- Email: [email protected]
Homeostatic Control of Mitotic Arrest
Molecular Cell, Volume 44
Supplemental Information Homeostatic Control of Mitotic Arrest Gianluca Varetti, Claudia Guida, Stefano Santaguida, Elena Chiroli, and Andrea Musacchio
Supplemental Experimental Procedures RNA interference siRNAs were transfected in HeLa cells with Lipofectamine™ 2000
(Invitrogen), according to the maufacturer’s instructions. Normally, two rounds of siRNA transfection were performed during cell synchronization. For p31comet RNAi, a Stealth siRNA from Invitrogen (siRNA HSS114319) was used for all the experiments, with the exception of HSS114320 and HSS114321 that were respectively indicated as siRNA#2 and #3 in Fig. S1B, and oligo 2 (ATTCATGGCTGATGCCTTT, Dharmacon Thermo Scientific) and oligo 3 (GAAGATTGGTTTCGACCCA, Dharmacon Thermo Scientific) in Fig. 6B. As a control, a siRNA specific for luciferase (target sequence AACGTACGCGGAATACTTCGA) was purchased from Dharmacon Thermo Scientific.
Antibodies The following antibodies were used specifically for Western blotting, unless
specified. Actin (SIGMA, A4700); APC7 (rabbit polyclonal, IFOM-IEO Campus, Biochemistry unit); Aurora B (Abcam, ab2254); BubR1 (BD Transduction Laboratories, 612503); Bub1 (Abcam, ab9000); Bub3 (BD Transduction Laboratories, 611731); Cdc20 (Abcam, ab26483; Biosource, AHO0322); Cdc27 (BD Transduction Laboratories, 610455, 1.5 µg/mg cell lysate in immunoprecipitation); Cyclin A (Santa Cruz Biotechnology, sc-751); Cyclin B1 (Santa Cruz Biotechnology, sc-245); FLAG (agaroseconjugated, SIGMA, A2220, 10 µl/mg cell lysate in immunoprecipitation); Mad1 ((reference Steensgaard et al., 2004); Mad2 ((reference De Antoni et al., 2005)); Bethyl, A300-301A); Mps1 (mouse monoclonal, Upstate, 05-682); myc (Sironi et al., 2001); Nek2 (BD Transduction Laboratories, 610593) phospho-Ser10 H3 (Upstate, 06-570); p31comet (mouse monoclonal, clone E29.19.14, IFOM-IEO Campus, Monoclonal Antibody Facility); tubulin (Abcam, ab6046); vinculin (SIGMA, V9131).
Time-lapse in vivo imaging Live cell imaging was performed using a IX70 inverted
microscope (Nikon) equipped with an incubation chamber (Solent Scientific) maintained at 37°C in an atmosphere of 5% CO2. Movies were acquired using a 20x magnification objective controlled by ScanR software (Olympus). Results from the time-lapse experiments were graphically represented with Prism 4 (GraphPad Software).
Immunoprecipitation Fresh cell lysates were incubated with the appropriate bead-
coupled antibodies at 4°C for 4 hours with agitation. The beads were recovered and washed three times in 10-20 volumes of lysis buffer. Finally the beads were resuspended in sample buffer and subjected to SDS-PAGE and Western Blot analysis.
In vitro ubiquitylation assays To immunopurify the APC/C, HeLa cells were lysed in
a modified lysis buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1% Triton X-100, 1% glycerol, 5 mM EGTA, 1.5 mM MgCl2, 1 mM DTT, 2mM Na3VO4, 2 mM NaF, 10 mM
1
Na4P2O7, EDTA-free protease inhibitor cocktail from Calbiochem) and the lysates were incubated with the -Cdc27 antibody at 4°C for 2 hours. Protein G-Sepharose® beads (Zymed) were added to the samples and incubated at 4°C for 4 hours with agitation. The beads were recovered and washed in washing buffer (50 mM Tris-HCl pH 7.4, 10% glycerol, 1 mM DTT, 1 µg/µl BSA). Each ubiquitylation reaction included: APC/C beads from 0.5 mg cell lysates, 150 nM E1 (Boston Biochem), 800 nM UbcH10, 200 µM Ub (Boston Biochem), 2 mM ATP (SIGMA), 1 µM Ub aldehyde (Boston Biochem), 40 mM Tris-HCl pH 7.4, 5 mM MgCl2, 10% glycerol, 1 mg/ml BSA, 1 mM DTT, 0.04 µM cyclin B11-87 S53C-Alexa488. The total reaction volume was 20 µl. The reactions were carried out at 25°C in the dark and stopped by adding sample buffer. The reactions underwent SDS-PAGE in the dark. The images were acquired with a Versadoc MP 4000 (Bio-Rad), equipped with the Quantity One software (Bio-Rad).
2
Figure S1. Specificity of the α-p31comet and α-Cdc27 Antibodies, Related to Figure 1 A) The indicated amounts of recombinant p31comet and soluble cell extracts of HeLa cells were loaded separated by SDS-PAGE and tested by Western blotting with the α-p31comet antibody, clone E29.19.14. B) HeLa cells were synchronized through a double thymidine block, and transfected between the first and second arrest with the indicated siRNAs at 50 nM concentration. Cells were harvested 22 hours after the second release. The corresponding protein extracts were analyzed by Western blotting with E29.19.14. C) One mg of soluble protein extracts of HeLa cells was incubated with the indicated antibodies for immunoprecipitation. Buffer: lysis buffer alone was incubated with 10 µg of α-p31comet antibody. The immunoprecipitates and the corresponding supernatants underwent SDS-PAGE and Western blotting with the α-p31comet antibody. D) Epitope mapping of the α-p31comet antibody, clone E29.19.14. A peptide array of 12 amino acids peptides covering the sequence of p31comet was ordered from New England Peptides. Adjacent peptides had a 9-residue overlap. The peptides were dissolved in DMSO at the concentration of 2-3 mg/ml and spotted on a nitrocellulose membrane through a dot-
3
blot apparatus (Bio-Rad). The peptides were adsorbed for 10 minutes and the membrane was then probed with the clone E29.19.14. In position H12, recombinant full-length p31comet was spotted as a positive control. The sequences of the peptides A5 and A6 are AVPDLEWYEKSE and DLEWYEKSEETH, respectively. E) HeLa cells were synchronized with a thymidine-aphidicolin block and transfected twice with control siRNAs or siRNA for p31comet. Cells were blocked in 80 ng/ml nocodazole for 7 hours and harvested. Cells were lysed and 1.5 mg of each sample were incubated with α-Cdc27 or α-myc antibodies for immunoprecipitation. Immunoprecipitates were separated by SDS-PAGE and the indicated proteins were monitored by Western blotting. Buffer: lysis buffer alone was incubated with α-Cdc27 antibody.
4
Figure S2. Protein Levels and Stability of p31comet and its Interaction with Mad1Mad2 Are Constant in the Cell Cycle, Related to Figure 1 A,B) HeLa cells were synchronized through a 15 hour-nocodazole block (A) or a double thymidine block (B), released in fresh medium and harvested at the indicated time points. The corresponding cell extracts underwent immunoblot analysis with the indicated antibodies. As: asynchronous population. C) Asynchronous (upper panel) or nocodazolereleased (lower panel) HeLa cells were treated with 14 µg/ml CHX; cell extracts corresponding to the indicated time points were subjected to Western blotting. D) HeLa cells were left untreated (asynchronous), blocked in nocodazole (80 ng/ml) overnight or released in fresh medium for 1 or 2 hours. Cells were lysed and protein extracts were used for immunoprecipitation with α-p31comet antibody crosslinked to protein G beads. Immunoprecipitates were subjected to SDS-PAGE and Western blotting to detect the indicated proteins. E) HeLa cells were transiently transfected with a pcDNA-FLAGp31comet or with pcDNA-FLAG-p31cometQF vector. Twenty-four hours after transfection, cells were treated with 100 ng/ml nocodazole overnight. Mitotic cells were collected by shake off and lysed. Protein extracts (1.8 mg) were pre-cleared and immunoprecipitation was carried out with a-FLAG antibody. Immunoprecipitates were analyzed by Western blotting to detect indicated proteins.
5
Figure S3. Quantification of Experiments in Fig 4B, Related to Figure 4 HeLa cells were treated as described in the legend of Fig. 4B. After Western blotting, the indicated proteins were quantified by densitometry from 3 experiments. The relative increase of Cdc20 levels upon p31comet RNAi is 1.8 (P-value= 0.0244).
