Hsa-miR-942 fingerprint in colorectal cancer through Wnt signaling pathway

Gene 712 (2019) 143958

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Hsa-miR-942 fingerprint in colorectal cancer through Wnt signaling pathway a

a,⁎

a

a

T

a

Ali Fasihi , Bahram M. Soltani , Zahra Sadat Ranjbaran , Sajedeh Bahonar , Romina Norouzi , Shirzad Nasirib a b

Molecular Genetics Department, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran Tehran University of Medical Sciences, Shariati Hospital, Tehran, Iran

A R T I C LE I N FO

A B S T R A C T

Keywords: hsa-miR-942 Wnt signaling CRC Cell cycle

The Wnt signaling pathway has been identified for its function in carcinogenesis and embryonic development. It is known to play a vital role in the initiation and development of colorectal cancer (CRC). Therefore, it is of great importance for CRC research to illuminate the mechanisms which regulate Wnt pathway activity. Here, we intended to examine the effect of hsa-miR-942 (miR-942) on the Wnt signaling activity, cell cycle progression, and its expression in CRC tissues. RT-qPCR results indicated that miR-942 is significantly upregulated in colorectal cancer. Then, overexpression of miR-942 promoted, whereas its inhibition decreased the Wnt signaling activity, detected by RT-qPCR and Top/Fop flash assay. Inhibition of Wnt signaling by using PNU-74654 or IWP2 small molecules indicated that miR-942 applies its effect to the β-catenin degradation complex level. Then, RTqPCR and dual luciferase assay showed that miR-942 upregulated Wnt signaling through direct targeting of APC, which is a tumor suppressor in Wnt signaling pathway. Furthermore, the western blotting analysis indicated that β.catenin, as a main member of Wnt signaling pathway is upregulated following the overexpression of miR-942. Finally, miR-942 overexpression resulted in cell cycle progression in SW480 cells. Taken together, our findings established an oncogenic role for miR-942 in CRC and indicated that this miRNA might be a crucial target for CRC therapy.

1. Introduction It is widely accepted that colorectal cancer (CRC) is the second most common cause of cancer-related death worldwide (de Klerk et al., 2017). Wnt signaling is known as a conserved pathway which is involved in a wide range of developmental and self-renewing procedures and is highly associated with tumorigenesis in CRC (Anastas and Moon, 2013; Polakis, 2012). β-Catenin is a vital component of this pathway that transduces the Wnt signal from the cytoplasm to the nucleus. βcatenin/TCF/LEF transcription factor hyperactivation in the Wnt signaling is a hallmark of CRC development (Polakis, 2012). In unstimulated cells, the free pool of β-catenin is phosphorylated by a complex of proteins that includes the scaffold molecule Axin and adenomatous polyposis coli (APC) and the kinases glycogen synthase kinase3β (GSK3β) and casein kinase 1 (CK1). After phosphorylation, βcatenin is targeted for proteolytic degradation by the proteasome (Li et al., 2012; Rao and Kühl, 2010; Takahashi-Yanaga and Kahn, 2010). APC as a key component of the cytoplasmic Axin degradosome complex, promotes the proteasomal degradation of β-catenin. Following the

inactivation of APC, β-catenin accumulates to high levels and translocate into the nucleus, where it acts as a transcriptional activation factor (Polakis, 2012; Rao and Kühl, 2010). C-MYC and cyclin D1 are two direct transcriptional targets of the Wnt signaling pathway, whose products are pivotal in driving malignancy in both mice and humans (Niehrs and Acebron, 2012; Clevers and Nusse, 2012). Therefore, deregulation of APC could play a key role in the initiation and development of CRC. The miRNAs are small single-stranded conserved RNAs that are primarily transcribed as long primary miRNA transcripts (pri-miRNA), and then sequentially processed from pre-miRNA to ~22 nt mature miRNA (Ha and Kim, 2014). Recent studies have shown that miRNAs play important roles in carcinogenesis by modulating canonical Wnt signaling pathway. For instance, miR-1, miR-25, and miR-613 inhibit the activity of the Wnt signaling while miR-142-3p upregulates this signaling by targeting APC transcripts (Kapinas et al., 2010; Thiele et al., 2016; Mahmood et al., 2016). The similarity of the phenotype between miRNA deficiency and Wnt signaling over-activation brought about this conclusion that Wnt signaling could be hyper-activated by miRNAs

Abbreviations: miR-942, Hsa-miR-942; CRC, colorectal cancer; APC, Axin and adenomatous polyposis coli; GSK3β, glycogen synthase kinase3β; CK1, casein kinase 1 ⁎ Corresponding author. E-mail address: [email protected] (B.M. Soltani). https://doi.org/10.1016/j.gene.2019.143958 Received 22 December 2018; Received in revised form 1 July 2019; Accepted 2 July 2019 Available online 03 July 2019 0378-1119/ © 2019 Elsevier B.V. All rights reserved.

Gene 712 (2019) 143958

A. Fasihi, et al.

2.3. Tumor tissues samples

through targeting tumor suppressor genes such as APC (Mahmood et al., 2016). In the present study, bioinformatics tools suggested miR942 as a candidate that potentially targets APC and GSK3B transcripts as Wnt signaling components and upregulate this pathway. Also, it has been reported that “Linc00675 long non-coding RNA suppresses cell proliferation and metastasis in colorectal cancer via acting on miR-942 and Wnt signaling pathway” (Shan et al., 2018). Here, the effect of miR942 on Wnt signaling activity and its effect on Wnt pathway components has been more investigated using Top/Flash assay, RT-qPCR, dual luciferase assay, and western blotting in the CRC-originated SW480 cell line. Furthermore, the effect of miR-942 on cell cycle status has been studied by flow cytometry.

Fresh-frozen human colorectal cancer tissue samples and their matched normal tissue samples (located > 3 cm away from tumors) were obtained from 20 CRC patients at the Shariati Hospital. None of the patients had the history of chemotherapy or radiotherapy before the surgery and all tumor samples were confirmed by pathological analysis. Tissue samples were collected and snap-frozen in liquid nitrogen and stored at −80 °C, for RT-qPCR analysis. This study included 5 paired tissue of CRC in grade 2, 6 paired tissue in grade 3, and 9 paired tissues in grade 4. Each cancerous sample separately was analyzed compared to its adjacent normal tissue. The cases included 12 (60%) female and 8 (40%) male. The cases were diagnosed with CRC from 2014 to 2016 at the Shariati Hospital, Tehran, Iran. There was no sex, histological or stage restrictions in this study. All processes and activities carried out in studies with human participants were consistent with the ethical standards of the institutional and/or National Research Committee. This study protocol is under the approval of the Ethics Committee of Tarbiat Modares University. All individual participants included in the study signed the informed consent.

2. Materials and methods 2.1. Bioinformatics prediction of candidate miRNAs capable of targeting Wnt signaling In order to predict the miRNAs that are potentially regulating Wnt signaling pathway genes, Diana (http://diana.imis.athena-innovation. gr/DianaTools/index.php?r=microT_CDS/index), mirmap (http:// mirmap.ezlab.org/app/), miRanda (http://www.microrna.org/ microrna/home.do), miRWalk (http://www.umm.uni-heidelberg.de/ apps/zmf/mirwalk/), and Targetscan (http://www.targetscan.org/) were used.

2.4. Cell culture and transfection SW480 cells obtained from Pasteur Institute/Iran were cultured in H-DMEM medium that was supplemented with 10% fetal calf serum (GIBCO) in a humidified atmosphere of 5% CO2 at 37 °C. The cells (first passage) were seeded at 10% confluence and 48 h later were transfected with 400 ng of pre-miR-942 or anti-miR-942, with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA). The empty (mock) as well as scramble vector were used as controls. Cells approved to be cleared of mycoplasma contamination.

2.2. Plasmid construction For the construction of pre-miR-942 and Anti-miR-942 vectors, the pre-miR-942 sequence was PCR-amplified using Taq polymerase and then cloned into pEGFP-C1 vector in direct and indirect orientation, respectively. The entire 3′UTR sequences of APC, APC2, AXIN, and AXIN2 human genes were PCR-amplified using primers containing flanking XhoI and NotI recognition sequence at forward and reverse primers, respectively (Table 1). The PCR products were ligated into the pTG19-R/T vector and, the 3′UTR segment of these genes was subcloned into the NotI/XhoI sites downstream of the stop codon of Renilla luciferase in the psiCHECK II vector (Promega, Madison, WI, USA). All constructs were sequencing.

