- Email: [email protected]
ICAM3 mediates tumor metastasis via a LFA-1-ICAM3-ERM dependent manner
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
Contents lists available at ScienceDirect
BBA - Molecular Basis of Disease journal homepage: www.elsevier.com/locate/bbadis
ICAM3 mediates tumor metastasis via a LFA-1-ICAM3-ERM dependent manner
T
Wenzhi Shena, Xiaoyuan Zhanga, Renle Dub, Yan Fanb, Dehong Luod, Yonghua Baoa, ⁎ ⁎ ⁎ Wancai Yanga, Na Luob, , Yunping Luoc, , Shuangtao Zhaoe, a
Department of Pathology, Institute of Precision Medicine, Jining Medical University, Jining 272067, China Dept. of Immunology, School of Medicine, Nankai University, Tianjin 300071, China c Dept. of Immunology, Institute of Basic Medical Science, Chinese Academy of Medical Science, School of Basic Medicine, Peking Union Medical College, Beijing 100005, China d The First People's Hospital of Zunyi, Zunyi 563002, China e Dept. of Radiation Oncology, National Cancer Center/Cancer Hospital, Chinese Academy of Science and Peking Union Medical College, Beijing 100021, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: ICAM3 Tumor metastasis ERM LFA-1 Lifitegrast
ICAM3 was reported to promote metastasis in tumors. However, the underlying mechanism remains elusive. Here, we disclosed that the expression of ICAM3 was closely correlated with the TNM stage of human breast and lung cancer, as well as the dominant overexpression in high aggressive tumor cell lines (231 and A549 cells). Moreover, the knockdown of ICAM3 inhibited tumor metastasis whereas the ectopic expression of ICAM3 promoted tumor metastasis both in vitro and in vivo. In addition, exploration of the underlying mechanism demonstrated that ICAM3 not only binds to LFA-1 with its extracellular domain and structure protein ERM but also to lamellipodia with its intracellular domain which causes a tension that pulls cells apart (metastasis). Furthermore, ICAM3 extracellular or intracellular mutants alternatively abolished ICAM3 mediated tumor metastasis in vitro and in vivo. As a therapy strategy, LFA-1 antibody or Lifitegrast restrained tumor metastasis via targeting ICAM3-LFA-1 interaction. In summary, the aforementioned findings suggest a model of ICAM3 in mediating tumor metastasis. This may provide a promising target or strategy for the prevention of tumor metastasis.
1. Introduction Tumor metastasis is the key factor that compromises the prognosis of tumor patients and accounts for 90% of tumor death [1,2]. Metastasis is a multistep process by which a percentage of primary tumor cells acquire the ability to spread from their initial site to the surrounding normal tissues in the local areas or to secondary tissues/organs [3,4]. It is comprised of multiple steps, which include penetrating the walls of lymphatic and/or blood vessels, infiltration into the circulation system, re-penetration through the vessels, docking and proliferation in the distant organs to form a metastatic tumor. Failure at any one of these steps can block the entire metastatic process. Since tumor metastasis is responsible for the majority of deaths for cancer patients, a better understanding of the molecular mechanism involved in the tumor spreading process is important for specific targeting of the tumor metastasis. The intercellular adhesion molecule (ICAM) family is a subfamily of
the immunoglobulin (Ig) superfamily with five known ICAM family members (ICAM1-ICAM5) which play a role in inflammation, immune responses, and intracellular signaling [5]. All ICAMs are type I transmembrane glycoproteins that contain an N-terminus extracellular domain, a single transmembrane domain, and a C-terminus cytoplasmic domain. ICAMs possess 2–9 Ig-like C2-type domains in extracellular region and bind to the leukocyte adhesion protein LFA-1 [6–9]. The extracellular domain of ICAMs show a striking homology, but the transmembrane domain and cytoplasmic domain show little conservation. Important differences may exist among various ICAMs in regards to cell surface localization, cytoskeletal interactions, and signaling. Previous reports indicate that ICAM-1 is involved in breast cancer cell metastasis via interacting with MUC1 and Src [10–13]. Although elevated levels of other ICAM family members occur in certain carcinomas, the role of ICAMs in the tumor metastasis and clinical outcomes remains unclear. ICAM3 is a member of the ICAMs subfamily. Numerous reports
Abbreviations: ICAM3, intercellular adhesion molecule 3; LFA-1, lymphocyte function associated antigen-1; ERM, ezrin/radixin/moesin ⁎ Corresponding authors. E-mail addresses: [email protected] (N. Luo), [email protected] (Y. Luo), [email protected] (S. Zhao). https://doi.org/10.1016/j.bbadis.2018.05.002 Received 15 September 2017; Received in revised form 20 March 2018; Accepted 1 May 2018 Available online 03 May 2018 0925-4439/ © 2018 Elsevier B.V. All rights reserved.
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
2.4. Western blotting
suggest that ICAM3 is involved in immune cell interactions and T lymphocyte activation [9,14]. Our previous work proved that ICAM3 mediates the PI3K-AKT signaling to promote the inflammation and cancer cell stemness [15]. Recently, several studies have suggested that ICAM3 exerts stimulatory activity in cancer cell migration and invasion via PI3K-AKT signaling pathway [16,17]. However, the details remain elusive. In addition, the proof and model of ICAM3 mediated tumor cell metastasis are not persuasive. Here, we investigated the role of ICAM3 in tumor metastasis and found that the expression of ICAM3 was closely correlated with TNM as well as dominant overexpression in high aggressive tumor cell lines (231 and A549 cells). Moreover, knockdown of ICAM3 inhibited tumor metastasis, ectopic expression of ICAM3 promoted tumor metastasis both in vitro and in vivo. Exploration of the underlying mechanism demonstrated that ICAM3 binds to LFA-1 (extracellular domain) and structure protein ERM or lamellipodia (intracellular domain) to both give cells a tension further to pulled cells to move (metastasis). In addition, LFA-1 antibody and Lifitegrast could restrain tumor metastasis via targeting ICAM3-LFA-1 interaction. Our research revealed that targeting of ICAM3 was a promising strategy for prevention of tumor metastasis.
Cell lysates from different cell lines were prepared with RIPA buffer in the presence of protease inhibitor cocktails and Phosphatase Inhibitor Cocktail 2 and 3 (P8340, P5726 and P0044, Sigma-Aldrich, St Louis, MO, USA) [19]. Protein (20–50 μg) was loaded onto 8–15% Trisacrylamide gels and blotted with antibodies that included: ICAM3 (cat. #ab109405 Abcam Biotechnology, Inc., Abcam, Hong Kong), β-actin (cat. #sc-47778, Santa Cruz Biotechnology, Inc. Santa Cruz, CA), FLAG (cat. #14793), ERM (cat. #3142), E-cadherin (cat. #3195), LFA-1 (cat. #73663), vimentin (cat. #5741, Cell Signal Technology Inc., Danvers, MA). 2.5. Migration, invasion, and wound healing assays For migration assays, 1 × 105 MDA-MB-231 or A549 cells were resuspended in serum-free medium and seeded into Boyden chamber inserts with a 5-μm pore membrane (BD Bioscience, Franklin Lakes, NJ). Medium containing 10% FBS was added to the lower chamber. For invasion assays, the upper chamber of the insert was coated with Matrigel (BD Biosciences), and 1 × 106 MDA-MB-231 or A549 cells were added to the inserts. For wound healing assays, 1 × 106 MDA-MB231 or A549 cells were seeded and grown to 90% confluence. A sterile pipette tip was then used to create scratch wounds. Images were then taken at 0 and 12 h with an IX71 inverted microscope (Olympus, Tokyo, Japan). Three independent experiments were performed.
2. Materials and methods 2.1. Vector construction ShRNA targeting human ICAM3 and scrambled control sequence were summarized in Table 1. The palindromic DNA oligos were annealed to each other to form a double-strand oligo and ligated to the linearized pLV-H1-EF1α-puro (cat. #SORT-B19, Biosettia Inc.) vector to generate circled pLV-H1-shRNA-Puro.
2.6. Immunoprecipitation Cell protein lysates were incubated with protein A/G agarose beads (Life technology) and antibody (Abcam plc, Cambridge, UK) overnight at 4 °C. Then centrifuge at 2500 rpm for 30s and wash the pellets carefully pre-chilled PBS buffer. Finally, binding proteins were boiled to proceed SDS-PAGE. Immunoprecipitates were analyzed with the specific antibody by Western blot.
2.2. Cell culture A549 cells were cultured in RPMI-1640 with 10% FBS, 100 U/ml penicillin/streptomycin. MDA-MB-231, MDA-MB-231-luc cells were cultured in L15 medium supplemented with 10% FBS, 100 U/ml penicillin/streptomycin. A549 and 231 cells were infected with lentivirus carrying pLV-H1-shICAM3-puro or pLV-EF1α-ICAM3 (mut)-puro plasmids, followed by selection using 2 μg/ml puromycin to generate polyclonal cell populations.
2.7. Immunofluorescence and cytoskeleton staining Cells were fixed with 4% formaldehyde for 15 min and then blocked with 1% bovine serum albumin for 1 h. Then immunolabeled with primary antibodies overnight at 4 °C, followed by incubation with species-appropriate secondary antibodies at room temperature for 1 h. Nuclei were stained with DAPI, and Images were obtained using confocal microscope with 160× objective (Olympus). For cytoskeleton staining, after rinsing, the cells were incubated with 5 μg/ml FITCphalloidin (P2141, Sigma, St. Louis, MO) at room temperature for 1 h. The lamellipodia of each cell was counted to represent the cell morphology after gene expression changes. Images were obtained with confocal microscope 80× objective (Olympus).
2.3. Immunohistochemistry Immunostaining was performed on paraffin-embedded human lung cancer, stomach cancer, colon cancer, prostate cancer and breast cancer tissue microarray (80 samples from cat. # MC8010, 240 samples from cat. # Top4-240a, Alenabio Company, Shanxi, China). Expression levels of ICAM3 in the tissue microarray were scored according to the percentage of positive cells in each cancer tissues. The images were recorded by Olympus BX51 Epi-fluorescent microscopy under a 10× or 40× objective (Olympus Co., Tokyo, Japan) [18].
2.8. Tumor xenografts Female NOD/SCID mice at 6–8 weeks of age were separated randomly into five groups (n = 7) for each group based on minimal 30%
Table 1 Primer sequences. Name
Sequence
ICAM3-sh1 ICAM3-sh2 SC Flag-ICAM3-F Flag-ICAM3-R
AAAAGCAGTACTGATTGTCCCAGCTTTGGATCCAAAGCTGGGACAATCAGTACTGC AAAAGCAATGGCTCTCAGATAACAGTTGGATCCAACTGTTATCTGAGAGCCATTGC AAAAGCTACACTATCGAGCAATTTTGGATCCAAAATTGCTCGATAGTGTAGC GCTCTAGAGCCACCATGGATTACAAGGATGACGACGATAAGAGCCCGATGGCCACCATGGTACC CGACGCGTTCACTCAGCTCTGGACGG
2567
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
decrease from 1 g tumors with 250 μg s.d. (standard deviation), α error of 0.05 and a β error of 0.8. In all, 3 × 106 A549 cells (A549-sc, A549shICAM3, A549-MCS, A549-ICAM3, A549-ICAM3ΔI, A549-ICAM3ΔE) were inoculated s.c. into each mouse at right axilla. Tumor volume (mm3) was measured with calipers two times per week and calculated by using the standard formula: length × width2 / 2. The individual measuring the mice was unaware of the identity of the group measured. Two months after implantation, primary tumors were harvested and analyzed by in vivo molecular imaging technology. Lungs were fixed in formalin, and embedded in paraffin, and sections were analyzed by H& E staining.
(Fig. 3C). Trans-well assay results showed that exogenous overexpression of ICAM3 promoted the cell migration capacity of both cell lines (Fig. 3D & E). The same results were obtained in invasion and wound-healing assays (Fig. 3F–H) where ectopic expression of ICAM3 promoted the migration and invasion capacity of both cell lines. Collectively, these results further support the contention of an important role for ICAM3 in tumor metastasis. 3.4. ICAM3 promotes tumor metastasis in vivo Since ICAM3 contributes to the metastatic properties of tumor cells in vitro, we next tested the results in an animal model. To this end, stable A549-sc, A549-shICAM3, A549-MCS and A549-ICAM3 cells were injected into the forth fat pad of NOD/SCID mice. As shown in Fig. 4A, the tumor growth and tumor volume in the A549-shICAM3 group showed a marked reduction versus the A549-sc control, consistently, the tumor growth and tumor volume in the A549-ICAM3 group showed a marked increase versus the A549-MCS control (Fig. 4E). Moreover, the living image results displayed a decreased primary tumor volume and lung metastasis in A549-shICAM3 group (Fig. 4B), an increased primary tumor volume and lung metastasis in A549-ICAM3 group (Fig. 4F). In addition, lung tissues from mice transplanted with A549-shICAM3 were less infiltrated than those of mice transplanted with A549-sc (Fig. 4C & G), indicating that deficient of ICAM3 inhibits tumor metastasis in vivo. At the same time, mice transplanted with A549-ICAM3 showed significantly more metastatic lung nodules and larger metastatic areas than those of mice transplanted with A549-MCS (Fig. 4D & H). Thus, our results indicated that ICAM3 promotes tumor metastasis in vivo.
2.9. Statistical analysis Values were expressed as means ± s.e.m. Significance was determined by χ2 test, others were determined by Student's t-test. A value of P < 0.05 was used as the criterion for statistical significance. * indicates significant difference with P < 0.05, ** indicates significant difference with P < 0.01, *** indicates significant difference with P < 0.001. 3. Results 3.1. Expression of ICAM3 correlates with TNM stage of human breast and lung cancers To determine whether ICAM3 plays a role in cancer metastasis, we performed immunohistochemical analyses with an ICAM3-specific antibody in tissue microarrays containing 160 samples (10 normal breast, 10 normal lung, 70 breast cancer and 70 lung cancer tissues) of human with different clinical degrees. As shown (Fig. 1A), a relatively high expression of ICAM3 was detectable in breast or lung tumor tissues, whereas, ICAM3 expression was weakly detected in normal breast or lung tissues. Moreover, ICAM3 demonstrated a higher expression in late-stage tumor. ICAM3 up-regulation was notable even in early-stage tumors (Fig. 1B).
3.5. ICAM3 mediates tumor cell metastasis via binding ezrin/radixin/ moesin (ERM) To determine the mechanism underlying the role of ICAM3, we subsequently tested the regulatory effect of ICAM3 on EMT markers. Interestingly, Western blotting showed that there was nearly no change of the expression levels of E-cadherin and vimentin with ICAM3 suppression (Fig. 5A). However, it has been reported that ICAM3 could interact with ezrin/radixin/moesin (ERM) proteins through its intercellular domain [20,21]. We next checked the expression level of ERM with ICAM3 deficiency. In accordance with our expectation, the expression level of ERM was decreased in both cell lines (Fig. 5A). To provide a visualized view of the interaction of ICAM3 and ERM, double fluorescent staining was performed in MDA-MB-231 and A549 cells. The results showed that ICAM3 and ERM had an obvious co-localization in both cell lines (Fig. 5B). To better understand the interaction of ICAM3 and ERM, we reconstituted either wild-type (WT) ICAM3, an intracellular domain defective (Mut ΔI), or an extracellular domain defective (Mut ΔE) (Fig. 5B) into two cell lines. Checking more carefully, we noted that the expression of ERM increased following expression of WT-ICAM3. However, expression of Mut ΔI and Mut ΔE, ERM level did not changed (Fig. 5C). To provide a visualized view of the interaction of ICAM3 and ERM, double fluorescent staining was enforced in A549 cells. The results showed that in WT ICAM3 overexpression cells, ERM could translocate to cell membrane and have co-expression with ICAM3. However, in the MutΔI or MutΔE overexpression groups, the abilities of ERM translocation and co-expression were reduced (Fig. 5D). In addition, an immunoprecipitation (IP) assay was performed to test the interaction between different ICAM3 forms and ERM. As shown in Fig. 5E, FLAG-WT ICAM3 antibody pulled down ERM, whereas FLAGMut ΔI antibody did not pull down ERM. Interestedly, FLAG-Mut ΔE antibody did not pull down ERM either. Furthermore, immunofluorescent staining showed that overexpression of WT-ICAM3 increased the formation of lamellipodia and this effect was partially reversed by both Mut ΔI and Mut ΔE (Fig. 5F). To explore whether the interaction of ICAM3 and ERM effects tumor
3.2. Suppression of ICAM3 inhibits tumor metastasis in vitro We next investigated whether the observations in the clinical samples were represented in tumor cell lines. The mRNA level of ICAM3 increased in breast and lung cancer cell lines relative to the normal cell line (Fig. 2A & C). Immunoblot analysis of ICAM3 protein levels supported the quantitative PCR results, suggesting that ICAM3 was in fact increased in the cancer cell lines (Fig. 2B & D). Therefore, the cell lines appeared suitable to use as a model to determine the impact of ICAM3 on tumor metastasis. To investigate the functional role of ICAM3 in tumor metastasis, we knock downed ICAM3 expression in human breast cancer cell line MDAMB-231 and human lung cancer cell line A549 (Fig. 2E) both of which have high metastatic and malignant properties. Trans-well assay was initially performed to detect the function of ICAM3 in the metastasis of both cell lines. As shown in Fig. 2F, knockdown ICAM3 expression suppressed the migration capacity of both cell lines (Fig. 2F & G). The same results were obtained in invasion and wound-healing assays (Fig. 2H–J), ICAM3 deficiency inhibited the migration and invasion capacity of both cell lines. Together, our results showed an indicative role of ICAM3 in regulating tumor metastasis. 3.3. ICAM3 overexpression promotes tumor metastasis in vitro To further evaluate the effect of ICAM3 on tumor metastasis, we also overexpressed ICAM3 in MDA-MB-231 and A549 wild type cells. We found that ICAM3 had a high overexpression efficiency as indicated by immunoblot and flow cytometry (Fig. 3A & B). Immunofluorescence results showed that ICAM3 clearly localized on the cell membrane 2568
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 1. Correlation of ICAM3 expression with tumor TNM stage of human breast & lung cancer. (A) Immunohistochemical staining of ICAM3 in paraffin-embedded human tumor tissue microarray with different TNM stage. (B) The relationship of ICAM3 expression with tissue status and TNM stage. Each point represents one sample and the middle line represents the mean value. Data are shown as the mean ± s.e.m. The number of samples and the mean values of each group are listed below the x axis (P-value was determined by Student's t-test).
3.6. ICAM3 promotes tumor cell metastasis selectively via interaction with LFA-1 in vitro
cell metastasis, a trans-well assay was performed to investigate the number of migrated cells. The results showed that WT-ICAM3 promoted tumor cell migration whereas both Mut ΔI and Mut ΔE partially reversed this effect in both cell lines (Fig. 5G & H). Moreover, these results were confirmed by a wound healing assay (Fig. 5I). Taken together, these results suggest that ICAM3 interacted with ERM to alter lamellipodia formation which plays a role in tumor cell metastasis. More importantly, both the extracellular domain and intracellular domain of ICAM3 were dispensable for this process.
Since we established that Mut ΔE was essential for ICAM3-ERM interaction and tumor cell metastasis, we next explored the underlying mechanism involved in this process. Since LFA-1 is the sole receptor for ICAM3, we first detected the expression level of LFA-1 in both the cell supernatant and total proteins. Western blotting results showed that LFA-1 was expressed in both the cell supernatant and total proteins, but no significant difference was observed in different ICAM3 forms reconstituted groups (Fig. 6A). To identify whether ICAM3 interacted
2569
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 2. Suppression of ICAM3 inhibits tumor metastasis in vitro. (A) QPCR was performed to detect the ICAM3 mRNA expression in normal breast cell line MCF-10A and breast cancer cell line T47D, 231 cell lines. (B) Western was used to check ICAM3 protein expression in MCF-10A, T47D and 231 cell lines. (C) QPCR to detect the ICAM3 mRNA expression in normal lung cell line MRC5 and lung cancer cell line H460, A549 cell lines. (D) Western was used to check ICAM3 protein expression in MRC5, H460 and A549 cell lines. (E) Western to check the knockdown efficiency of ICAM3 (sh1 and sh2) in 231 and A549 cell lines. (F & G) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. (H) Statistic results of invasion assay on invaded cells were shown. ***P < 0.001. (I & J) Representative images of wound healing assay and statistic results on migrated cells were shown. ***P < 0.001.
that exogenous LFA-1 accelerated cell migration in both cell lines (Fig. 6D & E). Since macrophages abundantly express LFA-1 similar to other tumor associated immunocytes (e.g., monocytes), we supposed that LFA-1 signaling also involved macrophages. To clarify our supposition, we co-cultured THP-1 cells with tumor cells that expressed different ICAM3 forms. Wound healing assay results demonstrated that THP-1 cells accelerated the WT-ICAM3 overexpression tumor cell
with LFA-1, we performed an IP assay. As shown in Fig. 6B, LFA-1 could be detected in both cell lines when using FLAG-ICAM3 antibody to pull down. To further investigate the function role of LFA-1 in ICAM3 mediated tumor cell metastasis, we added the human recombinant LFA1 protein into cells. Western blotting results showed that expression of ERM increased whereas ICAM3 had no significant change following LFA-1 stimulation (Fig. 6C). In addition, trans-well assay results showed 2570
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 3. Overexpression of ICAM3 promotes tumor metastasis in vitro. (A) Western to check ICAM3 overexpression efficiency in 231 and A549 cell lines. (B) Flow cytometry assay was performed to detect ICAM3 overexpression efficiency in 231 and A549 cell lines. (C) Immunofluorescence assay was used to detect ICAM3 overexpression efficiency and location in 231 and A549 cell lines. (D & E) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. (F) Statistic results of invasion assay on invaded cells were shown. ***P < 0.001. (G & H) Representative images of wound healing assay and statistic results on migrated cells were shown. ***P < 0.001.
2571
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 4. ICAM3 promotes tumor metastasis in vivo. (A) Tumor growth curve of different groups (sc and shICAM3) and several tumors separated from each group were shown. (B) Living image was used to check tumors and lung metastasis of different groups (sc and shICAM3). (C) Representative images of H&E staining on tumors from A549-shICAM3 and A549-sc groups were shown. (D) Statistic results of metastatic nodules and areas in the lungs from A549-shICAM3 and A549-sc groups were shown. **P < 0.01. (E) Tumor growth curve of different groups (MCS and ICAM3) and several tumors separated from each group were shown. (F) Living image was used to check tumors and lung metastasis of different groups (MCS and ICAM3). (G) Representative images of H& E staining on tumors from A549-ICAM3 and A549MCS groups were shown. (H) Statistic results of metastatic nodules and areas in the lungs from A549ICAM3 and A549-MCS groups were shown. **P < 0.01.
2572
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 5. ICAM3 mediates tumor cell metastasis via binding ezrin/radixin/moesin (ERM). (A) Western was used to check the expression of EMT markers and ERM in 231 and A549 ICAM3 knockdown or sc cells. (B) Overview of different ICAM3 mutants structure. (C) Western was used to check the expression of ERM in different ICAM3 mutants reconstituted cells. (D) Immunofluorescence assay was used to detect ICAM3 and ERM co-location in A549 expressed different constructs cells. (E) IP assay was performed to detect the interaction of different ICAM3 mutants labeled with FLAG tag and ERM. (F) To detect F-actin rearrangement in various ICAM3 mutants transfected 231 and A549 cells, the cytoskeleton was stained with FITC-phalloidin. (G & H) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. (I) Statistic results of wound healing assay on migrated cells were shown. ***P < 0.001. 2573
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
migration, whereas this effect was abolished by ICAM3 ΔI or ΔE mutation (Fig. 6F & G). These results together imply that LFA-1 selectively interacts with ICAM3 to further promote tumor cell metastasis in vitro.
inflammation, immune responses and in intracellular signaling events. Recently, a number of studies have reported that ICAM-1 is present in several cancer types (e.g., prostate, breast, oral cancers) and is at least partly involved in their progression and metastasis [22–26]. As a vital member of ICAMs, ICAM3 shares its function with ICAM1 in cancer progression. In this regard, ICAM1 and ICAM3 possess the same extracellular domain and have the same receptor (i.e., LFA-1). However, ICAM1 and ICAM3 possess different intracellular domains in order to mediate disparate functions. Our study shows that ICAM3 binds LFA-1 and ERM at the same time in order to give the tumor cells a tension that mediates cell movement. This contrasts with ICAM1 function that induces cell metastasis via binding MUC1 and Src [27,28]. These findings provide a new insight into the way that ICAMs mediate cell movement. Metastasis is a multistep process whereby the acceleration of any particular step may finally lead to the promotion of the entire metastatic process. Malignant cells break away from the primary tumor and attach to and degrade proteins within the surrounding extracellular matrix (ECM) which separates the tumor from adjoining tissues. By degrading these proteins, cancer cells breach the ECM and escape [29,30]. ICAMs work as the adhesion molecules and therefore may play a vital role in this metastatic process In our study, we found that ICAM3 has no effect on ECM protein degradation since the expression of Ecadherin and vimentin was not changed with ICAM3 overexpression. However, ICAM3 is involved in the cancer cell “escape” process. Our results showed that with the assistance of LFA-1 expressed in tumor associated monocytes and the structure protein ERM expressed in tumor cells, ICAM3 linked these two proteins and worked as a “leg” to promote cancer cell movement or escape. That is to say, cancer cell movement or escape is accentuated when cancer cells express high levels of ICAM3. These findings provide a new insight into the role of ICAMs and the promotion of metastasis. All ICAM proteins are type I transmembrane glycoproteins, containing an N-terminus extracellular domain, a single transmembrane domain, and a C-terminus cytoplasmic domain. ICAM3 is a member of the ICAMs subfamily and not only functions as an adhesion molecule, but also as a potent signaling molecule. In this study, we constructed different ICAM3 mutants that is, the extracellular domain deficient mutant ΔE and intracellular domain deficient mutant ΔI. Our in vivo results showed that ΔI or ΔE not only abolishes ICAM3 mediated lung metastasis, but also reduces tumor growth. That is to say, ICAM3 works as a signaling molecule and may play a role in promoting tumor growth or tumor stemness. The extracellular domain and intracellular domain were both indispensable for ICAM3 mediated signaling transduction. These findings provide novel information for the role of ICM3 in the metastatic process. Lifitegrast (trade name Xiidra) is an FDA approved drug indicated for the treatment of signs and symptoms of dry eye [31]. Lifitegrast inhibits an integrin, lymphocyte function-associated antigen 1 (LFA-1) [32], from binding to ICAM-1 which down-regulates inflammation mediated by T lymphocytes [33–35]. ICAM1 and ICAM3 possess nearly the same extracellular domain and the same binding to LFA-1. We therefore used Lifitegrast to inhibit ICAM3 and LFA-1 interaction and ultimately to inhibit tumor metastasis caused by ICAM3. Our results show that Lifitegrast inhibits ICAM3 and LFA-1 interaction and also suppresses tumor cell metastasis. These effects are especially enhanced with the combined treatment using Lifitegrast and LFA-1 antibody which significantly inhibits tumor metastasis. These findings provide potential new targets for tumor metastasis treatment. In conclusion, our results demonstrate that ICAM3 correlates with the tumor TNM stage and promotes tumor metastasis in vitro and in vivo. The underlying mechanism involves ICAM3 interaction not only with LFA-1 through its extracellular domain but also ERM through its intracellular domain simultaneously which in turn causes a tension within cells that pulls cells apart (metastasis). Furthermore, Lifitegrast and LFA-1 antibody restrain tumor metastasis via targeting ICAM3-LFA1 interaction. Therefore, our findings may provide a novel potential
3.7. The extracellular and intracellular domain of ICAM3 were indispensable for ICAM3 mediated tumor metastasis in vivo To evaluate the impact of different ICAM3 expression forms on tumor dissemination in vivo, we next tested the effect of different ICAM3 expression forms in a xenograft animal model. To this end, stable A549-MCS, A549-WTICAM3, A549-MutΔI and A549-MutΔE cells were injected into the forth fat pad of NOD/SCID mice. The results indicated that the tumor growth and tumor volume increased in the WtICAM3 group compared with the MCS control group and that this effect was abolished by the ICAM3 ΔI or ΔE mutation (Fig. 7A & B). In addition, lung tissues from WT-ICAM3 mice were more heavily infiltrated compared with the MCS control group. However, the ΔI or ΔE mutation groups reduced the infiltrated tumor nodules and areas (Fig. 7C & D). To further verify the above results, we overexpressed the truncate constructs in A549-shICAM3 (sh2) cells. Western blot was performed to detect FLAG-ICAM3 overexpression efficiency (Fig. 7E). 2 × 106 A549shICAM3-OEICAM3, A549-shICAM3-MutΔI and A549-shICAM3-MutΔE cells were injected into NOD/SCID mice subcutaneously and when tumors were palpable (15 days), the tumor volume was calculated. The living image was used to check tumor lung metastasis (Fig. 7G). At 40 days after injection, the mice were sacrificed and tumors were harvested and analyzed (Fig. 7F). The results showed that ICAM3-MutΔI and ICAM3-MutΔE could not only abolish ICAM3 mediated lung metastasis, but also reduced tumor growth. These results indicate that the extracellular and intracellular domains of ICAM3 are indispensable for ICAM3 mediated tumor metastasis in vivo. 3.8. Antibody or inhibitor inhibits tumor metastasis via targeting ICAM3LFA-1 interaction Since ICAM3-LFA-1 interaction mediated tumor metastasis in vitro and in vivo, we used the LFA-1 antibody or a small molecular inhibitor to arrest tumor metastasis. Previous reports have indicated that Lifitegrast prevents the binding of LFA-1 and ICAMs. So, we combined the LFA-1 antibody and Lifitegrast to arrest tumor cell metastasis. First, we checked the ICAM3 and LFA-1 interaction after LFA-1 antibody or Lifitegrast treatment in both cell lines. The IP results showed that ICAM3 and LFA-1 interaction was suppressed by LFA-1 antibody and Lifitegrast treatment (Fig. 8A & B). Second, trans-well assay results showed that LFA-1 antibody or Lifitegrast restrained cell migration in both cell lines and that the combination of LFA-1 antibody with Lifitegrast remarkably inhibited tumor cell migration (Fig. 8C & D). Collectively, these data suggest that the LFA-1 antibody and Lifitegrast arrest tumor metastasis via targeting ICAM3-LFA-1 interaction. 3.9. Proposed model of ICAM3 in mediating tumor metastasis ICAM3 works as a transmembrane protein with its extracellular domain binding to LFA-1 and its intracellular domain binding to the structure protein ERM and lamellipodia. As a result, LFA-1 and ERM cause a tension within cells that pulls cells apart (metastasis). Furthermore, LFA-1 antibody and Lifitegrast restrain tumor metastasis via targeting ICAM3-LFA-1 interaction (Fig. 8E). 4. Discussion The intercellular adhesion molecule (ICAM) family is a subfamily of immunoglobulin (Ig) superfamily. Five ICAM family members (ICAM1 to ICAM5) are known to date. ICAMs proteins are expressed in a number of epithelial and endothelial cells, leukocytes, fibroblasts, erythrocytes, platelets as well as neurons. ICAMs proteins play a role in 2574
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 6. ICAM3 promotes tumor cell metastasis selectively via interaction with LFA-1 in vitro. (A) Western was used to check the expression of LFA-1 in supernatant or total protein from various ICAM3 mutants transfected cells. (B) IP assay to detect the interaction of ICAM3 with LFA-1 or ERM. (C) Western to check the expression of ERM and ICAM3 in cells treated with different concentration LFA-1 recombinant protein. (D & E) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. Various ICAM3 mutants transfected cells were treated with 10 μg/ml LFA-1 recombinant protein. (F & G) Representative images of wound healing assay and statistic results on migrated cells were shown. ***P < 0.001. Various ICAM3 mutants transfected cells were co-cultured with THP-1 cells or supernatant.
2575
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 7. The extracellular and intracellular domains of ICAM3 were indispensable for ICAM3 mediated tumor metastasis in vivo. (A) Tumor growth curve of MCS control, ICAM3 and ICAM3 mutants were shown. (B) Tumors harvested from different groups were shown. (C) Representative images of H&E staining on tumors from different groups were shown. (D) Statistic results of metastatic nodules in the lungs from different groups were shown. **P < 0.01. (E) Western blot was performed to check the overexpression efficiency of different constructs in A549-shICAM3 cells. (F) Tumor growth curve of different groups (ICAM3, MutΔI and MutΔE) and several tumors separated from each group were shown. (G) Living image was used to check tumors and lung metastasis of different groups (ICAM3, MutΔI and MutΔE).
2576
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 8. