Human bone mesenchymal stem cells-derived exosomes overexpressing microRNA-26a-5p alleviate osteoarthritis via down-regulation of PTGS2

International Immunopharmacology xxx (xxxx) xxxx

Contents lists available at ScienceDirect

International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp

Human bone mesenchymal stem cells-derived exosomes overexpressing microRNA-26a-5p alleviate osteoarthritis via down-regulation of PTGS2 ⁎

Zhe Jina, , Jiaan Rena, Shanlun Qib a b

Department of Orthopaedics, the First Hospital of China Medical University, Shenyang 110001, PR China Department of Orthopaedics, Dashiqiao Central Hospital, Yingkou 115100, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: microRNA-26a-5p Osteoarthritis Human bone mesenchymal stem cells PTGS2 Synovial fibroblasts

Osteoarthritis (OA) is a degenerative disease characterized by synovium inflammation and articular cartilage damage. The aberrant expression profile of microRNAs (miRNAs) has been implicated in the cartilage of patients with OA. However, how microRNAs carried by exosomes derived from mesenchymal stem cells (MSCs) associated with OA progression is still unknown. Thus, the current study aimed to elucidate the potential therapeutic role of human bone MSC (hBMSC)-derived exosomal miR-26a-5p in OA progression. Initially, the differentially expressed genes related to OA were identified by microarray analysis which provided data predicting the interaction between miR-26a-5p and PTGS2 in OA. Next, miR-26a-5p and PTGS2 were elevated or silenced to determine their effects on the damage of synovial fibroblasts treated with IL-1β. Exosomes derived from hBMSCs were co-cultured with synovial fibroblasts to explore the effect of hBMSC-derived exosomes carrying miR-26a-5p on synovial fibroblast damage. This effect was further verified by an in vivo experiment. Our results revealed that miR-26a-5p was poorly expressed, while PTGS2 was highly expressed in OA patients and synovial fibroblasts treated with IL-1β. Furthermore, miR-26a-5p was identified to specifically target PTGS2. Additionally, the overexpression of miR-26a-5p exerted an alleviatory effect on the damage of the synovial fibroblasts by repressing PTGS2. Moreover, hBMSC-derived exosomes overexpressing miR-26a-5p retarded damage of synovial fibroblasts in vitro and alleviated OA damage in vivo. Taken together, hBMSC-derived exosomes overexpressing miR-26a-5p serve as a repressor for damage of synovial fibroblasts via PTGS2 in OA, which is of significance for the treatment of OA in rats.

1. Introduction As an articular joint disease, osteoarthritis (OA) is one of the most prevalent types of arthritis, which associates with physical disability, mortality, morbidity and mounting expenditures of health care among middle age and elderly people [1,2]. Studies have revealed that approximately 200 million of people suffer from OA, with about 2% of them suffering from body disability [3,4]. Various etiological factors have been implicated in the occurrence of OA including heredity, aging, obesity and joint injury, all of which are accompanied by multiple pathological changes such as synovial inflammation and progressive articular cartilage damage [5]. Synovial inflammation has been frequently found in OA at different stages, and synovitis is correlated with pain and gloomy function as well as occurrence and development of radiographic OA [6]. Mesenchymal stem cells (MSCs) are the products derived from a great variety of mesenchymal tissues including fat or

synovial membrane and bone marrow, which are the progenitors to differentiate into bone cells, cartilage cells, muscle cells and adipocytes [7]. Recent evidence has emphasized their therapeutic value following experiments with constant culture in an undifferentiated environment, including the application of bone mesenchymal stem cells (BMSCs) in OA therapy [8]. Exosomes derived from MSCs have been reported to exert a repressive effect on the degradation of bone and cartilage in OA [9]. As cell-secreted nanovesicles, exosomes consist of multiple types of molecules including DNA/RNA, lipid and protein, which function as attractive carriers for gene therapy and drug delivery and also as critical regulators of intercellular interaction [10]. Exosomes derived from MSCs play regulatory roles in the immune system, inflammatory response inhibition and tissue damage repair [11]. Exosomal microRNAs (miRNAs) derived from hBMSCs have been linked with regulation of osteoblast differentiation [12]. Additionally, as a cluster of short non-

⁎ Corresponding author at: Department of Orthopaedics, the First Hospital of China Medical University, No. 155, Nanjing North Street, Heping District, Shenyang 110001, Liaoning Province, PR China. E-mail address: [email protected] (Z. Jin).

https://doi.org/10.1016/j.intimp.2019.105946 Received 17 April 2019; Received in revised form 24 September 2019; Accepted 26 September 2019 1567-5769/ © 2019 Elsevier B.V. All rights reserved.

Please cite this article as: Zhe Jin, Jiaan Ren and Shanlun Qi, International Immunopharmacology, https://doi.org/10.1016/j.intimp.2019.105946

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

r = microT_CDS/index), miRDB (http://www.mirdb.org/), miRWalk (http://mirwalk.umm.uni-heidelberg.de/), TargetScan (http://www. targetscan.org/vert_71/) and starBase (http://starbase.sysu.edu.cn/ index.php) were employed to predict miRNAs that might regulate the DEGs. The predicted results were analyzed using Jvenn (http://jvenn. toulouse.inra.fr/app/example.html).

coding RNAs, miRNAs have a mean length of 22 nucleotides. The inhibition of the expression of mRNA by binding to the 3′untranslated region (3′UTR) of target mRNA has been reported to participate in numerous biological developments since their first discovery in the earlier 1990s [13]. Accumulating studies have placed additional emphasis on miRNAs regarding their critical role in cartilage homeostasis as well as the pathogenesis and clinical treatment of OA [14]. Furthermore, studies have continued to support the notion that miRNAs play a critical role in mediating cartilage homeostasis and biology as well as the pathogenesis of OA [15]. Evidence has previously presented suggesting the involvement of miRNAs in the development of OA by regulating OA-related signaling pathways, chondrocyte survival and proliferation, the extracellular matrix deposition, and inflammatory mediators which have been linked with the pathogenesis with OA [16]. For instance, as a newly identified critical modulator of cartilage homeostasis miR-26a-5p has been reported to be a promising novel biomarker for OA therapy [17]. Besides, it has been suggested that miR26a exerts its biological effect on the endometrial epithelial cells of dairy goats by targeting prostaglandin-endoperoxide synthase 2 (PTGS2) [18]. PTGS2 encodes cyclooxygenase-2 and is extremely polymorphic, with a class of single nucleotide polymorphisms located in its regulatory regions [19]. A prior study has also identified the highly expressed PTGS2 in human OA chondrocytes [20]. Based on the aforementioned evidence, a hypothesis was proposed that hBMSC-derived exosomes carrying miR-26a-5p affect the progression of OA through PTGS2. Hence, we subsequently co-cultured hBMSCs with synovial fibroblasts to verify our hypothesis and offer a deeper understanding regarding the underlying molecular mechanisms of OA progression, with the hope of identifying a more effective therapeutic approach for OA patients.

2.3. Patient enrollment Synovial tissues were collected from 21 OA patients (8 males and 13 females; aged 50–72 years; with a mean age of 61.43 ± 6.04 years) who had previously undergone a total knee arthroplasty procedure at the orthopedics department of the First Hospital of China Medical University from January 2015 to December 2016. Meanwhile, the synovial tissues (normal control) were collected from 15 donors with accidental deaths (excluding those with OA-related diseases) or normal knee-joint synovium who were subjected to lower limb amputation after acute trauma or open reduction and internal fixation after fracture of tibial plateau. Among them, there were 5 males and 10 females aged between 50 and 76 years with a mean age of 62.67 ± 7.88 years. The OA patients were diagnosed based on the diagnostic criteria of knee OA released by American College of Rheumatology, with any factors that could influence the progression of OA excluded. The synovial tissues were mainly used for RNA extraction and synovial fibroblast culture. 2.4. Isolation and culture of synovial fibroblasts The synovial tissues were cut into 1–2 mm3 pieces, and rinsed three times with phosphate buffer saline (PBS) supplemented with penicillin and streptomycin. Next, the purified synovial tissues were partially transferred into a culture medium, incubated with 1.5 mL Dulbecco's modified Eagle’s medium (DMEM) containing 20% fetal bovine serum (FBS) in a 5% CO2 incubator at 37 °C. The original medium was replaced with 1.5–2 mL DMEM containing 20% FBS every 2–3 days. After one week, cells adherent to the well were considered to be primary synovial cells. After cell confluence, the cells were initially detached with 2 mL trypsin, and then 4 mL DMEM containing 20% FBS was used to terminate the detachment. The cells were subsequently detached from the bottom of the medium via repeated rinses. The medium containing detached cells were transferred into another medium flask at a ratio of 1 : 2 and incubated in a CO2 incubator to observe daily growth of cells. The medium was renewed after cells had adhered to the well, and renewed every 2–3 days or when the color change from red to yellow. Cells at passage 3 were collected for subsequent experiments.

2. Materials and methods 2.1. Ethics statement Written informed consent was obtained from all participating patients prior to the enrollment. All study protocols were approved by Ethic Committee of the First Hospital of China Medical University and in line with the ethical principles for medical research involving human subjects of the Helsinki Declaration. All animal experiments were performed in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal experimental protocols were approved by the Institutional Animal Care and Use Committee of the First Hospital of China Medical University. The animal experiments were conducted based on minimized animal number and the least pains on experimental animals.