2.5. Luciferase assays TOP/FOPflash luciferase assay was used for measuring TCF-mediated transcription (Upstate Biotechnology) that reflected the extent of Wnt signaling activity. For this assays, SW480 cells were seeded in 48well plates in 250 μl of medium and allowed to settle for 48 h. Then the cells were co-transfected with Top/Fop flash vector (200 ng), plus 400 ng of pre-miRNA or anti-miRNA expressing vectors. Then after, transfected cells were incubated at 37 °C for 48 h and luciferase activity

Table 1 Primer and oligo sequences that were used in the study. Primer name

Primer sequence, 5′ to 3′

U48 hsa-miR-942 Anchored OligodT Universal-outer Universal-inner B-cat-real time

TGACCCCAGGTAACTCTGAGTGTGT CCTCTTCTCTGTTTTGGCCATG GCGTCGACTAGTACAACTCAAGGTTCTTCCAGTCACGACG(T)18V GCGTCGACTAGTACAACTCAAG AACTCAAGGTTCTTCCAGTCACG Forward: AGAACAGAGCCAATGGCTTG Reverse: CCTGGCCATATCCACCAGAG Forward: CTCCTACGTTGCGGTCACAC Reverse: CGGGTCGCAGATGAAACTCT Forward: GCCACATCGCTCAGACAC Reverse: GGCAACAATATCCACTTTACCAG Forward: GGGCGAAGCCTGTAATCACTGC Reverse: GAGTCGGACAGCTGACGGTG Forward: AAGGTGGACTGATAGGCTGGT Reverse: AGAAGACACACCACAGCCAGG Forward: TGGAACCCAAAGTCCTAAGC Reverse: CTGGGAAAACAACAGAAGTAG Forward: TCCCAGCTCCCTGCCTCTGT Reverse: AGCCAGCCAGACCCAAGTTCT Forward: TATTACGGAATGTGTCCAGCTTG Reverse: CCACATGCATTACTGACTATTGTC Forward: ATGCAGGAGAGCGTGCAGGTC Reverse: TGACGATGGATCGCCGTCCTC

C-myc-real time GAPDH APC2-3′UTR Axin1-3′UTR APC-3′UTR APC2-real time APC-real time Axin1-real time

Amplicon size (base pairs)

2

130 142 115 2515 715 2140 129 133 237

Gene 712 (2019) 143958

A. Fasihi, et al.

was assayed. Direct interaction between miR-942 and 3′UTR sequences of putative target genes was investigated through dual luciferase assay in which, cells were co-transfected using pre-miR-942 (400 ng) and psiCHECK-2–based constructs (200 ng), using Lipofectamine 2000 (Invitrogen). Luciferase and renilla signals of luciferase activity were measured 48 h post transfection, using a dual-luciferase reporter assay system (Promega, Madison, WI, USA).

Table 2 Putative target genes of miR-942 belong to the Wnt signaling pathway. The number of MREs and conserved MREs for miR-942 in the putative target genes are predicted by Diana microT, Mirmap, Mirwalk, and Targetscan software. miRNA

Target genes

Number of MREs

Diana microT

Number of conserved MREs

Mirmap

Mirwalk

2 2 0 0 3 1

6 8 2 3 5 2

Targetscan

2.6. RNA extraction, cDNA synthesis, and RT-qPCR hsa-miR-942

Total RNA was extracted from SW480 cells or frozen tissues using Trizol according to the manufacturer's protocol. Then, one μg total RNA (an aliquot was poly-A adenylated for miRNA detection) was subjected to reverse transcription in 20 μl final volume containing 10 mM dNTP mix and 2 M of anchored oligo-dt. The mix was plated at 60 °C for 10 min, then mixed with 5× RT buffer and 200 U/μl reverse transcriptase at 37 °C for 65 min, 80 °C for 20 min. The cDNA preparation was used for the amplification of mature miR-942, Wnt signaling components and the endogenous controls, U48 and GAPDH, by RTqPCR. Real-time PCR was performed using SYBR Green PCR MasterMix on an ABI 7500 real-time PCR system. The RT-qPCR conditions were: initial denaturation at 95 °C for 20 min, followed by 40 cycles of 95 °C for 15 s, 62 °C for 15 s, and 72 °C for 20 s. The relative amount of miR942 or mRNAs was normalized to the amount of U48 or GAPDH, respectively. The 2−ΔΔCt method was used for evaluation of relative quantification of target gene expression.

a

APCa GSK3Ba CCND1 FZD3 TCF7a WNT5B

9 5 1 5 0 1

1 1 0 0 0 0

Tumor suppressor genes in Wnt pathway.

Accordingly, miR-942 was significantly upregulated in carcinoma tissues compared to their paired normal tissues (2.4 fold, p < 0.01) (Fig. 1A). Hsa-miR-942 putative target genes expression level was also compared between the same CRC tumor versus normal pairs which showed a non-significant expression alteration except WNT3a gene (Fig. 1A). In order to confirm the successful overexpression and downregulation of miR-942, constructed cassettes for this miRNA were transfected into SW480 cells and its expression level was measured through RT-qPCR. Results indicated successful miRNA expression level alteration (Fig. 1B).

2.7. Cell cycle progression analysis

3.3. Expression alteration effect of miR-942 on the activity of Wnt signaling pathway

SW480 cell was transfected with vector overexpressing miR-942 procurers and 48 h later, the cells were trypsinized. Cell pellets that were harvested by centrifugation were washed twice with ice-cold PBS and fixed with ice-cold 70% ethanol at 4 °C. The fixed cells were rehydrated in PBS and subjected to PI/RNase staining followed by flow cytometry. Using flowing software, the percentage of the cells in each phase of the cell cycle was estimated.

Hsa-miR-942 precursor or its cloned antisense construct were independently transfected into SW480 cells along with Wnt pathway reporter plasmid (TOPflash). Top/Fop flash assay was performed, 48 h post transfection. Following the overexpression of miR-942, Wnt activity was significantly increased (2.25 fold, p < 0.05), while its downregulation resulted in significant Wnt signaling attenuation (0.65 fold, p < 0.05 (Fig. 2A). Furthermore, RT-qPCR data showed a significant increase in C-MYC and CYCLIN D1 expression following the overexpression of miR-942, which is further confirmed by downregulation study (Fig. 2B). Both of C-MYC and CYCLIN D1 genes are confirmed downstream target genes of Wnt signaling pathway. Some small molecules like PNU-74654 or IWP-2 are known to affect Wnt signaling components. In order to further investigate the effect of miR-942 on the Wnt signaling activity, precursor of this miRNA or control constructs were transfected into the SW480 cells pre-treated with PNU-74654 or IWP-2 small molecules. Top/Fop flash assay results indicated that overexpression of miR-942 in SW480 cells pre-treated with PNU-74654 did not change the Wnt activity however, its overexpression in the cells pre-treated with IWP-2 resulted in 1.28 fold, p < 0.05 increased Wnt activity (Fig. 2C).

2.8. Statistical analysis Each experiment was repeated at least three times and all of the results are presented as the means ± SD. The statistical significance of the results was determined using Student's t-test or analysis of variance (ANOVA) and post hoc multiple comparisons (Tukey test) for experiments with more than two subgroups, using SPSS v21.0 software. 3. Results 3.1. Bioinformatics search for the miRNAs capable of targeting the genes involved in Wnt signaling Bioinformatics software predicted miR-942 as a potential regulator of APC tumor suppressor gene which is involved in the Wnt signaling pathway. The number of recognition sites for a miRNA (called MRE) in a target gene sequence, determines the intensity of miRNA effect on the regulation of target genes. Based on these criteria, miR-942 that showed > 2 MREs on the genes of Wnt signaling pathway was selected for further investigation. Diana microT bioinformatics software predicted that 3′-UTR sequences of APC, GSK3B and TCF7 tumor suppressor genes are targeted by miR-942. The number of conserved MREs in the Wnt signaling related genes was shown in Table 2.

3.4. Experimental evidence for the interaction of miR-942 with its putative target genes In order to investigate the regulatory effect of miR-942 against Wnt signaling pathway, its effect on the main genes involved in this pathway was investigated. RT-qPCR results indicated that overexpression of miR942 was followed by downregulation of APC gene expression and upregulation of β-catenin and Wnt3a genes expression (Fig. 3A). This result was supported by dual luciferase assay experiments in which, 3′UTR sequences of some of Wnt signaling pathway tumor suppressor genes (APC, APC2, Axin and Axin2) were cloned downstream to the Renilla luciferase in psiCHECK reporter vector. Dual luciferase assay indicated

3.2. Expression status of miR-942 in CRC tissue samples Has-miR-942 expression status in 20 paired colon cancer tumors and their adjacent normal mucosa tissues was investigated by RT-qPCR. 3

Gene 712 (2019) 143958

A. Fasihi, et al.

Fig. 1. Hsa-miR-942 expression alterations in CRC tissue samples and SW480 cell line. A) RT-qPCR results indicated upregulation of miR-942 expression in CRC tissues versus normal pairs. Parallel data suggested downregulation of APC putative target gene (although not significant) and upregulation of Wnt3a gene in the tested CRC tissue samples. B) Successful expression alteration of miR-942 in SW480 cells compared to its related mock control, detected by RT-qPCR. GAPDH and U48 were used as internal controls.

(Fig. 5C).

that miR-942 interacts with APC gene-3′UTR sequence (Fig. 3B). In order to confirm the RT-qPCR and dual luciferase assay results for the effect of miR-942 overexpression on Wnt signaling activity, β-catenin protein level was also measured using western blot analysis. Quantified data indicated that β-catenin (1:1000; Abcam) protein level has been significantly increased (1.91 fold, p < 0.05), following the overexpression of miR-942 in SW480 cells (Fig. 4).

4. Discussion Wnt signaling is a conserved pathway that is involved in a wide range of developmental and self-renewing procedures (Rao and Kühl, 2010). Furthermore, it is highly associated with tumorigenesis in CRC. It is known that miRNAs play vital roles in carcinogenesis through modulating canonical Wnt signaling pathway (Kong et al., 2012; Hayes et al., 2014; Najafi et al., 2017; Dokanehiifard et al., 2017). We have shown elsewhere that, miR-103a and miR-1827 as onco-miRNAs and miR-137 as tumor suppressor exert their effect through regulation of Wnt signaling pathway (Fasihi et al., 2018). Here, we were looking for the other miRNAs that are capable of regulating the genes which are involved in Wnt signaling pathway. Therefore, a bioinformatics analysis was performed looking for the miRNAs that are potentially targeting APC, APC2, AXIN, AXIN2 tumor suppressor genes of the Wnt signaling pathway. The number of MREs on the 3′-UTR sequence of candidate target genes reflects the intensity of target gene downregulation (Lewis et al., 2005). Also, the proper conservation of MREs was another criterion for the selection of candidate miRNA. Finally, miR-942 that showed more than two MREs on the

3.5. The effect of miR-942 expression alteration on the cell cycle status in SW480 cells PI staining flow cytometry was performed following overexpression and downregulation of miR-942 in SW480 cell line to evaluate the effect of this miRNA on the cell cycle distribution. The results indicated that miR-942 overexpression significantly decrease 14% of cell population in G0/G1 stage. While, in anti-miR-942 transfected cells, G0/G1 cells proportion was increased compared to the mock control (Fig. 5A). Hsa-miR-942 overexpression in SW480 cells pre-treated with PNU74654 resulted in no significant alteration of cell cycle phase distribution (Fig. 5B). However, miR-942 overexpression in SW480 cells pre-treated with IWP-2 resulted in a 15% decrease of the cells in G0/G1 phases versus increased S phase, compared with the mock control

Fig. 2. Hsa-miR-942 expression alteration effect on Wnt signaling activity in SW480 cells. A) Hsa-miR-942 overexpression resulted in increased Wnt activity while, its downregulation resulted in decreased Wnt activity, shown by Top/Fop flash assay. B) Results of part A was supported through RT-qPCR against c-Myc and CyclinD1 genes (Wnt signaling downstream genes). B) Hsa-miR-942 overexpression in SW480 cells treated with PNU-74654 did not increase the Wnt activity while its overexpression in SW480 cells treated with IWP-2 resulted in significant increased Wnt activity. 4

Gene 712 (2019) 143958

A. Fasihi, et al.

Fig. 3. RT-qPCR and dual luciferase assay indicated targeting of Wnt signaling component by miR-942. A) RT -qPCR analysis suggested miR-942 as an onco-miR which downregulates APC tumor suppressor gene and upregulates B-catenin and WNT3a oncogenes in Wnt pathway. B) Dual Luciferase assay supported that APC tumor suppressor genes are targeted by miR-942. GAPDH was used as internal control and the significance level of p < 0.05 was considered for statistical analysis of triplicate experiments.

significant expression alteration of target genes (Fig. 1A). According to the Top/Fop flash assay, miR-942 overexpression in SW480 cells (Fig. 1B), significantly increased activity of Wnt signaling pathway, which is confirmed by downregulation study (Fig. 2A). Since C-MYC and CYCLIN D1 are downstream growth-promoting genes that are activated by the Wnt signaling cascade (Niehrs and Acebron, 2012), their expression was also examined by RT-qPCR analysis. RT-qPCR data showed a significant increase in C-MYC, and CYCLIN D1 expression following the overexpression of miR-942, while, its downregulation resulted in significant suppression of C-MYC and CYCLIND1 expression level (Fig. 2B). In order to investigate the direct effect of interested miRNAs on the Wnt signaling activity, precursors of miR-942 and control constructs were transfected into the SW480 cell pre-treated with PNU-74654 or IWP-2 small molecules. IWP-2 is an inhibitor that leads to Wnt retention in the endoplasmic reticulum and disrupts Wnt production (Voronkov and Krauss, 2013) and PNU-74654 targets the interactions between β-catenin and TCF and disrupts the β-catenin/TCF-4 complex (Zhang and Hao, 2015). Overexpression of miR-942 in SW480 cells treated with PNU-74654 did not change the Wnt activity while consistently, its overexpression in the cells treated with IWP-2 resulted in increased Wnt activity (Fig. 2C). The results suggested that miR-942 directly regulate Wnt signaling activity by targeting components upstream of β-catenin and downstream of Wnt signaling pathway receptors. This result was consistent to the RT-qPCR and dual luciferase assay indicating miR-942 suppress inhibitory complex of Wnt signaling through targeting APC (Fig. 3A, B). Furthermore, upregulation of βcatenin and WNT3a following the miR-942 overexpression (Figs. 3A and 4), indicated that miR-942 may positively regulate these genes, as well. Upregulation of miR-942 in CRC tumor samples (Fig. 1A), Wnt signaling upregulation following miR-942 overexpression (Fig. 2A and B), down regulation of APC, and upregulation of β-catenin and WNT3a (Figs. 3A and B and 4), suggest that miR-942 is an onco-miRNA affecting Wnt signaling. On the other hand, it is also known that cancer is characterized by aberrant cell cycle activity (Otto and Sicinski, 2017; Sherr and Bartek, 2017). When miR-942 precursor was overexpressed, it resulted in 14% decrease of the cell population in G0/G1 stage, while its downregulation resulted in increased G0/G1 cells proportion compared to the mock and scrambled control (Fig. 5A). Since, it has been reported that WNT signaling could inhibit apoptosis by activating βcatenin (Chen et al., 2001), decreased G0/G1 proportion in the cell cycle following the miR-942 overexpression, could be attributed to the positive effect of miR-942 on beta-catenin/TCF activity and therefore, inhibition of apoptosis. These results were consistent with the oncogenic function of miR-942 which exerts its effect through coordinated upregulation of Beta-catenin/TCF and downregulation of APC expression (Fig. 6). Furthermore, results of cell cycle analysis in SW480 cells

Fig. 4. Western blot analysis against β-catenin in SW480 cells following the overexpression of miR-942. A) Shows increased β-Catenin protein level following the overexpression of miR-942 in SW480 cells. β-Actin protein was used as a loading control. B) Quantitative analysis of triplicate western blot results. β-Catenin protein level has been increased following the miR-942 overexpression.

candidate target genes, was chosen for further investigation (Table 2). The APC, GSK3B and TCF7 tumor suppressor genes were predicted as potential target genes for miR-942 (Table 2). Hsa-miR-942 is reported to be upregulated in multiple cancers including HCC, gastric cancer, esophageal cancer, and CRC (Liu et al., 2014; Ge et al., 2015; Redova et al., 2013). Overexpression of miR-942 promoted tumorsphere formation and the expression of pluripotencyassociated markers, whereas downregulation of miR-942 had reverse effect (Ge et al., 2015). These studies have suggested an onco-miR role for miR-942 in several cancers. The in-vivo assay also has shown that miR-942 overexpression resulted in higher tumorigenesis in cancer cells. Furthermore, it has been demonstrated that miR-942 targets sFRP4 and TLE1 genes, which are multiple level negative regulators of Wnt signaling cascade. In addition, c-myc could directly bind to the miR-942 promoter and promotes its expression in CRC (Ge et al., 2015). The direct association of miR-942 with CRC through Wnt signaling pathway has not been shown yet. In this study, the expression status of miR-942 was investigated in CRC tissue samples compared to their normal pairs. According to the RT-qPCR results, miR-942 was significantly upregulated in carcinoma tissues compared to their matched normal tissues (Fig. 1A). The expression analysis of putative target genes for this miRNA in tumor and normal tissue indicated non5

Gene 712 (2019) 143958

A. Fasihi, et al.

Fig. 5. Hsa-miR-942 expression alteration effect on SW480 cell cycle status. A) Shows miR-942 overexpression resulted in G0/G1 cell proportion reduction and increased S phase proportion while miR-942 downregulation had reversely increased G0/G1 cell proportion, compared to the mock and scrambled controls. B) Shows the histogram for SW480 cell cycle phases pre-treated with PNU-74654 followed by miR-942 overexpression. The results indicate no significant alteration in cell cycle phases, compared to the mock control. C) The histogram for cell cycle phases of SW480 cells pre-treated with PNU-74654 followed by miR-942 overexpression. Hsa-miR-942 overexpression resulted in a significant reduction of G0/G1 cell proportion in SW480 cells, compared to the mock control.

(bias) our work and there are no interests to declare.

pre-treated with PNU-74654 or IWP-2, followed by miR-942 overexpression, confirmed that this miRNA exerts its oncogenic effect on cell cycle progression through Wnt signaling pathway (Fig. 5B and C). Overall, our data indicated that miR-942 is an onco-miRNA that exerts its effect on the cells through Wnt signaling components (both suppressors and oncogenes). It remains to be tested if this miRNA has the potential of being used as a cancer biomarker in colorectal cancer.

Acknowledgments The authors thank TMU, NIMAD, INSF, and Shariati Hospital for their aids. Funding

Declaration of Competing Interest This work has been supported by financial assistance from the National Institute for Medical Research Development of Iran (NIMAD; grant number 940876).

Authors declare there are no financial and personal relationships with other people or organizations that could inappropriately influence 6

Gene 712 (2019) 143958

A. Fasihi, et al.

Soltani, B.M., 2017. A novel microRNA located in the TrkC gene regulates the Wnt signaling pathway and is differentially expressed in colorectal cancer specimens. J. Biol. Chem. 292, 7566–7577. Fasihi, A., Soltani, B.M., Atashi, A., Nasiri, S., 2018. Introduction of hsa-miR-103a and hsa-miR-1827 and hsa-miR-137 as new regulators of Wnt signaling pathway and their relation to colorectal carcinoma. J. Cell Biochem. 119 (7), 5104–5117. Ge, C., Wu, S., Wang, W., Liu, Z., Zhang, J., Wang, Z., et al., 2015. miR-942 promotes cancer stem cell-like traits in esophageal squamous cell carcinoma through activation of Wnt/β-catenin signaling pathway. Oncotarget 6 (13), 10964. Ha, M., Kim, V.N., 2014. Regulation of microRNA biogenesis. Nat. Rev. Mol. Cell Biol. 15 (8), 509–524. Hayes, J., Peruzzi, P.P., Lawler, S., 2014. MicroRNAs in cancer: biomarkers, functions and therapy. Trends Mol. Med. 20 (8), 460–469. Kapinas, K., Kessler, C., Ricks, T., Gronowicz, G., Delany, A.M., 2010. miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. J. Biol. Chem. 285 (33), 25221–25231. de Klerk, C, Gupta, S, Dekker, E, Essink-Bot, M, 2017. Socioeconomic and ethnic inequities within organised colorectal cancer screening programmes worldwide. Gut 67 (4), 679–687 (gutjnl-2016-313311). Kong, Y.W., Ferland-McCollough, D., Jackson, T.J., Bushell, M., 2012. microRNAs in cancer management. Lancet Oncol. 13 (6), e249–e258. Lewis, B.P., Burge, C.B., Bartel, D.P., 2005. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. cell 120 (1), 15–20. Li, V.S., Ng, S.S., Boersema, P.J., Low, T.Y., Karthaus, W.R., Gerlach, J.P., et al., 2012. Wnt signaling through inhibition of β-catenin degradation in an intact Axin1 complex. Cell 149 (6), 1245–1256. Liu, N., Zuo, C., Wang, X., Chen, T., Yang, D., Wang, J., et al., 2014. miR-942 decreases TRAIL-induced apoptosis through ISG12a downregulation and is regulated by AKT. Oncotarget 5 (13), 4959. Mahmood, S., Bhatti, A., Syed, N.A., John, P., 2016. The microRNA regulatory network: a far-reaching approach to the regulate the Wnt signaling pathway in number of diseases. J. Recept. Signal Transduction 36 (3), 310–318. Najafi, H., Soltani, B.M., Dokanehiifard, S., Nasiri, S., Mowla, S.J., 2017. Alternative splicing of the OCC-1 gene generates three splice variants and a novel exonic microRNA, which regulate the Wnt signaling pathway. RNA 23 (1), 70–85. Niehrs, C., Acebron, S.P., 2012. Mitotic and mitogenic Wnt signaling. EMBO J. 31 (12), 2705–2713. Otto, T., Sicinski, P., 2017. Cell cycle proteins as promising targets in cancer therapy. Nat. Rev. Cancer 17 (2), 93 Feb. Polakis, P., 2012. Wnt signaling in cancer. Cold Spring Harb. Perspect. Biol. 4 (5), a008052. Rao, T.P., Kühl, M., 2010. An updated overview on Wnt signaling pathways. Circ. Res. 106 (12), 1798–1806. Redova, M., Sana, J., Slaby, O., 2013. Circulating miRNAs as new blood-based biomarkers for solid cancers. Future Oncol. 9 (3), 387–402. Shan, Z., An, N., Qin, J., Yang, J., Sun, H., Yang, W., 2018. Long non-coding RNA Linc00675 suppresses cell proliferation and metastasis in colorectal cancer via acting on miR-942 and Wnt/β-catenin signaling. Biomed. Pharmacother. 101, 769–776. Sherr, C.J., Bartek, J., 2017. Cell cycle–targeted cancer therapies. Ann. Rev. Cancer Biol. 1, 41–57 Mar 6. Takahashi-Yanaga, F., Kahn, M., 2010. Targeting Wnt signaling: can we safely eradicate cancer stem cells? Clin. Cancer Res. 16 (12), 3153–3162. Thiele, S., Rachner, T.D., Rauner, M., Hofbauer, L.C., 2016. WNT5A and its receptors in the bone-cancer dialogue. J. Bone Miner. Res. 31 (8), 1488–1496. Voronkov, A., Krauss, S., 2013. Wnt/beta-catenin signaling and small molecule inhibitors. Curr. Pharm. Des. 19 (4), 634–664. Zhang, X., Hao, J., 2015. Development of anticancer agents targeting the Wnt/β-catenin signaling. Am. J. Cancer Res. 5 (8), 2344.

Fig. 6. A schematic representation of the gene interaction modelling (including marked target genes of miR-942 and inhibitor small molecules in Wnt signaling). Hsa-miR-942 upregulates Wnt signaling through direct targeting of APC, which is a tumor suppressor in Wnt signaling pathway. Furthermore, β.catenin is upregulated following the overexpression of miR-942. IWP-2 is an inhibitor that leads to Wnt ligand retention in the endoplasmic reticulum and disrupts Wnt signaling. However, miR-942 affects downstream of the pathway and neutralizes the inhibitory effect of IWP-2 small molecule. On the other hand, PNU74654 that suppresses the interactions between β-catenin and TCF works downstream of the miR-942 target genes and neutralizes the effect of miR-942.

Ethical approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/ or national research committee. This article does not contain any studies with animals performed by any of the authors. References Anastas, J.N., Moon, R.T., 2013. WNT signaling pathways as therapeutic targets in cancer. Nat. Rev. Cancer 13 (1), 11–26. Chen, S., Guttridge, D.C., You, Z., et al., 2001. Wnt-1 signaling inhibits apoptosis by activating beta-catenin/T cell factor-mediated transcription. J. Cell Biol. 152 (1), 87–89. Clevers, H., Nusse, R., 2012. Wnt/β-catenin signaling and disease. Cell 149 (6), 1192–1205. Dokanehiifard, S., Yasari, A., Najafi, H., Jafarzadeh, M., Nikkhah, M., Mowla, S.J.,

7