hypoglycemia followed by reoxygenation

Journal of Neuroimmunology 112 (2001) 28–34 www.elsevier.com / locate / jneuroin

Resveratrol inhibits interleukin-6 production in cortical mixed glial cells under hypoxia / hypoglycemia followed by reoxygenation M.J. Wang, H.M. Huang, S.J. Hsieh, K.C.G. Jeng*, J.S. Kuo Department of Education and Research, Taichung Veterans General Hospital, Taichung, 40705 Taiwan, ROC Received 13 March 2000; received in revised form 11 August 2000; accepted 11 August 2000

Abstract Reactive oxygen intermediates (ROIs) are important mediators of a variety of pathological processes, including inflammation and ischemia / reperfusion injury. Cytokines and chemokines are detected at mRNA level in human and animal ischemic brains. This suggests that hypoxia / reoxygenation may induce cytokine production through generation of ROIs. In this study, we investigated the cytokine induction and inhibition by antioxidants in rat cortical mixed glial cells exposed to in vitro ischemia-like insults (hypoxia plus glucose deprivation). The results showed that interleukin-6 (IL-6) mRNA and protein, but not tumor necrosis factor-a (TNF-a) or interleukin-1b (IL-1b), were induced during hypoxia / hypoglycemia followed by reoxygenation in the mixed glial cells. The accumulation of IL-6 mRNA was induced as early as 15 min after hypoxia / hypoglycemia and its level was further increased after subsequent reoxygenation. Among the antioxidants studied, only resveratrol suppressed IL-6 gene expression and protein secretion in mixed glial cultures under hypoxia / hypoglycemia followed by reoxygenation. These findings suggest that resveratrol might be useful in treating ischemic-induced inflammatory processes in stroke.  2001 Elsevier Science B.V. All rights reserved. Keywords: Reactive oxygen intermediates; Hypoxia; Hypoglycemia; Reoxygenation; Antioxidants; Cytokine

1. Introduction Exposure of brain tissue to reduced oxygen supply initiates many biochemical events leading to loss of functional integrity and ultimately to cell death (Plum, 1983). Hypoxia / reoxygenation-induced cell injury shares certain features with the inflammatory response during reperfusion (Repine et al., 1987; Flaherty and Weisfeldt, 1988). Recent studies of the mechanisms underlying neuronal death due to cerebral ischemia have indicated the importance of immune / inflammatory proteins (cytokines) in this complex pathology (Feuerstein et al., 1995; Rothwell et al., 1995). Injury to central nervous system by ischemia elicits an inflammatory response involving several cytokines including interleukin-1 (IL-1), IL-6 and tumor necrosis factor-a (TNF-a). They are either proinflammatory or neuroprotective (Campbell et al., 1993; Hattori et al., 1993; Liu et al., 1993; 1994; Maeda et al., 1994;

*Corresponding author. Fax: 1886-4-359-2705. E-mail address: [email protected] (K.C.G. Jeng).

Hopkins and Rothwell, 1995; Loddick et al., 1998). Since oxygen-derived free radicals and related species have welldefined roles in the inflammatory process and postischemic injury (McCord, 1985; McCord, 1987), hypoxia / reoxygenation may induce cytokine production in brain cells via the activation of transcriptional factors by reactive oxygen species. Thus, antioxidants may play an important role in homeostasis during hypoxia / reoxygenation. Resveratrol is a phytoalexin found in grapes and other plants that has anti-cancer and anti-inflammatory effects (Jang et al., 1997). Several biological actions of resveratrol have been reported, including the inhibition of oxidation of low-density lipoprotein cholesterol (Frankel et al., 1993a; 1993b), attenuation of platelet aggregation and vasorelaxing activity (Kimura et al., 1985; Chen and Pace-Asciak, 1996), suppression of phorbol ester-induced cyclooxygenase-2 gene and lipopolysaccharide (LPS)-induced inducible NO synthase (iNOS) gene expression (Kawada et al., 1998; Subbaramaiah et al., 1998; Tsai et al., 1999). Recently, it has been shown that resveratrol inhibits production of reactive oxygen intermediates (ROIs) in zymosan-stimulated murine macrophages, human monocytes and neutrophils (Jang et al., 1999). In

0165-5728 / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved. PII: S0165-5728( 00 )00374-X

M. J. Wang et al. / Journal of Neuroimmunology 112 (2001) 28 – 34

addition, resveratrol protects PC12 cells from the oxidative stress-induced cell death (Chanvitayapongs et al., 1997). However, the effects of resveratrol on the cytokine production in brain cells exposed to hypoxia / reoxygenation have not been reported. In the present study, we established a mixed glial culture system, a model that more closely mimics the physiological conditions, to investigate the effect of resveratrol on the hypoxia / reoxygenation-induced cytokine production.