6
Figure S4. Cdc20 Lysine-less Mutant Peptide Has Reduced Binding Affinity for Mad2, Related to Figure 7 In their attempt to demonstrated that poly-ubiquitination of Cdc20 is not required for mitotic exit, Nilsson and co-workers created a mutant Cdc20 in which all lysine residues were mutated into arginine (Nilsson et al., 2008), abbreviated as K-less Cdc20. This mutant cannot be ubiquitinated. If ubiquitination were required for mitotic exit, as proposed (Reddy et al., 2007), this mutant should not support mitotic exit. On the contrary, this mutant allowed cells to exit mitosis in the presence of a checkpointactivating condition (Nilsson et al., 2008). This was interpreted as a demonstration that mitotic exit does not require Cdc20 ubiquitination (Nilsson et al., 2008). A possible alternative explanation for the behavior of K-less Cd20 is that it does not bind to the checkpoint proteins Mad2 and BubR1 as tightly as does wild type Cdc20. This may give rise to a paradoxical behavior: on the one hand, the K-less mutant may stick onto the APC/C more tightly because it cannot be ubiquitinated and released. On the other hand, the K-less mutant may not bind the SAC (or even the APC/C) with the same affinity, and therefore it may have an increased tendency to become dissociated from the APC/C, bypassing ubiquitination. To test the latter hypothesis, we noticed that there are two
7
lysines in the Mad2-binding motif of Cdc20 (Sironi et al., 2002). We tested if peptides corresponding to the Mad2-binding site of Cdc20 and having the two lysine residues mutated to arginine bound Mad2 with the same affinity as the peptide with the wild type sequence. We found that the binding affinity of Mad2 for the Cdc20 peptides bearing the K-R mutations was 1/2 to 1/3 of that of the wild type peptide. Thus, the interaction of Cdc20 with the APC/C or with the SAC might be impaired in the K-less mutant. Fluorescence anisotropy measurements were made with a Tecan Infinite F200 instrument at 20ºC. We used fixed concentrations (10 nM) of Fluorescein-labeled Cdc20 peptides (synthesized by Mimotopes) with sequences 5FAMNAKILRLSGKPQNAPEG, 5FAM-NARILRLSGKPQNAPEG, or 5FAMNARILRLSGRPQNAPEG. The peptides contain either one or both lysine residues mutated to arginine. Peptides were mixed with increasing concentrations of O-Mad2 in PBS buffer. Reaction mixtures were allowed to equilibrate overnight at 4°C. Fluorescein was excited with polarized light at 485 nm and the emitted light was detected at 535 nm through both horizontal and vertical polarizers. The Kd was determined by fitting the fluorescence polarization data to a quadratic equation.
8
Supplemental References De Antoni, A., Pearson, C.G., Cimini, D., Canman, J.C., Sala, V., Nezi, L., Mapelli, M., Sironi, L., Faretta, M., Salmon, E.D., and Musacchio, A. (2005). The Mad1/Mad2 complex as a template for Mad2 activation in the spindle assembly checkpoint. Curr Biol 15, 214-225. Nilsson, J., Yekezare, M., Minshull, J., and Pines, J. (2008). The APC/C maintains the spindle assembly checkpoint by targeting Cdc20 for destruction. Nat Cell Biol 10, 14111420. Reddy, S.K., Rape, M., Margansky, W.A., and Kirschner, M.W. (2007). Ubiquitination by the anaphase-promoting complex drives spindle checkpoint inactivation. Nature 446, 921-925. Sironi, L., Mapelli, M., Knapp, S., De Antoni, A., Jeang, K.T., and Musacchio, A. (2002). Crystal structure of the tetrameric Mad1-Mad2 core complex: implications of a 'safety belt' binding mechanism for the spindle checkpoint. EMBO J 21, 2496-2506. Sironi, L., Melixetian, M., Faretta, M., Prosperini, E., Helin, K., and Musacchio, A. (2001). Mad2 binding to Mad1 and Cdc20, rather than oligomerization, is required for the spindle checkpoint. EMBO J 20, 6371-6382. Steensgaard, P., Garre, M., Muradore, I., Transidico, P., Nigg, E.A., Kitagawa, K., Earnshaw, W.C., Faretta, M., and Musacchio, A. (2004). Sgt1 is required for human kinetochore assembly. EMBO Rep 5, 626-631.
9
Supplemental Information Homeostatic Control of Mitotic Arrest Gianluca Varetti, Claudia Guida, Stefano Santaguida, Elena Chiroli, and Andrea Musacchio
Supplemental Experimental Procedures RNA interference siRNAs were transfected in HeLa cells with Lipofectamine™ 2000
(Invitrogen), according to the maufacturer’s instructions. Normally, two rounds of siRNA transfection were performed during cell synchronization. For p31comet RNAi, a Stealth siRNA from Invitrogen (siRNA HSS114319) was used for all the experiments, with the exception of HSS114320 and HSS114321 that were respectively indicated as siRNA#2 and #3 in Fig. S1B, and oligo 2 (ATTCATGGCTGATGCCTTT, Dharmacon Thermo Scientific) and oligo 3 (GAAGATTGGTTTCGACCCA, Dharmacon Thermo Scientific) in Fig. 6B. As a control, a siRNA specific for luciferase (target sequence AACGTACGCGGAATACTTCGA) was purchased from Dharmacon Thermo Scientific.
Antibodies The following antibodies were used specifically for Western blotting, unless
specified. Actin (SIGMA, A4700); APC7 (rabbit polyclonal, IFOM-IEO Campus, Biochemistry unit); Aurora B (Abcam, ab2254); BubR1 (BD Transduction Laboratories, 612503); Bub1 (Abcam, ab9000); Bub3 (BD Transduction Laboratories, 611731); Cdc20 (Abcam, ab26483; Biosource, AHO0322); Cdc27 (BD Transduction Laboratories, 610455, 1.5 µg/mg cell lysate in immunoprecipitation); Cyclin A (Santa Cruz Biotechnology, sc-751); Cyclin B1 (Santa Cruz Biotechnology, sc-245); FLAG (agaroseconjugated, SIGMA, A2220, 10 µl/mg cell lysate in immunoprecipitation); Mad1 ((reference Steensgaard et al., 2004); Mad2 ((reference De Antoni et al., 2005)); Bethyl, A300-301A); Mps1 (mouse monoclonal, Upstate, 05-682); myc (Sironi et al., 2001); Nek2 (BD Transduction Laboratories, 610593) phospho-Ser10 H3 (Upstate, 06-570); p31comet (mouse monoclonal, clone E29.19.14, IFOM-IEO Campus, Monoclonal Antibody Facility); tubulin (Abcam, ab6046); vinculin (SIGMA, V9131).
Time-lapse in vivo imaging Live cell imaging was performed using a IX70 inverted
microscope (Nikon) equipped with an incubation chamber (Solent Scientific) maintained at 37°C in an atmosphere of 5% CO2. Movies were acquired using a 20x magnification objective controlled by ScanR software (Olympus). Results from the time-lapse experiments were graphically represented with Prism 4 (GraphPad Software).
Immunoprecipitation Fresh cell lysates were incubated with the appropriate bead-
coupled antibodies at 4°C for 4 hours with agitation. The beads were recovered and washed three times in 10-20 volumes of lysis buffer. Finally the beads were resuspended in sample buffer and subjected to SDS-PAGE and Western Blot analysis.
In vitro ubiquitylation assays To immunopurify the APC/C, HeLa cells were lysed in
a modified lysis buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1% Triton X-100, 1% glycerol, 5 mM EGTA, 1.5 mM MgCl2, 1 mM DTT, 2mM Na3VO4, 2 mM NaF, 10 mM
1
Na4P2O7, EDTA-free protease inhibitor cocktail from Calbiochem) and the lysates were incubated with the -Cdc27 antibody at 4°C for 2 hours. Protein G-Sepharose® beads (Zymed) were added to the samples and incubated at 4°C for 4 hours with agitation. The beads were recovered and washed in washing buffer (50 mM Tris-HCl pH 7.4, 10% glycerol, 1 mM DTT, 1 µg/µl BSA). Each ubiquitylation reaction included: APC/C beads from 0.5 mg cell lysates, 150 nM E1 (Boston Biochem), 800 nM UbcH10, 200 µM Ub (Boston Biochem), 2 mM ATP (SIGMA), 1 µM Ub aldehyde (Boston Biochem), 40 mM Tris-HCl pH 7.4, 5 mM MgCl2, 10% glycerol, 1 mg/ml BSA, 1 mM DTT, 0.04 µM cyclin B11-87 S53C-Alexa488. The total reaction volume was 20 µl. The reactions were carried out at 25°C in the dark and stopped by adding sample buffer. The reactions underwent SDS-PAGE in the dark. The images were acquired with a Versadoc MP 4000 (Bio-Rad), equipped with the Quantity One software (Bio-Rad).
2
Figure S1. Specificity of the α-p31comet and α-Cdc27 Antibodies, Related to Figure 1 A) The indicated amounts of recombinant p31comet and soluble cell extracts of HeLa cells were loaded separated by SDS-PAGE and tested by Western blotting with the α-p31comet antibody, clone E29.19.14. B) HeLa cells were synchronized through a double thymidine block, and transfected between the first and second arrest with the indicated siRNAs at 50 nM concentration. Cells were harvested 22 hours after the second release. The corresponding protein extracts were analyzed by Western blotting with E29.19.14. C) One mg of soluble protein extracts of HeLa cells was incubated with the indicated antibodies for immunoprecipitation. Buffer: lysis buffer alone was incubated with 10 µg of α-p31comet antibody. The immunoprecipitates and the corresponding supernatants underwent SDS-PAGE and Western blotting with the α-p31comet antibody. D) Epitope mapping of the α-p31comet antibody, clone E29.19.14. A peptide array of 12 amino acids peptides covering the sequence of p31comet was ordered from New England Peptides. Adjacent peptides had a 9-residue overlap. The peptides were dissolved in DMSO at the concentration of 2-3 mg/ml and spotted on a nitrocellulose membrane through a dot-
3
blot apparatus (Bio-Rad). The peptides were adsorbed for 10 minutes and the membrane was then probed with the clone E29.19.14. In position H12, recombinant full-length p31comet was spotted as a positive control. The sequences of the peptides A5 and A6 are AVPDLEWYEKSE and DLEWYEKSEETH, respectively. E) HeLa cells were synchronized with a thymidine-aphidicolin block and transfected twice with control siRNAs or siRNA for p31comet. Cells were blocked in 80 ng/ml nocodazole for 7 hours and harvested. Cells were lysed and 1.5 mg of each sample were incubated with α-Cdc27 or α-myc antibodies for immunoprecipitation. Immunoprecipitates were separated by SDS-PAGE and the indicated proteins were monitored by Western blotting. Buffer: lysis buffer alone was incubated with α-Cdc27 antibody.
4
Figure S2. Protein Levels and Stability of p31comet and its Interaction with Mad1Mad2 Are Constant in the Cell Cycle, Related to Figure 1 A,B) HeLa cells were synchronized through a 15 hour-nocodazole block (A) or a double thymidine block (B), released in fresh medium and harvested at the indicated time points. The corresponding cell extracts underwent immunoblot analysis with the indicated antibodies. As: asynchronous population. C) Asynchronous (upper panel) or nocodazolereleased (lower panel) HeLa cells were treated with 14 µg/ml CHX; cell extracts corresponding to the indicated time points were subjected to Western blotting. D) HeLa cells were left untreated (asynchronous), blocked in nocodazole (80 ng/ml) overnight or released in fresh medium for 1 or 2 hours. Cells were lysed and protein extracts were used for immunoprecipitation with α-p31comet antibody crosslinked to protein G beads. Immunoprecipitates were subjected to SDS-PAGE and Western blotting to detect the indicated proteins. E) HeLa cells were transiently transfected with a pcDNA-FLAGp31comet or with pcDNA-FLAG-p31cometQF vector. Twenty-four hours after transfection, cells were treated with 100 ng/ml nocodazole overnight. Mitotic cells were collected by shake off and lysed. Protein extracts (1.8 mg) were pre-cleared and immunoprecipitation was carried out with a-FLAG antibody. Immunoprecipitates were analyzed by Western blotting to detect indicated proteins.
5
Figure S3. Quantification of Experiments in Fig 4B, Related to Figure 4 HeLa cells were treated as described in the legend of Fig. 4B. After Western blotting, the indicated proteins were quantified by densitometry from 3 experiments. The relative increase of Cdc20 levels upon p31comet RNAi is 1.8 (P-value= 0.0244).
6
Figure S4. Cdc20 Lysine-less Mutant Peptide Has Reduced Binding Affinity for Mad2, Related to Figure 7 In their attempt to demonstrated that poly-ubiquitination of Cdc20 is not required for mitotic exit, Nilsson and co-workers created a mutant Cdc20 in which all lysine residues were mutated into arginine (Nilsson et al., 2008), abbreviated as K-less Cdc20. This mutant cannot be ubiquitinated. If ubiquitination were required for mitotic exit, as proposed (Reddy et al., 2007), this mutant should not support mitotic exit. On the contrary, this mutant allowed cells to exit mitosis in the presence of a checkpointactivating condition (Nilsson et al., 2008). This was interpreted as a demonstration that mitotic exit does not require Cdc20 ubiquitination (Nilsson et al., 2008). A possible alternative explanation for the behavior of K-less Cd20 is that it does not bind to the checkpoint proteins Mad2 and BubR1 as tightly as does wild type Cdc20. This may give rise to a paradoxical behavior: on the one hand, the K-less mutant may stick onto the APC/C more tightly because it cannot be ubiquitinated and released. On the other hand, the K-less mutant may not bind the SAC (or even the APC/C) with the same affinity, and therefore it may have an increased tendency to become dissociated from the APC/C, bypassing ubiquitination. To test the latter hypothesis, we noticed that there are two
7
lysines in the Mad2-binding motif of Cdc20 (Sironi et al., 2002). We tested if peptides corresponding to the Mad2-binding site of Cdc20 and having the two lysine residues mutated to arginine bound Mad2 with the same affinity as the peptide with the wild type sequence. We found that the binding affinity of Mad2 for the Cdc20 peptides bearing the K-R mutations was 1/2 to 1/3 of that of the wild type peptide. Thus, the interaction of Cdc20 with the APC/C or with the SAC might be impaired in the K-less mutant. Fluorescence anisotropy measurements were made with a Tecan Infinite F200 instrument at 20ºC. We used fixed concentrations (10 nM) of Fluorescein-labeled Cdc20 peptides (synthesized by Mimotopes) with sequences 5FAMNAKILRLSGKPQNAPEG, 5FAM-NARILRLSGKPQNAPEG, or 5FAMNARILRLSGRPQNAPEG. The peptides contain either one or both lysine residues mutated to arginine. Peptides were mixed with increasing concentrations of O-Mad2 in PBS buffer. Reaction mixtures were allowed to equilibrate overnight at 4°C. Fluorescein was excited with polarized light at 485 nm and the emitted light was detected at 535 nm through both horizontal and vertical polarizers. The Kd was determined by fitting the fluorescence polarization data to a quadratic equation.
8
Supplemental References De Antoni, A., Pearson, C.G., Cimini, D., Canman, J.C., Sala, V., Nezi, L., Mapelli, M., Sironi, L., Faretta, M., Salmon, E.D., and Musacchio, A. (2005). The Mad1/Mad2 complex as a template for Mad2 activation in the spindle assembly checkpoint. Curr Biol 15, 214-225. Nilsson, J., Yekezare, M., Minshull, J., and Pines, J. (2008). The APC/C maintains the spindle assembly checkpoint by targeting Cdc20 for destruction. Nat Cell Biol 10, 14111420. Reddy, S.K., Rape, M., Margansky, W.A., and Kirschner, M.W. (2007). Ubiquitination by the anaphase-promoting complex drives spindle checkpoint inactivation. Nature 446, 921-925. Sironi, L., Mapelli, M., Knapp, S., De Antoni, A., Jeang, K.T., and Musacchio, A. (2002). Crystal structure of the tetrameric Mad1-Mad2 core complex: implications of a 'safety belt' binding mechanism for the spindle checkpoint. EMBO J 21, 2496-2506. Sironi, L., Melixetian, M., Faretta, M., Prosperini, E., Helin, K., and Musacchio, A. (2001). Mad2 binding to Mad1 and Cdc20, rather than oligomerization, is required for the spindle checkpoint. EMBO J 20, 6371-6382. Steensgaard, P., Garre, M., Muradore, I., Transidico, P., Nigg, E.A., Kitagawa, K., Earnshaw, W.C., Faretta, M., and Musacchio, A. (2004). Sgt1 is required for human kinetochore assembly. EMBO Rep 5, 626-631.
9