesis in L6 myoblasts, Biochem. Biophys. Res. Commun. 280 (2001) 615–619. L.J. Martin, Neuronal cell death in nervous system development, disease, and injury (review), Int. J. Mol. Med. 7 (2001) 455–478. A. McCall, The impact of diabetes on the CNS, Diabetes 41 (1992) 557–570. L.M. Mertz, A. Rashtchian, PCR radioactive labeling system: a rapid method for synthesis of high specific activity DNA probes, Focus 16 (1994) 45–48. J. Mordes, R. Bortell, H. Groen, D. Guberski, A.A. Rossini, D.L. Greiner, Autoimmune diabetes mellitus in the BB-rat, in: A.A.F. Sima, E. Shafrir (Eds.), Animal Models of Diabetes: A Primer, Harwood, Amsterdam, 2001, pp. 1–42. R. Morris, Developments of a water-maze procedure for studying spatial learning in the rat, J. Neurosci. Methods 11 (1984) 47–60. A. Ott, R.P. Stolk, F. van Harskamp, H.A.P. Pols, A. Hofman, M.M.B. Breteler, Diabetes mellitus and the risk of dementia: the Rotterdam study, Neurology 58 (1999) 1937–1941. G. Paxinos, C. Watson (Eds.), The Rat Brain in Stereotaxic Coordinates, Academic Press, Sydney, 1982. M. Resnicoff, J.L. Burgaud, H.L. Rotman, D. Abraham, R. Baserga,

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38] [39] [40]

[41]

[42] [43]

[44]

[45]

[46]

[47]

[48]

231

Correlation between apoptosis, tumorigenesis, and levels of insulinlike growth factor I receptors, Cancer Res. 55 (1995) 3739–3741. J.W. Russell, E.L. Feldman, Insulin-like growth factor-I prevents apoptosis in sympathetic neurons exposed to high glucose, Horm. Metab. Res. 31 (1999) 90–96. E.J. Schoenle, D. Schoenle, L. Molinari, R.H. Largo, Impaired intellectual development in children with type 1 diabetes: association with HbA 1 c, age at diagnosis and sex, Diabetologia 45 (2002) 108–114. E. Shafrir, A.A.F. Sima, Diabetic animals for research into the complications: a general overview, in: A.A.F. Sima (Ed.), Chronic Complications in Diabetes, Harwood, Amsterdam, 2000, pp. 1–42. A.A.F. Sima, The natural history of diabetic neuropathy in BB-rat, in: A.K. Sharma (Ed.), Diabetes Mellitus and its Complications—an Update, McMillan, Dublin, 1993, pp. 315–325. A.A.F. Sima, W. Zhang, K. Sugimoto, D. Henry, Z.G. Li, J. Wahren, G. Grunberger, C-peptide prevents and improves chronic type 1 neuropathy in BB / Wor-rat, Diabetologia 44 (2001) 889–897. J.R. Singleton, A.E. Randolph, E. L Feldman, Insulin-like growth factor I receptor prevents apoptosis and enhances neuroblastoma tumorigenesis, Cancer. Res. 56 (1996) 4522–4529. K. Staley, A.J. Blaschke, J. Chun, Apoptotic DNA fragmentation is determined by a semiquantitative ligation-mediated PCR of blunt DNA ends, Cell Death Diff. 4 (1997) 66–75. R.J. Steele, R.G. Morris, Delay-dependent impairment of a matchingto-place task with chronic and intrahippocampal infusion of the NMDA-antagonist D-AP5, Hippocampus 9 (1999) 118–136. L. Stefanis, R.E. Burke, L.A. Greene, Apoptosis in neurodegenerative disorders, Curr. Opin. Neurol. 10 (1997) 299–305. R. Stewart, D. Liolitsa, Type 2 diabetes mellitus, cognitive impairment and dementia, Diab. Med. 16 (1999) 93–112. K. Sugimoto, Y. Murakawa, W. Zhang, G. Xu, A.A.F. Sima, Insulin receptor in rat peripheral nerve: its localization and alternatively spliced isoforms, Diabetes Metab. Res. Rev. 16 (2000) 354–363. B.M. Terry, J.C. Cannon, L. Guong, Abnormalities in insulin, IGF-I, and corresponding receptor (R) expression in Alzheimer disease, J. Neuropath. Exp. Neurol. 60 (2001) 546, Abstract. C.B. Thompson, Apoptosis in the pathogenesis and treatment of disease, Science 267 (1995) 1456–1462. G.V. Wallenstein, H. Eichenbaum, M.E. Hasselmo, The hippocampus as an associator of discontiguous events, Trends Neurosci. 21 (1998) 317–323. B.C. White, J.M. Sullivan, D.J. DeGracia, B.J. O’Neil, R.W. Neumar, L.I. Grossman, J.A. Rafols, G.S. Krause, Brain ischemia and reperfusion: molecular mechanisms of neuronal injury, J. Neurol. Sci. 179 (2000) 1–33. L. Wuarin, R. Namdev, J.G. Burns, Z.J. Fei, D.N. Ishii, Brain insulin-like growth factor-II mRNA content is reduced in insulindependent and non-insulin-dependent diabetes mellitus, J. Neurochem. 67 (1996) 742–751. H. Yamanouchi, W. Zhang, V. Jay, L.E. Becker, Enhanced expression of microtubule-associated protein 2 in large neurons of cortical dysplasia, Ann. Neurol. 39 (1996) 57–61. W. Zhang, B. Ghetti, W.H. Lee, Decreased IGF-I gene expression during the apoptosis of Purkinje cells in pcd mice, Brain. Res. Dev. Brain Res. 98 (1997) 164–176. W. Zhang, P. Khanna, L.L. Chan, G. Campbell, N.H. Ansari, Diabetes-induced apoptosis in rat kidney, Biochem. Mol. Med. 61 (1997) 58–62.