2.5. Dual luciferase reporter gene assay The biological prediction tool microRNA.org was used to analyze the targets of miR-26a-5p, and dual luciferase reporter gene assay was performed to examine whether PTGS2 was a direct target of miR-26a5p. The full length of 3′UTR of PTGS2 was cloned, amplified, and introduced into pmiR-RB-REPORTTM (Guangzhou RiboBio Co., Ltd., Guangzhou, Guangdong, China) using restriction enzyme sites XhoI and XbaI. Next, the mutation site of complementary sequences in the seed sequence was designed on the PTGS2 wild type (WT). The target sequence was inserted into the vector using T4 DNA ligase after digestion with the restriction enzymes. Next, the constructed luciferase reporter plasmids WT and mutant (MUT) were co-transfected with miR-26a-5p mimic into HEK-293T cells (Cell Resource Center of Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai, China). After 48 h of transfection, the cells were lysed, with the luciferase activity subsequently determined using the Luminometer TD-20/20 detector (E5311, Promega Corporation, Madison, WI, USA) in accordance with the instructions of the Dual-Luciferase Reporter Assay System reagent kit (Promega Corporation, Madison, WI, USA). Each reaction was performed in triplicate.

2.2. Microarray analysis The OA-related gene expression dataset GSE82107 was retrieved from Gene Expression Omnibus database (https://www.ncbi.nlm.nih. gov/geo/) [21], which included dataset of the synovial tissues from 10 end-stage OA patients and 7 healthy subjects. The dataset annotation platform was GPL570 [HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array. Affy package of R language was applied for background correction and standardized pretreatment [22]. The limma package was employed for differential analyses [23]. Differentially expressed genes (DEGs) were screened out based on the set p. Value < 0.05 and Log FoldChange > 2, and the DEG expression heatmap was plotted. String database (https://string-db.org/) was used to analyze protein-protein interaction (PPI) [24], and Cytoscape 3.6.0 software was applied to construct PPI network of DEGs [25]. Afterwards, miRNA-target gene prediction databases including miRTarBase (http://mirtarbase.mbc.nctu.edu.tw/php/search.php), DIANA (http:// diana.imis.athena-innovation.gr/DianaTools/index.php? 2

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

2.6. Synovial fibroblast treatment and in vitro inflammation induction

Identification of differentiation-induced ability in vitro: Induced differentiation of adipoblasts, osteoblasts and chondroblasts was identified in accordance with the instructions of the MSC tri-lineage differentiation kits (CHEM-2000; Shanghai Qimeng Biotechnology Co., Ltd., Shanghai, China). The staining solutions for adipogenic differentiation, osteogenic differentiation and chondrogenic differentiation were Oil Red O staining solution (CHEM-200002-I), alizarin red staining solution (CHEM-200010-G), and Alcian Blue staining solution (CHEM-200015–1), respectively.

The synovial fibroblasts were treated with negative control (NC) of miR-26a-5p mimic (NC-mimic), miR-26a-5p mimic, NC of miR-26a-5p inhibitor (NC-inhibitor), miR-26a-5p inhibitor, NC of Vector-PTGS2 (Vector) and Vector-PTGS2. miR-26a-5p mimic and miR-26a-5p inhibitor were purchased from GenePharma (Shanghai, China). The respective sequence of miR-26a-5p mimic NC and miR-26a-5p inhibitor NC was 5′-UUCUCCGAACGUGUCACGUTT-3′ and 5′-CAGUACUUUUG UGUAGUACAA-3′. The full coding sequence of PTGS2 was separated from synovial fibroblasts-generated complementary DNA (cDNA) based on the subsequent oligonucleotides: F: 5′-TATGGATCCATGCTCGCCCC GCGCCCTGCTGC-3′; R: 5′-CCGGAATTCCTACAGTTCAGTCGAACGTTC TTT-3′. The full-length fragment was introduced into the pEXP-RB-Mam vector. The plasmids were constructed as follows: the full length of the coding sequences of the PTGS2 was amplified by PCR (Promega Corporation, Madison, WI, USA) with the human synovial fibroblast cDNA as template. The PCR product was purified using an Omega purification kit and digested with plasmids at 37 °C for 4 h. The products were subjected to an agarose gel electrophoresis, and then recovered using an Omega gel recovery kit, followed by measurement of the concentration. DNA and vectors were ligated using T4 ligase (Network Engineering Branch, National Institutes of Health, Bethesda, MD, USA) at 16 °C overnight at a ratio of 3:1. A total of 10 µl products were transformed into DH5α. The single colony was submitted to BioSune (Shanghai, China) for sequencing and plasmid extraction. The transfection procedure of the synovial fibroblasts was performed in accordance with the instructions of the Lipofectamine 2000 (11668–019, Invitrogen Inc., Carlsbad, CA, USA). After being cultured in a CO2 incubator at 37 °C for 6–8 h, the cells were cultured in a fresh complete medium for 48 h for further experiments. After transfection, cells were cultured in monolayer at 37 °C with 5% CO2 at a density of 25,000 cells/cm2 in DMEM containing 10% FBS, 100 U/mL penicillin and 100 mg/mL streptomycin. After 24 h of incubation, the cells were treated with 10 ng/mL interleukin (IL)-1β to trigger an inflammatory response [26].

2.8. Lentivirus infection in hBMSCs Recombinant lentivirus containing miR-26a precursor (pre-miR26a) sequence and negative recombinant lentivirus without miR-26a-5p were prepared by miRNA retrovirus Lenti-virus Vector system (Invitrogen Inc., Carlsbad, CA, USA). The synthetic pre-miR-26a-5p sequence was cloned into the pLenti6.3-EmGFP-Bvel miR plasmid of the retroviral expression vector system (Biovector Inc., Beijing, China), and the DH5α competent cell was transformed. pLenti6.3-EmGFP-Bvel miRmiR-26a-5p plasmid DNA was prepared and purified. With the use of the liposome, the recombinant plasmid and packaging plasmids pMD2. Gand psPAX2 (Addgen, Cambridge, MA, USA) containing the target gene were co-transfected into 293T cells to construct experimental lentivirus. Similarly, plasmid and packaging plasmids without the target gene were co-transfected into 293T cells to construct NC lentivirus. After incubation with 5% CO2 at 37 °C for 4–6 h, the cells were further cultured in DMEM supplemented with 10% FBS for 72 h. The supernatants containing virus were collected, followed by a filtration with a 0.45 μm cellulose acetate filter (Merck Millipore, Burlington, MA, USA) and being preserved at −80 °C. The hBMSCs at the logarithmic growth phase were subsequently seeded into a 6-well plate at a seeding density of 1 × 106 cells/mL and incubated at 37℃ with 5% CO2 for 24 h. Lentivirus solution was prepared by dilution with Roswell Park Memorial Institute 1640 medium supplemented with 10% FBS, added with 5 μg/mL coagel to enhance infection. After the NC group had been set, the medium was replaced with fresh complete medium following a 24-h period of infection. After further culture for 72 h, the exosome was extracted for subsequent experiments.

2.7. Isolation and culture of hBMSCs A total of 15 mL marrows was collected from the ilium of healthy volunteers and centrifuged to prepare 4 × 107 cells/mL cell suspension. Next, 5 mL cell suspension was added to 5 mL Percoll separation medium (P8370, Beijing Solabio Life Sciences Co., Ltd., Beijing, China) and centrifuged. Next, cell layer in the middle was centrifuged with PBS and seeded into a 50 mL culture flask at the density of 1 × 106 cells/mL, followed by primary culture with 10 mL hBMSCs complete medium. The medium was renewed after 24 h and 48 h respectively. When cell confluence reached 70 – 80%, cells were trypsinized and passaged for further culture. hBMSCs at passage 3–5 were identified when cell confluence reached 80–90%. Flow cytometry was employed to identify the hBMSCs phenotype. In brief, the cells were trypsinized, rinsed two times by fluorescence-activated cell sorting buffer containing Ca2+, Mg2+-free PBS, 1% bull serum albumin and 13.6 mmol/L sodium citrate, centrifuged and counted (1 × 107 cells/mL). Next, 200 μL cell suspension was added with fluorescence-labeled rabbit antibodies against CD34 (ab81289, 1 : 100), CD45 (ab10558, 1 : 150), CD44 (ab157107, 1 : 500), CD29 (ab179471, 1 : 1000), CD71 (ab1086, 1 : 50) and human leukocyte antigen DR (HLA-DR; ab20181, 1 : 1000). All aforementioned antibodies were purchased from Abcam Inc. (Cambridge, MA, USA). Subsequently, the isotype NC immunoglobulin 2a-phycoerythrin and G1-fluorescein isothiocyanate (FITC) (10 μL each) were completely mixed and permitted to react at room temperature for 30 min. A flow cytometer was employed to detect the cell surface antigen following centrifugation, after which the cotfit software was used to analyze the results [27].

2.9. Isolation and identification of exosomes derived from hBMSCs Next, hBMSCs were seeded into a 6-well plate at a density of 2 × 105 cells/well. After the cells were observed to have adhered to the well, they were further cultured in exosome-free serum (EXODP-FBS50A; Shanghai chembio Co., Ltd., Shanghai, China) for 48 h. The exosomes were then extracted from the supernatant and resuspended using PBS in strict accordance with the instructions of the ExoQuick-TC reagent kit (EXOTC10A-1, Shanghai Shanran Biological Technology Co., Ltd., Shanghai, China). Next, the transmission electron microscope (TEM) was used to analyze the morphology of the exosomes, and western blot analysis was conducted to detect the expression of specific markers of exosomes (HSP70, CD63 and CD9) [28]. Finally, Zetasizer Nano ZS (Malvern Instruments, Malvern, UK) was applied to analyze the particle size distribution [29]. The protein concentration in exosomes was determined by bicinchoninic acid (BCA) assay. 2.10. Fluorescence labeling of hBMSCs and co-culture with synovial fibroblasts The hBMSCs were subsequently treated with 0.25% trypsin and resuspended by DMEM containing 10% FBS with cell concentration adjusted into 1 × 106 cells/well. Cy3-labeled miR-26a-5p (miR-26a-5pCy3) was purchased from GenePharma, Shanghai, China, and was transfected into the hBMSCs according to the protocols of lipofectamin2000 (11668–019, Invitrogen Inc., Carlsbad, CA, USA) in order 3

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

FITC fluorescence detected using a 525 nm band-pass filter, and PI detected using a 620 nm band-pass filter. The experiment was repeated three times.

to identify the delivery of exosomal miR-26a-5p. The Cy3-miR-26a-5pexpressing hBMSCs were then seeded into a 6-well plate and co-cultivated with synovial fibroblasts in a Transwell chamber for 2–4 d. Besides, FITC Phalloidin (Thermo Fisher Scientific Inc., Waltham, MA, USA) was employed to stain the cytoskeleton of synovial fibroblasts. Lastly, a confocal microscope was utilized to observe the exosomal miR26a-5p.