2. Materials and methods

2.1. Cell culture Cultured cortical cells were prepared from the cerebral cortices of 1-day-old Sprague–Dawley rats. After the brain was dissected, the blood vessels and meninges were removed under microscope. Then the cortices were placed in ice-cold Dulbecco’s Modified Eagle’s medium (DMEM; GIBCO BRL, Gaithersburg, MD) and minced. The tissue chunks were incubated with papain solution (100 U / ml papain, 0.5 mM EDTA, 0.2 mg / ml cysteine, 1.5 mM CaCl 2 , 0.21% DNase I) at 378C for 20 min to dissociate the cells. The reaction was terminated by adding heatinactivated horse serum. The cell suspensions were centrifuged at 60003g, and the pellets were resuspended in DMEM supplemented with 10% horse serum. Cells were plated onto poly-D-lysine-coated 35 mm petri dishes at a seeding density of 2–4310 5 / dish, and incubated at 378C in a humidified incubator with 5% CO 2 . Two hours after plating, the medium was replaced with DMEM containing 10% fetal calf serum (FCS; Hyclone, Logan, UT), 100 U / ml penicillin and 100 mg / ml streptomycin, and changed every 4–5 days thereafter. Cells were used 10 to 14 days after plating. Cell population of the mixed cell cultures consisted 85–90% of Glial fibrillary acid protein (GFAP) positive astrocytes, 5–10% of microglia (Mac-1 positive) and 2–3% of neurons (MAP-2 positive), as identified by immunochemical staining.

2.2. Hypoxia /reoxygenation Mixed glial cell cultures were washed twice with serumfree DMEM (without glucose, phenol red, L-glutamine, sodium pyruvate). After washing, cell cultures were exposed to hypoxia (with glucose deprivation) in a humidified temperature-controlled hypoxia chamber (bugbox, Ruskinn, UK), which was purged with 85% N 2 / 10% H 2 / 5% CO 2 atmosphere, at 378C. Where indicated, after exposure to hypoxia, cultures were returned to an atmosphere with ambient oxygen levels. Fresh DMEM containing 4.5 g / l glucose and 1% G5 supplement (GIBCO BRL, Gaithersburg, MD) was added at the time of reoxygenation. Resveratrol (Res) (Sigma Chemical Co., St.

29

Louis, MO) was added to mixed glial cultures at the time of reoxygenation.

2.3. IL-6 assay Supernatants from cell culture were collected and stored at 2808C until assay. IL-6 production in each sample was assayed in duplicate by commercial ELISA kit (BioSource International, Inc., Nivelles, Belgium), according to the manufacturer’s instructions. The detection limit of IL-6 was 8 pg / ml. The ELISA assay did not cross react with TNF-a IL-1b, IL-4, IL-10 or MIP-2.

2.4. Isolation of RNA and semiquantitative reverse transcription–polymerase chain reaction Cells were exposed to hypoxia / hypoglycemia alone or hypoxia / hypoglycemia followed by reoxygenation to study IL-6 mRNA expression. After exposure, cells were lysed with a cold RNA extraction solution (Ultraspec RNA; Biotecx Lab. Inc., Houston, TX, USA). Total RNA was quantified spectrophotometrically by absorbance at 260 nm. The reverse transcription–polymerase chain reaction (RT–PCR) assays were performed with a TitanE One Tube RT–PCR System kit (Boehringer Mannheim GmbH, Mannheim, Germany). Briefly, 1 mg of total RNA from each sample was added to 50 ml of a reaction mixture containing 0.2 mM dNTP, 0.4 mM each of specific primers, 5 mM DTT, 5 U RNase inhibitor, 1 ml of AMV reverse transcriptase and ExpandE High Fidelity enzyme mix. The primer sequences were as follows: 59 CAAGAGACTTCCAGCCAGTTGC, 39 TTGCCGAGTAGACCTCATAGTGACC for IL-6 (614 bp fragment), and 59 TTGTAACCAACTGGGACGATATGG, 39 GATCTTGATCTTCATGGTGCTAGG for b-actin (764 bp fragment), as a control for the RNA isolation and reverse-transcription. RT–PCR was carried out in a Perkin Elmer Cetus thermocycler. The preparations in the microtubes were incubated at 508C for 30 min, then amplified using a three-temperature PCR system consisting of denaturation at 948C for 45 s, primer annealing at 608C for 45 s and extension at 728C for 2 min. The number of cycles was determined for samples within linear range of amplification cycles (30 cycles for IL-6 and 20 cycles for b-actin). The PCR product was visualized by electrophoresis in a 3% agarose gel (consisting of 2% Nusieve GTG agarose and 1% agarose) and staining with 0.5 mg / ml ethidium bromide.

2.5. Statistical methods The Mann–Whitney rank test was used for the analysis of data. P values less than 0.05 were considered significant. All analyses were performed with STATVIEW

30

M. J. Wang et al. / Journal of Neuroimmunology 112 (2001) 28 – 34

version 3.0 for Macintosh (Abacus Concepts, Inc., Berkeley, CA).

3. Results

3.1. Induction of IL-6 gene expression in mixed glial cells exposed to hypoxia To investigate the effect of hypoxia on the cytokine gene expression, rat cortical mixed glial cells were exposed to hypoxia for the indicated periods of time. Total cellular RNA was extracted and analyzed by semiquantitative RT– PCR (Fig. 1, top panel) and quantified by densitometry (Fig. 1, bottom panel). Accumulation of IL-6 mRNA occurred as early as 15 min after exposure to glucose deprivation alone (normoxia), peaked at 30 min, and dramatically declined with time to that of the control level. However, the IL-6 mRNA in cells exposed to hypoxia plus glucose deprivation, was induced at 15 min, and reached a maximal level at 1–4 h. When cells were exposed to hypoxia in the presence of glucose, IL-6 mRNA was not induced (data not shown). In these cells, hypoxia / hypoglycemia induced IL-6 gene expression, but not TNF-a or IL-1b. In contrast, in cells exposed to LPS, both TNF-a

Fig. 1. Effect of hypoxia on the accumulation of IL-6 mRNA in rat cortical mixed glial cells. Cells were exposed to normoxia or hypoxia under glucose deprivation for the indicated periods (0, 15, 30, 60, 120, and 240 min). Levels of IL-6 and b-actin mRNAs were determined by RT–PCR analysis (top panel). Results of scanning densitometric analysis of the gel are presented as relative ratio of IL-6 / b-actin (bottom panel). Values represent means6S.E. of two independent experiments each done in duplicate. All determinants show a significant difference (P,0.01) as compared with untreated cells, except for normoxia at 2 or 4 h.

and IL-1b mRNA transcription were induced (data not shown). Furthermore, during hypoxia / hypoglycemia periods, cell injury was observed after 4 h that part of cells began to float and large amount of LDH was released in the medium as compared to the control. The release of IL-6 protein by mixed glial cells was detectable after 2 h of hypoxia / hypoglycemia (12 and 28 pg / ml for 2 and 4 h of hypoxia / hypoglycemia, respectively). In the following study, all hypoxic experiments were performed under glucose deprivation.

3.2. Induction of IL-6 gene expression and protein secretion by mixed glial cells subjected to hypoxia / hypoglycemia followed by reoxygenation Previous studies have demonstrated that cells exposed to hypoxia produce a large amount of ROIs upon reoxygenation. It has been suggested that diverse stimuli induce nuclear factor-kB (NF-kB) activation through generation of ROIs. To determine whether reoxygenation further induces IL-6 gene expression and protein secretion in mixed glial cells, cells were subjected to hypoxia / hypoglycemia followed by reoxygenation (i.e., normoxia) in the growth media for the indicated times. Levels of IL-6 mRNA and protein were analyzed as described in Materials and methods. As shown in Fig. 2, the patterns of IL-6 mRNA expression were similar at 30 min and 2 h of hypoxia / hypoglycemia, as well as during subsequent reoxygenation period, except at 4 h of hypoxia / hypoglycemia. During reoxygenation periods, the level of IL-6 transcripts further increased and peaked at 30 min to 1 h, gradually decling to the baseline level by 16 h. When the cells were exposed to hypoxia / hypoglycemia for 4 h, the IL-6 mRNA level further increased during subsequent reoxygenation for up to 30 min. After that the IL-6 mRNA level rapidly decreased with time and was lower than that of cells exposed to hypoxia / hypoglycemia only. ELISA analysis indicated that the release of IL-6 from mixed glial cells occurred in a time-dependent manner, depending on the period of reoxygenation (Fig. 3). When cells were subjected to hypoxia / hypoglycemia for 30 min or 2 h, maximal IL-6 release occurred at 4–16 h of reoxygenation. In contrast, there were no significant differences in IL-6 level after exposure of cells to hypoxia / hypoglycemia for 4 h and followed by reoxygenation.

3.3. Effect of resveratrol on the IL-6 gene expression and protein secretion in mixed glial cells subjected to hypoxia /hypoglycemia followed by reoxygenation To determine whether resveratrol inhibits the production of IL-6 in hypoxia / hypoglycemia / reoxygenated mixed glial cells, the cells were subjected to hypoxia / hypoglycemia for 2 h. Then, fresh medium containing vehicle or various concentrations of resveratrol was added and the cells were reexposed to normoxia for 4 h. Cells did not

M. J. Wang et al. / Journal of Neuroimmunology 112 (2001) 28 – 34

31

Fig. 2. Expression of IL-6 mRNA in mixed glial cells subjected to hypoxia / hypoglycemia followed by reoxygenation. Cells were exposed to hypoxia / hypoglycemia for 0.5, 2 and 4 h and then reoxygenated at the indicated times (0–16 h). IL-6 mRNA and b-actin mRNA were assayed as described in Fig. 1. Values represent means6S.E. of two independent experiments each done in duplicate. [, P,0.05 and *, P,0.01 as compared with hypoxia / hypoglycemia treatment alone.

Fig. 3. Production of IL-6 by mixed glial cells subjected to hypoxia / hypoglycemia followed by reoxygenation. Cells were exposed to hypoxia / hypoglycemia for 0.5, 2 and 4 h and then reoxygenated at the indicated times. Levels of IL-6 in the culture supernatants were determined by ELISA analysis. Values represent means6S.E. of two independent experiments each done in duplicate. [, P,0.05 and *, P,0.01 as compared with hypoxia / hypoglycemia treatment alone.

show any sign of change in the viability or morphology by treatment with resveratrol, at concentrations used in the study. The results showed that the release of IL-6 was inhibited by resveratrol in a dose-dependent manner (Fig. 4). The inhibitory effect of resveratrol on hypoxia / hypoglycemia / reoxygenation-induced IL-6 was maximal at 50 mM (inhibited by approximately 50%). Increasing the concentration of resveratrol to 100 mM did not further increase the inhibitory effect. To investigate whether resveratrol also suppressed the induction of IL-6 mRNA in mixed glial cells, the time course of resveratrol’s effect on the expression of IL-6 gene was studied. As shown in Fig. 5, the inhibitory effect of resveratrol on IL-6 gene expression was observed at 1–2 h reoxygenation (42 and 36% inhibition, respectively). After that, there was no inhibitory effect on the expression

of IL-6 mRNA. This result indicated that the inhibitory effect of resveratrol was also at the mRNA level and that the treatment time was critical.

4. Discussion In the present study, we demonstrated that only IL-6 gene expression, not IL-1b or TNF-a gene expression was induced, and that occurred as early as 15 min after exposure of rat cortical mixed glial cells to hypoxia / hypoglycemia. The expression of IL-6 mRNA further increased after subsequent reoxygenation. Furthermore, resveratrol exhibited an inhibitory effect on IL-6 gene expression and protein secretion. It is not clear why glucose and serum deprivation

32

M. J. Wang et al. / Journal of Neuroimmunology 112 (2001) 28 – 34

Fig. 4. Effect of resveratrol on the secretion of IL-6 protein by mixed glial cells exposed to hypoxia / hypoglycemia followed by reoxygenation. Cells were exposed to hypoxia / hypoglycemia for 2 h followed by normoxia for 4 h. Just before exposure to reoxygenation, vehicle (control) or various concentration of resveratrol (5, 10, 25, 50 and 100 mM) was added. At the end of the experiment, supernatants were obtained for analysis of IL-6 protein levels. Values represent means6S.E. of three independent experiments each done in duplicate. *, P,0.01 as compared with control.

Fig. 5. Time course for the effect of resveratrol on the expression of IL-6 gene in mixed glial cells exposed to hypoxia / hypoglycemia followed by reoxygenation. Cells were exposed to hypoxia / hypoglycemia for 2 h followed by normoxia for the indicated periods. Vehicle or resveratrol (50 mM) was added just before reoxygenation. IL-6 mRNA and b-actin mRNA were assayed as described in Fig. 1. Values represent means6S.E. of three independent experiments each done in duplicate. *, P,0.01 as compared with control.

induced a higher and transient level of IL-6 mRNA in mixed glial cells. To our knowledge, this finding has never before been reported. A previous study showed that the expression of c-fos and c-jun mRNA is induced in rat hypothalamic tissue after insulin-induced hypoglycemia (Itoi et al., 1996). Galoforo et al. (1996) also demonstrated that hypoglycemic treatment induces c-jun and c-fos gene expression, AP-1 binding activity and protein kinase C (PKC) activation in human breast carcinoma MCF-7 /ADR cells. To date, two signal transduction pathways, the adenylate cyclase pathway and the protein kinase C pathway, have been implicated in the modulation of IL-6 gene expression (Sehgal et al., 1987; Zhang et al., 1988). Whether hypoglycemia-induced IL-6 gene expression is mediated through the activation of PKC and the AP-1 transcription factor awaits further investigation. The transcription factors NF-kB and AP-1 have been implicated in the inducible expression of a variety of genes involved in response to oxidative stress and cellular defense mechanism. ROIs have been shown to activate the NF-kB transcription factor (Schreck et al., 1991; 1992; Schulze-Osthoff et al., 1993), which can be regarded as an oxidative stress-responsive factor that is activated by posttranslational processes. In contrast, AP-1 activation is observed under antioxidant or hypoxia treatment and is regarded as an antioxidant-responsive transcription factor (Meyer et al., 1993; Shenk et al., 1994; Yao et al., 1994). The 59 flanking region of the IL-6 gene contains multiple regulatory elements, including NF-kB, AP-1, NF-IL6 sites, etc. (Dendorfer et al., 1994). These reports suggest that the expression of IL-6 gene in rat cortical mixed glial cells might be induced under hypoxia / reoxygenation. Our results presented here showed that the IL-6 gene expression was rapidly induced during hypoxic / hypoglycemic periods with additional increases in IL-6 mRNA levels after reoxygenation. Our findings are consistent with those of previous studies showing that cells exposed to hypoxia produce a large amount of ROIs upon reoxygenation, which in turn activate the NF-kB transcription factor (McCord, 1985; 1987; Zweier et al., 1988; Schinetti et al., 1989). Nevertheless, the expression patterns of IL-6 gene were different from a previous report on rat astrocyte cultures showing that IL-6 transcripts are induced at the end of hypoxia (32 h), then further and transiently increased during the early phase of reoxygenation (up to 1 h) (Maeda et al., 1994). This discrepancy might be due to differences in cell cultures and ischemia models. Although the accumulation of IL-6 mRNA could be induced rapidly during the early phase of hypoxia / hypoglycemia and remained at maximum levels throughout the hypoxic / hypoglycemic period, the release of large amounts of IL-6 protein was delayed until reoxygenation. This observation was similar to findings of previous studies in that no demonstrable protein was produced in hypoxic cells (Kourembanas et al., 1990; Koga et al., 1992; Maeda et al., 1994). The reason for lack of efficient

M. J. Wang et al. / Journal of Neuroimmunology 112 (2001) 28 – 34

translation of IL-6 mRNA during hypoxia is not clear. It is well known that during oxygen and glucose deprivation, the concentration of high energy phosphates in the brain cells is significantly decreased, which in turn would affects protein synthesis (Kawai et al., 1989). It has also been shown that disaggregation of polyribosomes occurs during the hypoxic period, which is reversible upon reoxygenation, in astrocytes and neurons (Brown and Brierley, 1972; Petito et al., 1991). The loss of polyribosomes with the attendant disruption of mRNA strands indicates inhibition of protein synthesis (Petito et al., 1991). These observations may in part explain the phenomenon of the release of IL-6 protein, which is incompatible with the expression of IL-6 mRNA during hypoxia / hypoglycemia. Oxygen free radicals are highly reactive species that promote damage to lipids, DNA, carbohydrates and proteins, and induce production of several immune / inflammatory proteins which contribute to the process of excitoxic neuronal death. In brain ischemia, the production of ROIs occurs during the reperfusion period (McCord, 1985; 1987), and free radical scavengers can reduce brain damage after ischemia, particularly during reperfusion (Yang et al., 1994). Resveratrol has been reported as a ROI scavenger (Jang et al., 1999). In this study, we demonstrated that resveratrol inhibits IL-6 gene expression and protein secretion in mixed glial cells exposed to hypoxia / hypoglycemia followed by reoxygenation. Recently, resveratrol have been found to inhibit the LPS-induced expression of TNF-a and IL-1 b mRNA in endothelial cells and monocytes (Pendurthi et al., 1999). In mouse peritoneal macrophages, resveratrol could inhibit IL-6 release induced by calcium ionophore A23187 and fMLP (Zhong et al., 1999). Furthermore, it has been shown that resveratrol inhibited phorbol 12-myristate 13-acetate (PMA)-induced tissue factor (TF) expression in endothelial cells which mediated through the transcriptional level (Pendurthi et al., 1999). Another study showed that resveratrol posttranscriptionally decreased LPS-induced nitrite release in RAW 264.7 macrophages (Wadsworth and Koop, 1999). Since the decrease in mRNA level might be due to inhibit gene transcription or decrease mRNA stability. In this in vitro ischemic system, the real mechanisms of inhibitory effect on IL-6 mRNA level by resveratrol awaits further study. Previous studies have shown that the formation of free radicals occurs early in the reoxygenation period (5–60 min after reoxygenation) in human mononuclear phagocytes and rat astrocytes (Koga et al., 1992; Maeda et al., 1994). A recent report showed that resveratrol suppresses iNOS gene expression via the down-regulation of NF-kB in murine macrophages (Tsai et al., 1999). Since NF-kB can be activated through the generation of ROIs, it is conceivable that the inhibitory effect of resveratrol on IL-6 gene expression largely depends on the treatment time. In conclusion, the present results show that the IL-6 gene expression and protein secretion can be induced in rat

33

cortical mixed glial cells exposed to hypoxia / hypoglycemia followed by reoxygenation. Furthermore, resveratrol inhibits the secretion of IL-6 which might be act at the transcriptional and / or posttranscriptional levels, and further studies are required to address these issues. Thus, resveratrol might be beneficial in the treatment of inflammatory response induced by ischemia / reperfusion.

Acknowledgements This study was supported by grants (TCVGH887306D and 887307D) from Taichung Veterans General Hospital.

References Brown, A.W., Brierley, J.B., 1972. Anoxic-ischemic cell change in rat brain: light microscopic and fine-structural observations. J. Neurol. Sci. 16, 59–84. Campbell, I.L., Abraham, C.R., Masliah, E., Kemper, P., Inglis, J.D., Oldstone, M.B.A., Mucke, L., 1993. Neurologic disease induced in transgenic mice by cerebral overexpression of interleukin-6. Proc. Natl. Acad. Sci. USA 90, 10061–10065. Chanvitayapongs, S., Draczynska-Lusiak, B., Sun, A.Y., 1997. Amelioration of oxidative stress by antioxidants and resveratrol in PC12 cells. Neuroreport 8, 1499–1502. Chen, C.K., Pace-Asciak, C.R., 1996. Vasorelaxing activity of resveratrol and quercetin in isolated rat aorta. Gen. Pharmacol. 27, 363–366. Dendorfer, U., Oettgen, P., Libermann, T.A., 1994. Multiple regulatory element in the interleukin-6 gene mediate induction by prostaglandins, cyclic AMP, and lipopolysaccharide. Mol. Cell Biol. 14, 4443–4454. Feuerstein, G.Z., Liu, T., Barone, F.C., 1995. Cytokines, inflammation, and brain injury: role of tumor necrosis factor-alpha. Cerebro. Brain Metabol. Rev. 6, 341–360. Flaherty, J., Weisfeldt, M., 1988. Reperfusion injury. Free Radic. Biol. Med. 5, 409–419. Frankel, E.N., Kanner, J., German, J.B., Parks, E., Kinsella, J.E., 1993a. Inhibition of oxidation of human low-density lipoprotein by phenolic substances in red wine. Lancet 341, 454–457. Frankel, E.N., Waterhouse, A.L., Kinsella, J.E., 1993b. Inhibition of human LDL oxidation by resveratrol. Lancet 341, 1103–1104. Galoforo, S.S., Berns, C.M., Erdos, G., Corry, P.M., Lee, Y.J., 1996. Hypoglycemia-induced AP-1 transcription factor and basic fibroblast growth factor gene expression in multidrug resistant human breast carcinoma MCF-7 /ADR cells. Mol. Cell Biochem. 155, 163–171. Hattori, A., Tanaha, E., Murase, K., Ishida, N., Chatani, Y., Tsujimoto, M., Hayashi, K., Kohno, M., 1993. Tumor necrosis factor stimulates the synthesis and secretion of biologically active nerve growth factor in non-neuronal cells. J. Biol. Chem. 268, 2577–2582. Hopkins, S.J., Rothwell, N.J., 1995. Cytokines and the nervous system I: expression and recognition. Trends Neurosci. 18, 83–88. Itoi, K., Horiba, N., Tozawa, F., Sakai, Y., Sakai, K., Abe, K., Demura, H., Suda, T., 1996. Major role of 39,59-cyclic adenosine monophosphate-dependent protein kinase A pathway in corticotropin-releasing factor gene expression in the rat hypothalamus in vivo. Endocrinology 137, 2389–2396. Jang, D.S., Kang, B.S., Ryu, S.Y., Chang, I.M., Min, K.Y., Kim, Y., 1999. Inhibitory effects of resveratrol analogs on unopsonized zymosaninduced oxygen radical production. Biochem. Pharmacol. 57, 705– 712. Jang, M., Cai, L., Udeani, G.O., Slowing, K.V., Thomas, C.F., Beecher, C.W.W., Fong, H.H.S., Farnsworth, N.R., Kinghorn, A.D., Mehta,

34

M. J. Wang et al. / Journal of Neuroimmunology 112 (2001) 28 – 34

R.G., Moon, R.C., Pezzuto, J.M., 1997. Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science 275, 218–220. Kawada, N., Seki, S., Inoue, M., Kuroki, T., 1998. Effects of antioxidants, resveratrol, quercetin and N-acetylcysteine on the functions of cultured rat hepatic stellate cells and Kupffer Cells. Hepatol. 27, 1265–1274. Kawai, S., Yonetani, M., Nakamura, H., Okada, Y., 1989. Effects of deprivation of oxygen and glucose on the neural activity and the level of high energy phosphates in the hypocampal slices of immature and adult rat. Dev. Brain Res. 48, 11–18. Kimura, Y., Okuda, H., Arichi, S., 1985. Effects of stilbenes on arachidonate metabolism in leukocytes. Biochim. Biophys. Acta 834, 275– 278. Koga, S., Ogawa, S., Kuwabara, K., Brett, J., Leavy, J.A., Ryan, J., Koga, Y., Plocinski, J., Benjamin, W., Burns, D.K., Stern, D., 1992. Synthesis and release of interleukin 1 by reoxygenated human mononuclear phagocytes. J. Clin. Invest. 90, 1007–1015. Kourembanas, S., Hannan, R.L., Faller, D.V., 1990. Oxygen tension regulates the expression of the platelet-derived growth factor-B chain gene in human endothelial cells. J. Clin. Invest. 86, 670–674. Liu, T., McDonnell, P.C., Young, P.R., White, R.F., Siren, B.A., Hellenbeck, J.M., Barone, F.C., Feuerstein, G.Z., 1993. Interleukin-1b mRNA expression in ischemic rat cortex. Stroke 24, 1746–1751. Liu, T., Clark, R.K., McDonnell, P.C., Young, P.R., White, R.F., Barone, F.C., Feuerstein, G.Z., 1994. Tumor necrosis factor-a expression in ischemic neurons. Stroke 25, 1481–1488. Loddick, S.A., Turnbull, A.V., Rothwell, N.J., 1998. Cerebral interleukin6 is neuroprotective during permenent focal cerebral ischemia in the rat. J. Cerebr. Blood Flow Metab. 18, 176–179. Maeda, Y., Matsumoto, M., Hori, O., Kuwabara, K., Ogawa, S., Yan, S.D., Ohtsuki, T., Kinoshita, T., Kamada, T., Stern, D.M., 1994. Hypoxia / reoxygenation-mediate induction of astrocyte interleukin 6: a paracrine mechanism potentially enhancing neuron survival. J. Exp. Med. 180, 2297–2308. Meyer, M., Schreck, R., Baeuerle, P.A., 1993. H 2 O 2 and antioxidants have opposite effects on activation of NF-kB and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 12, 2005– 2015. McCord, J.M., 1985. Oxygen-derived free radicals in postischemic tissue injury. New Engl. J. Med. 312, 159–163. McCord, J.M., 1987. Oxygen-derived free radicals: a link between reperfusion injury and inflammation. Fed. Proc. 46, 2402–2406. Pendurthi, U.R., Williams, J.T., Rao, L.V., 1999. Resveratrol, a polyphenolic compound found in wine, inhibits tissue factor expression in vascular cells: a possible mechanism for the cardiovascular benefits associated with moderate consumption of wine. Arterioscler. Thromb. Vasc. Biol. 19, 419–426. Petito, C.K., Juurlink, B.H.J., Hertz, L., 1991. In vitro models differentiating between direct and indirect effects of ischemia on astrocytes. Exp. Neurol. 113, 364–372. Plum, F., 1983. What causes infarction in ischemic brain. Neurology 33, 222–233. Repine, J., Cheronis, J., Rodell, T., Linas, S., Patt, A., 1987. Pulmonary oxygen toxicity and ischemia-reperfusion injury. Am. Rev. Respir. Dis. 136, 483–485.

Rothwell, N., Loddick, S., Lawrence, C., 1995. Cytokines and neurodegeneration. In: Rothwell, N.J. (Ed.), Immune Response in the Nervous System. BIOS Scientific, Oxford, pp. 77–99. Schinetti, M.L., Sbarbati, R., Scarlattini, M., 1989. Superoxide production by human umbilical vein endothelial cells in an anoxia / reoxygenation model. Cardiovasc. Res. 23, 76–80. Schreck, R., Rieber, P., Baeuerle, P.A., 1991. Reactive oxygen intermediates as apparent widely used messengers in the activation of the NF-kB transcription factor and HIV-1. EMBO J. 10, 2247–2258. Schreck, R., Meier, B., Mannel, D., Droge, W., Baeuerle, P.A., 1992. Dithiocarbamates as potent inhibitors of nuclear factor kB activation in intact cells. J. Exp. Med. 175, 1181–1194. Schulze-Osthoff, K., Beyaert, R., Vandevoorde, V., Haegeman, G., Fiers, W., 1993. Depletion of the mitochondrial electron transport abrogates the cytotoxic and gene-inductive effects of TNF. EMBO J. 12, 3095–3104. Sehgal, P.B., Walther, Z., Tamm, I., 1987. Rapid enhancement of b2interferon / B-cell differentiation factor BSF-2 gene expression in human fibroblasts by diacylglycerol and the calcium ionophore A23187. Proc. Natl. Acad. Sci. USA 84, 3663–3667. Shenk, H., Klein, M., Erdbrugger, W., Droge, W., Schulze-Osthoff, K., 1994. Distinct effects of thioredoxin and other antioxidants on the activation of NF-kB and AP-1. Proc. Natl. Acad. Sci. USA 91, 1672–1676. Subbaramaiah, K., Chung, W.J., Michaluart, P., Telang, N., Tanabe, T., Inoue, H., Jang, M., Pezzuto, J.M., Dannenberg, A.J., 1998. Resveratrol inhibits cyclooxygenase-2 transcription and activity in phorbol ester-treated human mammary epithelial cells. J. Biol. Chem. 273, 21875–21882. Tsai, S.H., Lin-Shiau, S.Y., Lin, J.K., 1999. Suppression of nitric oxide synthase and the down-regulation of the activation of NF-kB in macrophages by resveratrol. Br. J. Pharmacol. 126, 673–680. Wadsworth, T.L., Koop, D.R., 1999. Effects of the wine polyphenolics quercetin and resveratrol on pro-inflammatory cytokine expression in RAW 264.7 macrophages. Biochem. Pharmacol. 57, 941–949. Yang, G., Chan, P.H., Chen, J., Carlson, E., Chen, S.F., Weinstein, P., Epstein, C.J., Kamii, H., 1994. Human copper-zinc superoxide dismutase transgenic mice are highly resistant to reperfusion injury after focal cerebral ischemia. Stroke 25, 165–170. Yao, K.S., Xanthoudakis, S., Curran, T., O’Dwyer, P.J., 1994. Activation of AP-1 and of a nuclear redox factor, Ref-1, in the response of HT29 colon cancer cells to hypoxia. Mol. Cell Biol. 14, 5997–6003. Zhang, Y., Lin, J.X., Vilcek, J., 1988. Synthesis of interleukin 6 (interferon b2 / B cell stimulatory factor 2) in human fibroblasts is triggered by an increase in intracellular cyclic AMP. J. Biol. Chem. 263, 6177–6182. Zhong, M., Cheng, G.F., Wang, W.J., Guo, Y., Zhu, X.Y., Zhang, J.T., 1999. Inhibitory effect of resveratrol on interleukin 6 release by stimulated peritoneal macrophages of mice. Phytomedicine 6, 79–84. Zweier, J.L., Kuppusany, P., Lutty, G.A., 1988. Measurement of endothelial cell free radical generation: evidence for a central mechanism of free radical injury in postischemic tissues. Proc. Natl. Acad. Sci. USA 85, 4046–4050.