2.14. Establishment of a rat model of OA A total of 50 Wistar rats were randomly grouped into the control (Wistar rats without treatment), sham (after anesthesia by intraperitoneal injection of 3% pentobarbital sodium [P3761; SigmaAldrich Chemical Company, St Louis, MO, USA], the inside skin of left knee joints of the rats were opened to expose the joints, followed by skin suture), OA (OA rats), EXO-miR-NC + OA (after successful model establishment, OA rats were subjected to 1-week joint injection of 250 ng/5 µL EXO-miR-NC) and EXO-miR-26a-5p + OA (after successful model establishment, OA rats were subjected to 1-week joint injection of 250 ng/5 µL EXO-miR-26a-5p) groups (10 rats each group) [9]. An OA rat model was established based on the method previously described by Kamekura S [32]. Eight weeks later, rat serum, condylar tissues as well as the synovial tissue of the knee joint were collected.

2.11. Exosome treatment Synovial fibroblasts were seeded into the 6-well plates one day prior to treatment. When cell confluence reached 70%, 2 µg exosomes (EXOmiR-NC and EXO-miR-26a-5p) were introduced into the synovial fibroblast culture medium supplemented with 10 ng/mL IL-1β. Synovial fibroblasts treated with PBS were regarded as the blank controls. After 48 h of treatment, cells were collected for subsequent use [9]. 2.12. 5-Ethynyl-2′-deoxyuridine (EdU) assay EdU is a thymidine nucleoside analogue, which can penetrate into DNA molecules in replacement of thymine (T) during cell proliferation. It can be used to rapidly detect DNA replication activity of cells based on the specific reaction between EdU and Apollo fluorescent staining solution. Therefore, this assay is suitable for studying cell proliferation, cell differentiation, growth and development, DNA repair, virus replication and cell marker tracing, especially for screening siRNA, miRNA, small molecular compounds and other drugs. EdU labeling/ detection kit purchased from Ribobio (Guangzhou, Guangdong, China) was used in this assay. The cells were cultured with 50 μM EdU for 12 h. The cells were then fixed with 4% paraformaldehyde for 30 min, incubated with 5% glycine for 5 min, and ruptured using 0.5% Triton X100. The cells were subsequently incubated with antibody against EdU for 30 min, stained with 5 μg/mL Hoechst 33,342 for 30 min, and analyzed and photographed under a fluorescence microscope.

2.15. Synovial tissue collection and pathological observation The rats were anesthetized via an intraperitoneal injection with 3% pentobarbital sodium and subsequently euthanized. Following the removal of fur and tendon tissues, conventionally fixation, and decalcification, the condylar joint was then dissected, dehydrated conventionally, paraffin-embedded, and sliced into sections for hematoxylin-eosin (HE) staining. The skin was opened in a lengthwise manner along with middle part of the right posterior knee joint to expose the knee joint-centered area. An incision was made from the upper part of skeleton to the femur after which the skin was separated from both sides of the skeleton to the tibia which allowed the knee joint cavity to be opened. The synovial tissues were cut, fixed with polyformaldehyde, dehydrated, paraffin-embedded, and sliced into sections for HE staining. The pathological changes of condylar joint tissues and synovial tissues were analyzed under a microscope. The pathological changes identified were scored in a blind manner based on the degree of synovitis inflammation, synovial thickening, and subchondral bone erosion using a 0–3 subjective grading system (0, normal; 1, mild; 2, moderate; 3, severe) as previously published [33]. The pathological score was expressed as the total subjective scores of 3 parameters and was ≤ 9. The average of the sum of score of condylar tissues at the bilateral knee joints was regarded as the pathological score of each rat, with a higher score representing a greater degree of joint injury severity.

2.13. Annexin-V-propidium iodide (PI) staining After a 48-h period of transfection, the cells were detached with trypsin free of ethylene diamine tetraacetic acid (YB15050057, Yubo Biotechnology Co., Ltd., Shanghai, China), centrifuged and rinsed with cold PBS. Next, Annexin-V-FITC, PI and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer solution were made into Annexin-V-FITC/PI staining solution as per the instructions of the Annexin-V-FITC cell apoptosis detection kit (APOAF-20TST, SigmaAldrich, St. Louis, MO, USA). Every 100 μL staining solution was used to resuspend 1 × 106 cells. After incubation at room temperature for 15 min, 1 mL of HEPES buffer solution (PB180325, Procell Life Science & Technology Co., Ltd., Wuhan, Hubei, China) was added. Annexin-V, a member of the phospholipid binding protein family, selectively binds to phosphatidylserine (PS) in a calcium ion-dependent manner. In a viable cell, PS is expressed only on the inner leaflet of the cell membrane, that is, on the side adjacent to the cytoplasm. After activation of the cell death program, PS is externalized rapidly to the outer leaflet of the cell membrane [30]. PS externalization is considered to be closely associated with the activation of apoptosis and can be detected by flow cytometers or fluorescence microscopes with FITC-labeled Annexin V, that is, Annexin V-FITC. PI is a nuclear staining reagent that can stain DNA, which releases red fluorescence after being embedded into DNA. PI cannot penetrate the complete cell membrane, but can penetrate the necrotic cells or the cells that lose the cell membrane integrity in the late stage of apoptosis. Therefore, when the Annexin-V is used in combination with PI, PI is excluded from viable cells (Annexin V−/PI−) and early apoptotic cells (Annexin V+/PI−), while the advanced apoptotic cells and the necrotic cells are simultaneously stained with FITC and PI to present double-positive (Annexin V+/PI+) [31]. The cells were excited using a laser light at a wavelength of 488 nm, with

2.16. Immunohistochemistry The synovial tissues were fixed, dehydrated and embedded. The tissues were then incubated overnight at 4 °C with 50 μL primary antibody, rabbit anti-mouse antibodies against the marker molecules of OA including matrix metalloproteinase (MMP)-3 (ab53015, 1 : 400, Abcam Inc., Cambridge, UK) and MMP-13 (ab219620, 1 : 1000, Abcam Inc., Cambridge, UK). The tissues were subsequently incubated with secondary antibody, goat anti-rabbit antibody against immunoglobulin G (IgG; ab150077, 1 : 1000, Abcam Inc., Cambridge, UK) at 37 °C for 1 h. Immunoreactivity was visualized using developed with diaminobenzidine (Sigma-Aldrich, St. Louis, MO, USA), counterstained with hematoxylin (Shanghai Bogoo Biological Technology Co., Ltd., Shanghai, China) and mounted. The primary antibody was replaced by PBS as the NC, while the normal tissues were considered to be the positive control. The sections were then observed under an optical microscope (XSP-36, Posterscope Optical Instruments Co., Ltd., Shenzhen, Guangdong, China) with the images captured. Finally, 5 high-power visual fields (200×) were randomly selected from each section. The expression of MMP-3 and MMP-13 in synovial tissues was 4

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

2.20. Western blot analysis

quantified with the optical density (OD) value per unit area calculated to obtain the average value.

The total protein was collected from the cells, with the protein concentration determined using a BCA kit (20201ES76, Yeasen Company, Shanghai, China). Next, 20 μg/well protein was loaded and separated by 8% sodium dodecyl sulfate–polyacrylamide gel electrophoresis for 1 h. The protein was then transferred onto a polyvinylidene fluoride membrane and subsequently sealed with 5% skim milk. Afterwards, the membrane was probed with rabbit polyclonal antibodies against β-actin (ab8226, 1 : 500), cleaved Caspase-3 (ab13847, 1 : 50), IL-6 (ab9324, 1 : 1000), tumor necrosis factor (TNF)-α (ab220210, 1 : 50), IL-8 (ab18672, 1 : 2000), B-cell lymphoma-2 (Bcl-2; ab59348, 1 : 500), Bcl2 Associated X (Bax; ab32503, 1 : 1000), CD63 (ab59479, 1 : 200) and Hsp70 (ab2787, 1 : 1000) overnight at 4 °C. The membrane was then incubated with secondary antibody, horse radish peroxidase-labeled goat anti-rabbit antibody against IgG (ab150077, 1 : 1000) at room temperature for 1 h. All aforementioned antibodies were purchased from Abcam Inc. (Cambridge, UK). Next, the membrane was reacted with an enhanced chemiluminescence solution (ECL808-25, Biomiga Inc, San Diego, CA, USA) at room temperature for 1 min, and then visualized using an optical luminescence instrument (GE Healthcare, Pittsburgh, PA, USA). At last, Image Pro Plus 6.0 (Media Cybernetics Inc., Rockville, MD, USA) was utilized to analyze relative protein expression by gray scanning the protein bands. Each reaction was performed in duplicate.

2.17. Enzyme linked immunosorbent assay (ELISA) The expression of IL-1β was determined on the basis of the specifications provided by the ELISA reagent kit (Neobioscience Biotechnology Co., Ltd., Shenzhen, Guangdong, China). The OD value of each well was determined at a wavelength of 450 nm within 20 min.

2.18. TdT-mediated dUTP-biotin nick end-labeling (TUNEL) After the synovial tissues had been fixed, dehydrated and embedded, cell apoptosis was examined using a TUNEL reagent kit (11684817910, Rochester Hills, Oakland, MI, USA). Next, five 200-fold fields were counted on each slice, with the number of apoptotic cells out of every 100 cells calculated and regarded as the apoptotic index.

2.19. Reverse transcription quantitative polymerase chain reaction (RTqPCR) The primers of PTGS2 were designed by Primer 5 software based on the related sequences provided by GeneBank, while primers of miR26a-5p were designed and synthetized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). The primers of downstream target genes were designed by homology analysis with BLAST software. The primer sequences are depicted in Table 1. After transfection, the total RNA of the cells was extracted using a Trizol kit (15596–026, Invitrogen Inc., Carlsbad, CA, USA). Next, cDNA sample required for quantitative detection of miRNA was reversely transcribed in accordance with the instructions of the TaqMan MicroRNA Assays Reverse Transcription Primer kit (4427975, Applied Biosystems, Inc., CA, USA). The cDNA needed for conventional quantitative PCR detection was provided by PrimeScript product RT reagent Kit with gDNA Eraser Perfect RT (RR047A, Takara Holdings Inc., Kyoto, Japan), followed by quantitative PCR amplification. RT-qPCR was conducted with the following condition: 1 cycle of pre-denaturation at 95 °C for 5 min, and 45 cycles of denaturation at 95 °C for 20 s, annealing at 60 °C for 1 min and extension at 72 °C for 30 s. The results were analyzed using the 2−ΔCt method. U6 was regarded as the internal reference of miR-26a-5p, while β-actin was regarded as the internal reference of the other coding genes. Each experiment was repeated 3 times.

2.21. Statistical analysis All data analyses were performed using SPSS 21.0 software (IBM Corp., Armonk, NY, USA). The measurement data were expressed as mean ± standard deviation. When the data were consistent with normal distribution and homogeneity of variance, a t-test was applied for comparison of data under matched-pair design. Unpaired t-test was applied for comparison of data with normal distribution and homogeneity of variance between two groups. One-way analysis of variance (ANOVA) was used for data comparison among multiple groups, with a Tukey’s test conducted for post hoc test. p < 0.05 was considered to be indicative of statistical significance.

3. Results 3.1. PTGS2 is significantly upregulated in OA Initially, microarray analysis was conducted to screen out the DEGs of OA. OA-related gene expression dataset GSE82107 was analyzed by R language. The top 100 DEGs were introduced into the String database for gene interaction analysis as well as construction and visualization of the PPI network of DEGs with Cytoscape (Fig. 1A). The genes predominately correlated with other genes were localized in the center, suggesting their possible association with the disease, of which the top two were FOS and PTGS2. Existing literature has suggested that inhibition of PTGS2 exerts a protective effect on OA [34]. The heatmap of the top 50 DEGs in GSE82107 illustrated that PTGS2 was highly expressed in OA relative to normal controls (Fig. 1B). Hence, we placed additional emphasis on PTGS2. Furthermore, we explored the effect of PTGS2 on OA by determining its expression in OA and normal synovial tissues as well as in normal synovial fibroblasts and those treated with IL-1β using RT-qPCR. The results revealed that compared with normal synovial tissues, OA tissues exhibited elevated PTGS2 expression (p < 0.05; Fig. 1C), and up-regulated PTGS2 was also detected in synovial fibroblasts treated with IL-1β when compared to normal synovial fibroblasts (p < 0.05) (Fig. 1D). Thus, PTGS2 was predicted to be implicated in OA progression.

Table 1 Primer sequence for RT-qPCR. Gene

Primer sequences (5′-3′)

miR-26a-5p

F: GCCTTGCGTCAATCTTTTCATCTTG R: GATTGACGCAAGGCTAAGAAG F: GAGAGATGTATCCTCCCACAGTCA R: GACCAGGCACCAGACCAAAG F: AAGCCAGAGCTGTGCAGATGAGTA R: TTCGTCAGCAGGCTGCATTTGT F: ACCAGCTAAGAGGGAGAGAAGCAA R: TCAGTGCTCATGGTGTCCTTTCCA F: TCTTGGCAGCCTTCCTGATTTCTG R: GGGTGGAAAGGTTTGGAGTATGTC F: CGCTTCGGCAGCACATATACTAT R: CGCTTCACGAATTTGCGTGTCAAT F: CGGGATCCATGGATGATGATATCGCCGCGC R: CGGAATTCCTAGAAGCATTTGCGGTGGACG

PTGS2 IL-6 TNF-α IL-8 U6 β-actin

Note: F, forward; R, reverse; RT-qPCR, reverse transcription quantitative polymerase chain reaction; miR-26a-5p, microRNA-26a-5p; PTGS2, prostaglandin-endoperoxide synthase-2; IL, interleukin; TNF; tumor necrosis factor. 5

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Fig. 1. PTGS2 is assumed as a putative gene that might participate in OA progression. (A), PPI network of the top 100 DEGs in OA-related gene expression dataset GSE82107. (B), heatmap of the top 50 DEGs in OA-related gene expression dataset GSE82107. The abscissa represents the sample number, and the ordinate represents DEGs; upright histogram is color gradation, where each rectangle corresponds to a sample value. (C), mRNA expression of PTGS2 in OA tissues and normal synovial tissues detected by RT-qPCR. D, mRNA expression of PTGS2 in normal synovial fibroblasts and those treated with IL-1β determined by RT-qPCR. Normal, n = 15; OA, n = 21; * p < 0.05 compared with normal synovial tissues or normal synovial fibroblasts. The data are measurement data, expressed as mean ± standard deviation and analyzed by independent sample t test. PTGS2, prostaglandin-endoperoxide synthase-2; OA, osteoarthritis; DEG, differentially expressed gene; RT-qPCR, reverse transcription quantitative polymerase chain reaction; IL, interleukin.

Fig. 2. miR-26a-5p targets PTGS2 to influence OA progression. (A), comparisons of predicted miRNAs that regulate PTGS2 in a Venn map. (B), binding sites between has-miR-26a-5p and mmu-miR-26a-5p and PTGS2 predicted by online websites. (C), luciferase activity of PTGS2-WT and PTGS2-MUT in HEK-293T cells treated with miR-26a-5p mimic or NC-mimic assessed by dual luciferase reporter gene assay. (D), expression of miR-26a-5p and PTGS2 in synovial fibroblasts after alteration of miR-26a-5p detected by RT-qPCR. (E), protein expression of PTGS2 in synovial fibroblasts after alteration of miR-26a-5p determined by western blot analysis. (F), expression of miR-26a-5p in OA tissues and normal synovial tissues examined by RT-qPCR. (G), expression of miR-26a-5p in normal synovial fibroblasts and those treated with IL-1β evaluated by RT-qPCR. * p < 0.05 compared with treatment of NC-mimic or NC-inhibitor or normal synovial tissues or normal synovial fibroblasts. The data are measurement data and expressed as mean ± standard deviation. Comparisons between two groups are analyzed by independent sample t test, while comparisons among multiple groups are analyzed by one-way analysis of variance, and Tukey’s test is conducted for post hoc test. PTGS2, prostaglandinendoperoxide synthase-2; miR-26a-5p, microRNA-26a-5p; OA, osteoarthritis; RT-qPCR, reverse transcription quantitative polymerase chain reaction; IL, interleukin; NC, negative control.

6

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Fig. 3. miR-26a-5p elevation induces relieved damage of synovial fibroblasts. Synovial fibroblasts are transfected with miR-26a-5p mimic or miR-26a-5p inhibitor. (A), expression of miR-26a-5p in synovial fibroblasts determined by RT-qPCR. (B), cell proliferation of synovial fibroblasts assessed by EdU assay (×200). (C), cell apoptosis of synovial fibroblasts examined by flow cytometry. (D), protein expression of Bcl-2, Bax and cleaved Caspase-3 determined by western blot analysis. (E), mRNA expression of IL-6, TNF-α and IL-8 evaluated by RT-qPCR. (F), protein expression of IL-6, TNF-α and IL-8 evaluated by western blot analysis. * p < 0.05 compared with the treatment of NC-mimic or NC-inhibitor. The data are measurement data and expressed as mean ± standard deviation. Comparisons among multiple groups are analyzed by one-way analysis of variance, and Tukey’s test is conducted for post hoc test. PTGS2, prostaglandin-endoperoxide synthase-2; miR26a-5p, microRNA-26a-5p; RT-qPCR, reverse transcription quantitative polymerase chain reaction; IL, interleukin; EdU, 5-Ethynyl-2′-deoxyuridine; Bcl-2, B-cell lymphoma 2; Bax, Bcl2 associated X; TNF, tumor necrosis factor; NC, negative control.

relative to normal synovial fibroblasts (p < 0.05; Fig. 2G). Taken together, the results indicated that miR-26a-5p was poorly expressed in OA and could specifically bind to PTGS2.

3.2. PTGS2 is a putative target of miR-26a-5p Subsequently, miRTarBase, DIANA, miRDB, miRWalk, TargetScan and starBase databases were applied to predict the miRNAs that could potentially regulate PTGS2 expression, with 21, 203, 78, 1978, 597 and 49 miRNAs identified respectively. A Venn map was plotted on the basis of comparisons on those miRNAs (Fig. 2A), which revealed there to be only one intersected miRNA, hsa-miR-26a-5p that was very likely to regulate PTGS2. Thus, we proposed the speculation that miR-26a-5p could influence OA progression by targeting PTGS2. In order to verify the aforementioned finding, six online websites revealed that specific binding sites existed between PTGS2 mRNA and miR-26a-5p (Fig. 2B). Besides, miR-26a-5p could target both human and murine PTGS2 3′-UTR, with conserved target sequence (UACUU GAA), suggesting that PTGS2 might be the downstream target gene of miR-26a-5p. Moreover, according to dual luciferase reporter gene assay, compared with the introduction of NC-mimic, the luciferase activity decreased after the introduction of miR-26a-5p mimic and PTGS2-WT reporter plasmid (p < 0.05), while no significant difference was detected following the introduction of miR-26a-5p mimic and PTGS2-MUT reporter plasmid (p > 0.05; Fig. 2C), highlighting that miR-26a-5p could specifically bind to PTGS2. Next, the expression of miR-26a-5p and PTGS2 was determined in synovial fibroblasts treated with miR-26a-5p mimic or miR-26a-5p inhibitor. The results revealed that miR-26a-5p mimic triggered an increase in the expression of miR26a-5p as well as a decrease in the expression of PTGS2 (p < 0.05), while miR-26a-5p inhibitor induced reverse effects (p < 0.05; Fig. 2DE). Next, RT-qPCR was performed again to detect expression of miR26a-5p in OA and normal synovial tissues as well as in normal synovial fibroblasts and those treated with IL-1β. The results revealed that the OA tissues had a decrease in miR-26a-5p expression when compared to the normal synovial tissues (p < 0.05; Fig. 2F). The synovial fibroblasts treated with IL-1β exhibited a reduced miR-26a-5p expression

3.3. Overexpression of miR-26a-5p alleviates the damage of synovial fibroblasts Afterwards, in order to investigate the effect of miR-26a-5p in synovial fibroblasts, the cells were transfected with miR-26a-5p mimic or miR-26a-5p inhibitor, followed by the IL-1β treatment to induce the inflammation in the cells. RT-qPCR was performed to determine transfection efficiency in synovial fibroblasts. The results demonstrated that the transfection plasmids were successfully delivered (p < 0.05; Fig. 3A). EdU assay and flow cytometry were subsequently performed to assess proliferation and apoptosis of synovial fibroblasts, respectively, the results of which revealed there to be a decrease in cell proliferation as well as an increase in apoptosis following the treatment of miR-26a-5p mimic. These trends could be reversed following treatment with miR-26a-5p inhibitor (p < 0.05; Fig. 3B and C). RT-qPCR and western blot analysis were conducted to evaluate mRNA and protein expression of apoptosis-related proteins (Bcl-2, Bax TNF-α and cleaved Caspase-3) and pro-inflammatory factors (IL-6, TNF-α and IL-8). As shown in Fig. 3D–F, the treatment of miR-26a-5p mimic led to a decline in the expression of Bcl-2, IL-6, TNF-α and IL-8 which was accompanied by an elevation in expression of Bax and cleaved Caspase-3, while treatment with miR-26a-5p inhibitor resulted in an opposite tendency. Therefore, overexpressed miR-26a-5p increased apoptosis and reduced inflammatory response of synovial fibroblasts, and the damage of synovial fibroblasts was alleviated by overexpressed miR-26a-5p.

7

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Fig. 4. miR-26a-5p contributes to alleviated damage of synovial fibroblast by downregulating PTGS2. Synovial fibroblasts were transfected with Vector-PTGS2 NC, Vector-PTGS2, Vector-PTGS2 + miR-26a-5p mimic or Vector-PTGS2 + NC-mimic. (A), mRNA expression of PTGS2 in synovial fibroblasts detected by RT-qPCR. (B), protein expression of PTGS2 in synovial fibroblasts detected by western blot analysis. (C), cell proliferation of synovial fibroblasts evaluated by EdU assay (×200). (D), cell apoptosis of synovial fibroblasts assessed by flow cytometry. (E), protein expression of Bcl-2, Bax and cleaved Caspase-3 determined by western blot analysis. (F), mRNA expression of IL-6, TNF-α and IL-8 examined by RT-qPCR. (G), protein expression of IL-6, TNF-α and IL-8 examined by western blot analysis. * p < 0.05 compared with the treatment of Vector-PTGS2 NC or Vector-PTGS2 + NC-mimic. The data are measurement data and expressed as mean ± standard deviation. Comparisons among multiple groups are analyzed by one-way analysis of variance, and Tukey’s test is conducted for post hoc test. PTGS2, prostaglandin-endoperoxide synthase-2; miR-26a-5p, microRNA-26a-5p; RT-qPCR, reverse transcription quantitative polymerase chain reaction; IL, interleukin; EdU, 5-Ethynyl-2′deoxyuridine; Bcl-2, B-cell lymphoma 2; Bax, Bcl2 associated X; TNF, tumor necrosis factor; NC, negative control.

flow cytometry. The results revealed that CD29, CD44 and CD71 were positive, while CD34, CD45 and HLA-DR were negative, which confirmed that the hBMSCs had preserved the stem cells characteristics (Fig. 5A). Next, the results of Oil red O staining revealed that the red lipid droplets could be observed inside cells, some of which were fused into larger lipid droplets, while others were arranged in string beads. The results of alizarin red staining exhibited a large number of red nodules and red calcium precipitation and unclear cellular structure; Alcian Blue staining results showed that blue staining (acidic mucopolysaccharide) could be seen in cells (Fig. 5B). These results suggested that the cultured cells could differentiate into adipoblasts, osteoblasts, and chondroblasts, implying that these cells were hBMSCs. Next, the exosomes were extracted from hBMSCs, which were analyzed under a TEM. Our observations indicated that the exosomes derived from hBMSCs were round or oval-shaped with an uneven size and the diameter ranging from 30 − 100 nm (Fig. 5C). The results of the western blot analysis revealed that positive CD63, Hsp70 and CD9 expression was observed in the exosomes (Fig. 5D). Zetasizer Nano ZS was used to analyze the particle size distribution, which found the particle size of exosomes was mainly ranged from 50 − 100 nm (Fig. 5E). Next, hBMSCs transduced with miR-26a-5p-Cy3 were co-cultured with synovial fibroblasts transfected with fluorescence-labeled pCDNA3.1-GFP. RT-qPCR was performed to determine the expression of miR-26a-5p in hBMSCs and in exosomes derived from hBMSCs after transfection with miR-26a-5p mimic. The results indicated that either hBMSCs or exosomes from hBMSCs displayed increased miR-26a-5p expression (p < 0.05; Fig. 5F). Besides, under the observation of a laser scanning confocal microscope, the hBMSCs as well as the synovial

3.4. miR-26a-5p retards synovial fibroblast damage potentially by targeting PTGS2 Next, we set out to explore the association of miR-26a-5p and PTGS2 in synovial fibroblasts, with the cells transfected with miR-26a5p mimic and overexpressed PTGS2. Next, RT-qPCR, western blot analysis, EdU and flow cytometry were conducted to assess expression of PTGS2, apoptosis-related proteins (Bcl-2, Bax and cleaved Caspase-3) and pro-inflammatory factors (IL-6, TNF-α and IL-8), cell proliferation and apoptosis, respectively. As shown in Fig. 4A and B, overexpressed PTGS2 elevated expression of PTGS2. In addition, the treatment of oePTGS2 increased cell proliferation (Fig. 4C) and declined cell apoptosis (Fig. 4D). Also, after overexpression of PTGS2, expression of Bax and cleaved Caspase-3 was reduced and increased Bcl-2 expression was elevated (Fig. 4E), and expression of IL-6, TNF-α and IL-8 also was enhanced (Fig. 4F and G, p < 0.05). However, when compared with overexpressed PTGS2 alone, the overexpressed PTGS2 combined with miR-26a-5p mimic reversed the aforementioned results with the above indicators (p < 0.05; Fig. 4A–G). Thereby, miR-26a-5p alleviated synovial fibroblast damages mediated by its target PTGS2. 3.5. hBMSC-derived exosomes transfer miR-26a-5p into synovial fibroblasts Next further investigations were performed to assess the vector function of hBMSC-derived exosomes transporting miR-26a-5p to synovial fibroblasts. Initially, the cell surface antigens (CD29, CD44, CD71, CD34, CD45 and HLA-DR) were identified on the hBMSCs using 8

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Fig. 5. miR-26a-5p is transferred into synovial fibroblasts by hBMSC-derived exosomes. (A), hBMSC surface antigens (CD29, CD44, CD71, CD34, CD45 and HLA-DR) identified by flow cytometry. (B), the left image refers to adipogenic differentiation of hBMSCs assessed by Oil red O staining; the middle image represents osteogenic differentiation of hBMSCs examined by alizarin red staining; the right images refers to chondrogenic differentiation of hBMSCs measured using Alcian Blue staining (×200). (C), images of exosomes extracted from hBMSCs observed under a TEM (scale bar = 200 nm). (D), protein bands of exosome surface markers (CD63, Hsp70 and CD9) in exosomes and hBMSCs determined by western blot analysis. (E), analysis of the particle size distribution in exosomes. (F), expression of miR-26a-5p in hBMSCs and exosomes both transfected with miR-26a-5p mimic evaluated by RT-qPCR. (G), images of hBMSCs and synovial fibroblasts observed under the laser scanning confocal microscope (×200). (H), miR-26a-5p expression and mRNA expression of PTGS2 in hBMSCs transduced with miR-26a-5p mimic. (I), protein expression of PTGS2 in hBMSCs transduced with miR-26a-5p mimic. * p < 0.05 compared with the treatment of hBMSC-miR-NC or EXO-miR-NC. Comparisons of the measurement data between two groups are analyzed by independent sample t test. PTGS2, prostaglandin-endoperoxide synthase-2; miR-26a-5p, microRNA-26a5p; RT-qPCR, reverse transcription quantitative polymerase chain reaction; hBMSCs, human bone mesenchymal stem cells; HLA-DR, human leukocyte antigen DR; TEM, transmission electron microscope; NC, negative control.

fibroblasts were successfully transduced with miR-26a-5p-Cy3 emitting red fluorescence (Fig. 5G). Moreover, the expression of PTGS2 was decreased, while miR-26a-5p expression was restored following the transfection of miR-26a-5p-Cy3 in hBMSCs (p < 0.05; Fig. 5H and I). These results demonstrated the successful delivery of miR-26a-5p into synovial fibroblasts by hBMSC-derived exosomes.

expression of miR-26a-5p but decreased PTGS2 expression (Fig. 6A). Meanwhile, after the synovial fibroblasts were co-cultured with exosomes, cell proliferation was weakened (Fig. 6B), and cell apoptosis was enhanced (Fig. 6C). Additionally, exosome treatment increased Bax and cleaved Caspase-3 expression, decreased Bcl-2 expression (Fig. 6D), and declined IL-6, TNF-α and IL-8 expression (Fig. 6E and F). Furthermore, the exosomes overexpressing miR-26a-5p displayed a more significant trend in the aforementioned factors (p < 0.05; Fig. 6A–F). These results demonstrated that damage of synovial fibroblasts was retarded by transfer of miR-26a-5p by hBMSC-derived exosomes.

3.6. hBMSC-derived exosomes overexpressing miR-26a-5p alleviate damage of synovial fibroblasts Following the above-mentioned findings, to investigate the effects associated with the exosomes derived from hBMSCs in synovial fibroblasts, exosomes were extracted from hBMSCs and added into synovial fibroblasts treated with IL-1β. Next, expression of miR-26a-5p, PTGS2, apoptosis-related proteins (Bcl-2, Bax and cleaved Caspase-3) and proinflammatory factors (IL-6, TNF-α and IL-8), cell proliferation and apoptosis of synovial fibroblasts were examined through RT-qPCR, western blot analysis, EdU assay and flow cytometry, respectively. The synovial fibroblasts treated with exosomes exhibited increased

3.7. hBMSC-derived exosomes harboring miR-26a-5p retard OA damage in vivo Finally, the effect of hBMSC-derived exosomes on rats with OA was evaluated in vivo. OA rats were injected with hBMSC-derived exosomes treated with miR-26a-5p mimic and miR-NC. HE staining was conducted to observe the pathological changes of condylar tissues and synovial tissues of the knee joint. The results revealed that compared 9

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Fig. 6. hBMSC-derived exosomes overexpressing miR-26a-5p ameliorate damage of synovial fibroblasts. Synovial fibroblasts co-cultured with hBMSC-derived exosomes were delivered with miR-26a-5p mimic and miR-NC. (A), expression of miR-26a-5p and PTGS2 detected by RT-qPCR. (B), cell proliferation of synovial fibroblasts assessed by EdU assay (×200). (C), cell apoptosis of synovial fibroblasts examined by flow cytometry. (D), protein expression of Bcl-2, Bax and cleaved Caspase-3 determined by western blot analysis. (E), mRNA expression of IL-6, TNF-α and IL-8 evaluated by RT-qPCR. (F), protein expression of IL-6, TNF-α and IL-8 evaluated by western blot analysis. * p < 0.05 compared with synovial fibroblasts; # p < 0.05 compared with synovial fibroblasts co-cultured with exosomes treated with EXO-miR-NC. Comparisons among multiple groups are analyzed by one-way analysis of variance, and Tukey’s test is conducted for post hoc test. hBMSCs, human bone mesenchymal stem cells; PTGS2, prostaglandin-endoperoxide synthase-2; miR-26a-5p, microRNA-26a-5p; RT-qPCR, reverse transcription quantitative polymerase chain reaction; IL, interleukin; EdU, 5-Ethynyl-2′-deoxyuridine; Bcl-2, B-cell lymphoma 2; Bax, Bcl2 associated X; TNF, tumor necrosis factor; NC, negative control.

4. Discussion

with the rats without treatment and sham-operated rats, synovitis cell infiltration, and increased proliferation in synovial cells and fibrous tissues were seen in the OA rats. Compared with the OA rats, OA rats injected with EXO-miR-26a-5p or EXO-miR-NC, particularly the OA rats injected with EXO-miR-26a-5p, exhibited alleviated synovial tissue proliferation, reduced inflammatory cells, and attenuated pathological changes of synovial tissues (Fig. 7A). Immunohistochemistry was performed to assess the expression of MMP-3 and MMP-13 in the synovial tissues, the results of which showed that the positive expression was mainly located in cytoplasm of synovial cells. Moreover, when compared with the rats without treatment as well as the sham-operated rats, the OA rats were found to have a higher expression of MMP-3 and MMP-13 (p < 0.05). In contrast to the OA rats, the OA rats injected with EXO-miR-NC or EXO-miR-26a-5p displayed a lower expression of these two indicators (p < 0.05; Fig. 7B). Finally, TUNEL staining was employed to detect cell apoptosis, and cells with tan particles in the staining nucleus were deemed as positive cells, namely apoptotic cells. The apoptotic cells were observed under a microscope and counted. The results revealed that the apoptotic index of the synovial cells was reduced in OA rats versus the rats without treatment and sham-operated rats; compared with the OA rats, the apoptotic index of synovial cells was elevated in OA rats injected with EXO-miR-NC or with EXO-miR26a-5p, especially in OA rats injected with EXO-miR-26a-5p (p < 0.05; Fig. 7C). Furthermore, ELISA was performed to determine the serum level of IL-1β. Compared with the rats without treatment and shamoperated rats, OA rats illustrated increased serum IL-1β level (p < 0.05); when relative to the OA rats, the level of serum IL-1β was decreased in OA rats treated with EXO-miR-NC or EXO-miR-26a-5p (p < 0.05; Fig. 7D). Additionally, the expression of miR-26a-5p and PTGS2 in synovial tissues was detected using RT-qPCR, the results revealed that the expression of miR-26a-5p was down-regulated and that of PTGS2 was up-regulated in OA rats when in comparison with the rats without treatment and sham-operated rats (p < 0.05); when compared with OA rats, the expression of miR-26a-5p was significantly elevated and that of PTGS2 was significantly diminished in OA rats treated with EXO-miR-NC or EXO-miR-26a-5p (p < 0.05), especially in OA rats injected with EXO-miR-26a-5p (Fig. 7E). Therefore, as demonstrated by the in vivo experiments, the hBMSC-derived exosomes overexpressing miR-26a-5p could hinder OA damage.

Although both pharmacologic therapies administrated intraarticularly, orally and topically and non-pharmacologic treatments including exercise and weight loss have been applied in OA therapy, more effective treatment methods for this disease are still in urgent need [35]. Exosomes secreted by MSCs have been proved to confer an anti-inflammatory and chondroprotective effect in vitro and retard OA progression in vivo [9]. The increasing diagnostic and therapeutic potential of miRNAs have been highlighted in treatment of OA [36]. The current study aimed to investigate the effects of hBMSC-derived exosomal miR-26a-5p on OA through the regulation of PTGS2. Overall, the key findings of our study provided evidence suggesting that hBMSCderived exosomes overexpressing miR-26a-5p could attenuate OA damage by repressing PTGS2. One important finding in our study was that miR-26a-5p was expressed poorly, while PTGS2 was expressed highly in OA synovium samples and synovial fibroblasts treated with IL-1β. The expression of miR-26a has been found to be decreased in patients’ cartilage with OA, highlighting its possible role in the pathogenesis of OA [37]. Furthermore, in human OA chondrocytes, low expression of miR-26a-5p has been identified, with a prior study linking this to the expression of inducible nitric oxide synthase induced by IL-1β [17]. On the other hand, a previous study conducted by Fukai A et al. revealed that inducible enzyme PTGS2 exhibits an increased expression in both mouse and human OA cartilage [34]. Fan HW et al. identified elevated mRNA expression of PTGS2 in the synovial cells from patients with OA relative to control subjects [36], which was consistent with the findings of the current study. Moreover, by detection of luciferase activity and quantification, PTGS2 was verified as a target gene of miR-26a-5p. In line with our finding, the predicted target site in a recent study by Zhang L et al. demonstrated that the expression of PTGS2 is decreased by miR26a in the endometrial epithelial cells of dairy goats in vitro [18]. Besides, miR-26b has been revealed to repress breast cancer proliferation through binding to PTGS2 [39]. Collectively, it seems that the expression of miR-26a-5p and PTGS2 are reversely associated with OA both in cartilage as well as the synovium. Additionally, our results revealed that the overexpression of miR26a-5p led to the inhibition of inflammation, proliferation and 10

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Fig. 7. hBMSC-derived exosomes overexpressing miR-26a-5p relieve damage of OA in vivo. OA rats are injected with hBMSC-derived exosomes treated with miR-26a5p mimic and miR-NC. (A), pathological changes of condylar tissues and synovial tissues of the knee joint using HE staining (×200). (B), immunohistochemical staining of MMP-3 and MMP-13 in synovial tissues of OA rats (×400). (C), cell apoptosis in synovial tissues of OA rats assessed by TUNEL staining (×400). (D), serum IL-1β level of OA rats measured by ELISA. (E), expression of miR-26a-5p and PTGS2 in synovial tissues of OA rats detected by RT-qPCR. * p < 0.05 compared with normal rats. # p < 0.05 compared with OA rats. & p < 0.05 compared with OA rats injected with EXO-miR-NC. Comparisons among multiple groups are analyzed by one-way analysis of variance, and Tukey’s test is conducted for post hoc test. PTGS2, prostaglandin-endoperoxide synthase-2; hBMSCs, human bone mesenchymal stem cells; miR-26a-5p, microRNA-26a-5p; OA, osteoarthritis; NC, negative control; RT-qPCR, reverse transcription quantitative polymerase chain reaction; IL, interleukin; ELISA, enzyme-linked immunoassay; MMP, matrix metalloproteinase; TUNEL, TdT-mediated dUTP-biotin nick end-labeling.

migration in addition to the stimulation of synovial fibroblasts apoptosis by downregulating PTGS2, corresponding to decreased expression of Bcl-2, IL-6, TNF-α, IL-8, MMP-3 and MMP-13 and increased expression of Bax and cleaved Caspase-3. The Bcl-2 gene family mediates the process of cell apoptosis in the progression of OA, and the ratio of Bcl2/Bax has been found to be downregulated in the OA study groups when compared to normal cartilage control groups [40]. Elevated cleaved caspase-3 has been found in tissues from active rheumatoid arthritis, and its elevation correlates with enhanced apoptosis in active rheumatoid synovium [41]. Additionally, miR-222 is involved in OA pathogenesis by reducing expression of MMP-13 through targeting

HDAC-4 [42]. IL-6 and TNF-α are two primary proinflammatory cytokines that mediate cartilage destruction and synovial inflammation in OA, and their increased production by visfatin can be reversed by upregulated miR-199a-5p in human OA synovial fibroblasts [43]. miR140-5p repressed proliferation of synovial fibroblasts and secretion of inflammatory cytokines (IL-6 and IL-8) by targeting TLR4 [44]. The diminished expression of MMPs and PTGS2 by kaempferol has been shown to contribute to the repression of synovial fibroblast proliferation and articular inflammation in rheumatoid arthritis [45]. Moreover, the repressed production of MMPs and PTGS2 by quercetin has been demonstrated to impede synovial fibroblast proliferation and

11

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Fig. 8. hBMSC-derived exosomes overexpressing miR-26a-5p alleviate OA damage by repressing PTGS2. hBMSC-derived exosomes carry miR-26a5p into synovial fibroblasts to repress PTGS2 expression, thus inhibiting cell proliferation and migration, suppressing regional inflammation by decreasing expression of IL-6, IL-8, IL-1β, TNF-α, MMP-3 and MMP-13 and promoting cell apoptosis by reducing expression of Bcl-2 and elevating expression of Bax and Cleaved caspase 3. PTGS2, prostaglandin-endoperoxide synthase-2; hBMSCs, human bone mesenchymal stem cells; miR-26a-5p, microRNA-26a-5p; OA, osteoarthritis; IL, interleukin; MMP, matrix metalloproteinase; TNF, tumor necrosis factor.

mature articular chondrocytes-, catabolism-, and inflammation-related markers was affected by exosomes in a dose-dependent way [9]. Therefore, we will explore the effects of exosome dose and how the exosome dose is translated between in vitro and in vivo studies in our future work.

consequent joint destruction in rheumatoid arthritis [46]. Moreover, the results of exosomes derived from hBMSCs and synovial fibroblasts co-culture system found that synovial fibroblasts could internalize exosomes derived from hBMSCs which contained miR26a-5p. As minor membrane vesicles, exosomes are secreted by various types of cells from multivesicular endosomes, which have been implicated in cell-cell communication in their ability to carry genetic materials such as miRNA and lncRNA as well as proteins [47]. Both BMSCs and their secreted exosomes serve as vehicles for delivery of small RNAs and inhibitors for immune reaction [48]. Exosomes derived from MSCs overexpressing miR-92a-3p inhibit cartilage degradation and facilitate chondrogenesis in OA through targeting WNT5A [49]. Besides, exosomal miR-100-5p secreted from infrapatellar fat pad MSCs prevents articular cartilage and alleviates gait abnormalities in OA [50]. Exosomes derived from synovial fibroblasts triggered by IL-1β result in OA-like changes within articular chondrocytes [51]. Meanwhile, exosomes derived from human embryonic stem cell-induced MSCs contribute to attenuated OA by regulating cartilage extracellular matrix degradation and synthesis [52]. Furthermore, exosomes secreted by synovial membrane MSCs or pluripotent stem cell-derived MSCs have been revealed to relieve OA development in a mouse model [53]. Moreover, human synovial MSCs-derived exosomes overexpressing miR-140-5p promote regeneration of cartilage tissues and inhibit the knee OA in a rat model [54]. Therefore, exosomes are important vectors to transport functional microRNA to target cell. Taken together, hBMSC-derived exosomes carrying miR-26a-5p exerts an inhibitory effect on inflammation, proliferation and migration and a promotive effect on cell apoptosis, thus attenuating OA progression (Fig. 8). The above findings identify exosomal miR-26a-5p as a promising therapeutic method for OA treatment. However, based on the proteomic and genomic complexities of exosomes, their possible mechanisms and exact compositions need further investigation. Thus, it is also recommended that experiments are needed in order to further explore the intrinsic mechanisms of exosomal miR-26a-5p derived from other cells in OA. Moreover, it was reported that the expression of

Funding None.

Consent for publication Consent for publication was obtained from the participants.

Availability of data and material The datasets generated during the current study are available.

Ethics statement Written informed consent was obtained from all participating patients prior to enrollment into the study. All study protocols were approved by Ethic Committee of the First Hospital of China Medical University and in line with the ethical principles for medical research involving human subjects of the Helsinki Declaration. All animal experiments were performed in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal experimental protocols were approved by the Institutional Animal Care and Use Committee of the First Hospital of China Medical University. The animal experiments were conducted based on minimized animal number and the least pains on experimental animals. 12

International Immunopharmacology xxx (xxxx) xxxx

Z. Jin, et al.

Declaration of Competing Interest [25]

None. Acknowledgments

[26]

We would like to give our sincere appreciation to the reviewers for their helpful comments on this article.

[27]

[28]

Authors' Contributions

[29] [30]

Zhe Jin and Jiaan Ren designed the study. Zhe Jin, Jiaan Ren, and Shanlun Qi collated the data, carried out data analyses and produced the initial draft of the manuscript. Zhe Jin and Shanlun Qi contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.

[31]

[32]

References [33] [1] N.E. Lane, K. Shidara, B.L. Wise, Osteoarthritis year in review 2016: clinical, Osteoarthr. Cartil. 25 (2) (2017) 209–215. [2] F. Berenbaum, T.M. Griffin, R. Liu-Bryan, Review: metabolic regulation of inflammation in osteoarthritis, Arthr. Rheumatol. 69 (1) (2017) 9–21. [3] G.B.D. Disease, I. Injury, C. Prevalence, Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990–2015: a systematic analysis for the global burden of disease study 2015, Lancet 388 (10053) (2016) 1545–1602. [4] L. March, E.U. Smith, D.G. Hoy, et al., Burden of disability due to musculoskeletal (MSK) disorders, Best Pract. Res. Clin. Rheumatol. 28 (3) (2014) 353–366. [5] D. Chen, J. Shen, W. Zhao, et al., Osteoarthritis: toward a comprehensive understanding of pathological mechanism, Bone Res. 5 (2017) 16044. [6] A. Mathiessen, P.G. Conaghan, Synovitis in osteoarthritis: current understanding with therapeutic implications, Arthr. Res. Ther. 19 (1) (2017) 18. [7] J.A. Ankrum, J.F. Ong, J.M. Karp, Mesenchymal stem cells: immune evasive, not immune privileged, Nat. Biotechnol. 32 (3) (2014) 252–260. [8] F. Song, J. Tang, R. Geng, et al., Comparison of the efficacy of bone marrow mononuclear cells and bone mesenchymal stem cells in the treatment of osteoarthritis in a sheep model, Int. J. Clin. Exp. Pathol. 7 (4) (2014) 1415–1426. [9] S. Cosenza, M. Ruiz, K. Toupet, C. Jorgensen, D. Noel, Mesenchymal stem cells derived exosomes and microparticles protect cartilage and bone from degradation in osteoarthritis, Sci. Rep. 7 (1) (2017) 16214. [10] D. Zhang, H. Lee, Z. Zhu, J.K. Minhas, Y. Jin, Enrichment of selective miRNAs in exosomes and delivery of exosomal miRNAs in vitro and in vivo, Am. J. Physiol. Lung Cell Mol. Physiol. 312 (1) (2017) L110–L121. [11] B. Yu, X. Zhang, X. Li, Exosomes derived from mesenchymal stem cells, Int. J. Mol. Sci. 15 (3) (2014) 4142–4157. [12] J.F. Xu, G.H. Yang, X.H. Pan, et al., Altered microRNA expression profile in exosomes during osteogenic differentiation of human bone marrow-derived mesenchymal stem cells, PLoS ONE 9 (12) (2014) e114627. [13] J. O'Brien, H. Hayder, Y. Zayed, C. Peng, Overview of microRNA biogenesis, mechanisms of actions, and circulation, Front Endocrinol. (Lausanne) 9 (2018) 402. [14] S. Miyaki, H. Asahara, Macro view of microRNA function in osteoarthritis, Nat. Rev. Rheumatol. 8 (9) (2012) 543–552. [15] A. De Palma, S. Cheleschi, N.A. Pascarelli, et al., Do MicroRNAs have a key epigenetic role in osteoarthritis and in mechanotransduction? Clin. Exp. Rheumatol. 35 (3) (2017) 518–526. [16] A. Fathollahi, S. Aslani, A. Jamshidi, M. Mahmoudi, Epigenetics in osteoarthritis: novel spotlight, J. Cell Physiol. 234 (8) (2019) 12309–12324. [17] Z. Rasheed, H.A. Al-Shobaili, N. Rasheed, A. Mahmood, M.I. Khan, MicroRNA-26a5p regulates the expression of inducible nitric oxide synthase via activation of NFkappaB pathway in human osteoarthritis chondrocytes, Arch. Biochem. Biophys. 594 (2016) 61–67. [18] L. Zhang, X. Liu, S. Che, et al., CircRNA-9119 regulates the expression of prostaglandin-endoperoxide synthase 2 (PTGS2) by sponging miR-26a in the endometrial epithelial cells of dairy goat, Reprod. Fertil. Dev. (2018). [19] D.N. Piranda, R.B.V. Abreu, D.R. Freitas-Alves, M.A. de Carvalho, R. Vianna-Jorge, Modulation of the prostaglandin-endoperoxide synthase 2 gene expression by variant haplotypes: influence of the 3'-untranslated region, Braz. J. Med. Biol. Res. 51 (2) (2017) e6546. [20] Y. Mu, W. Hao, S. Li, Casticin protects against IL-1beta-induced inflammation in human osteoarthritis chondrocytes, Eur. J. Pharmacol. 842 (2019) 314–320. [21] M.G. Broeren, M. de Vries, M.B. Bennink, et al., Functional tissue analysis reveals successful cryopreservation of human osteoarthritic synovium, PLoS ONE 11 (11) (2016) e0167076. [22] L. Gautier, L. Cope, B.M. Bolstad, R.A. Irizarry, affy–analysis of Affymetrix GeneChip data at the probe level, Bioinformatics 20 (3) (2004) 307–315. [23] G.K. Smyth, Linear models and empirical bayes methods for assessing differential expression in microarray experiments, Stat. Appl. Genet. Mol. Biol. 3 (Article 3) (2004). [24] D. Szklarczyk, A. Franceschini, S. Wyder, et al., STRING v10: protein-protein

[34]

[35] [36] [37]

[39] [40]

[41]

[42]

[43]

[44]

[45]

[46]

[47] [48]

[49]

[50]

[51]

[52]

[53]

[54]

13

interaction networks, integrated over the tree of life, Nucleic Acids Res. 43 (Database issue) (2015) D447-452. P. Shannon, A. Markiel, O. Ozier, et al., Cytoscape: a software environment for integrated models of biomolecular interaction networks, Genome Res. 13 (11) (2003) 2498–2504. L.A. Vonk, S.F.J. van Dooremalen, N. Liv, et al., Mesenchymal stromal/stem cellderived extracellular vesicles promote human cartilage regeneration in vitro, Theranostics 8 (4) (2018) 906–920. M. Gnecchi, L.G. Melo, Bone marrow-derived mesenchymal stem cells: isolation, expansion, characterization, viral transduction, and production of conditioned medium, Methods Mol. Biol. 482 (2009) 281–294. A. Schneider, M. Simons, Exosomes: vesicular carriers for intercellular communication in neurodegenerative disorders, Cell Tissue Res. 352 (1) (2013) 33–47. R.C. Lai, F. Arslan, M.M. Lee, et al., Exosome secreted by MSC reduces myocardial ischemia/reperfusion injury, Stem Cell Res. 4 (3) (2010) 214–222. E.A. Dumont, L. Hofstra, W.L. van Heerde, et al., Cardiomyocyte death induced by myocardial ischemia and reperfusion: measurement with recombinant human annexin-V in a mouse model, Circulation 102 (13) (2000) 1564–1568. A. Koskinen, K. Vuolteenaho, R. Nieminen, T. Moilanen, E. Moilanen, Leptin enhances MMP-1, MMP-3 and MMP-13 production in human osteoarthritic cartilage and correlates with MMP-1 and MMP-3 in synovial fluid from OA patients, Clin. Exp. Rheumatol. 29 (1) (2011) 57–64. S. Kamekura, K. Hoshi, T. Shimoaka, et al., Osteoarthritis development in novel experimental mouse models induced by knee joint instability, Osteoarthr. Cartil. 13 (7) (2005) 632–641. H. Takayanagi, T. Juji, T. Miyazaki, et al., Suppression of arthritic bone destruction by adenovirus-mediated csk gene transfer to synoviocytes and osteoclasts, J. Clin. Invest. 104 (2) (1999) 137–146. A. Fukai, S. Kamekura, D. Chikazu, et al., Lack of a chondroprotective effect of cyclooxygenase 2 inhibition in a surgically induced model of osteoarthritis in mice, Arthr. Rheum 64 (1) (2012) 198–203. A.E. Nelson, Osteoarthritis year in review 2017: clinical, Osteoarthr. Cartil. 26 (3) (2018) 319–325. C. Yu, W.P. Chen, X.H. Wang, MicroRNA in osteoarthritis, J. Int. Med. Res. 39 (1) (2011) 1–9. X. Yin, J.Q. Wang, S.Y. Yan, Reduced miR26a and miR26b expression contributes to the pathogenesis of osteoarthritis via the promotion of p65 translocation, Mol. Med. Rep. 15 (2) (2017) 551–558. J. Li, X. Kong, J. Zhang, Q. Luo, X. Li, L. Fang, Correction: MiRNA-26b inhibits proliferation by targeting PTGS2 in breast cancer, Cancer Cell Int. 13 (1) (2013) 17. G.I. Karaliotas, K. Mavridis, A. Scorilas, G.C. Babis, Quantitative analysis of the mRNA expression levels of BCL2 and BAX genes in human osteoarthritis and normal articular cartilage: an investigation into their differential expression, Mol. Med. Rep. 12 (3) (2015) 4514–4521. A.A. Dharmapatni, M.D. Smith, D.M. Findlay, et al., Elevated expression of caspase3 inhibitors, survivin and xIAP correlates with low levels of apoptosis in active rheumatoid synovium, Arthritis Res. Ther. 11 (1) (2009) R13. J. Song, E.H. Jin, D. Kim, K.Y. Kim, C.H. Chun, E.J. Jin, MicroRNA-222 regulates MMP-13 via targeting HDAC-4 during osteoarthritis pathogenesis, BBA Clin. 3 (2015) 79–89. M.H. Wu, C.H. Tsai, Y.L. Huang, Y.C. Fong, C.H. Tang, Visfatin promotes IL-6 and TNF-alpha production in human synovial fibroblasts by repressing miR-199a-5p through ERK, p38 and JNK signaling pathways, Int. J. Mol. Sci. 19 (1) (2018). H. Li, S.B. Guan, Y. Lu, F. Wang, MiR-140-5p inhibits synovial fibroblasts proliferation and inflammatory cytokines secretion through targeting TLR4, Biomed. Pharmacother. 96 (2017) 208–214. H.Y. Yoon, E.G. Lee, H. Lee, et al., Kaempferol inhibits IL-1beta-induced proliferation of rheumatoid arthritis synovial fibroblasts and the production of COX-2, PGE2 and MMPs, Int. J. Mol. Med. 32 (4) (2013) 971–977. M.S. Sung, E.G. Lee, H.S. Jeon, et al., Quercetin inhibits IL-1beta-induced proliferation and production of MMPs, COX-2, and PGE2 by rheumatoid synovial fibroblast, Inflammation 35 (4) (2012) 1585–1594. A. Bobrie, M. Colombo, G. Raposo, C. Thery, Exosome secretion: molecular mechanisms and roles in immune responses, Traffic 12 (12) (2011) 1659–1668. D. Wen, Y. Peng, D. Liu, Y. Weizmann, R.I. Mahato, Mesenchymal stem cell and derived exosome as small RNA carrier and immunomodulator to improve islet transplantation, J. Contr. Rel. 238 (2016) 166–175. G. Mao, Z. Zhang, S. Hu, et al., Exosomes derived from miR-92a-3p-overexpressing human mesenchymal stem cells enhance chondrogenesis and suppress cartilage degradation via targeting WNT5A, Stem Cell Res. Ther. 9 (1) (2018) 247. G. Al-Kafaji, G. Al-Mahroos, N.A. Alsayed, et al., Peripheral blood microRNA-15a is a potential biomarker for type 2 diabetes mellitus and pre-diabetes, Mol. Med. Rep. 12 (5) (2015) 7485–7490. T. Kato, S. Miyaki, H. Ishitobi, et al., Exosomes from IL-1beta stimulated synovial fibroblasts induce osteoarthritic changes in articular chondrocytes, Arthr. Res. Ther. 16 (4) (2014) R163. Y. Wang, D. Yu, Z. Liu, et al., Exosomes from embryonic mesenchymal stem cells alleviate osteoarthritis through balancing synthesis and degradation of cartilage extracellular matrix, Stem Cell Res. Ther. 8 (1) (2017) 189. Y. Zhu, Y. Wang, B. Zhao, et al., Comparison of exosomes secreted by induced pluripotent stem cell-derived mesenchymal stem cells and synovial membrane-derived mesenchymal stem cells for the treatment of osteoarthritis, Stem Cell Res. Ther. 8 (1) (2017) 64. S.C. Tao, T. Yuan, Y.L. Zhang, W.J. Yin, S.C. Guo, C.Q. Zhang, Exosomes derived from miR-140-5p-overexpressing human synovial mesenchymal stem cells enhance cartilage tissue regeneration and prevent osteoarthritis of the knee in a rat model, Theranostics 7 (1) (2017) 180–195.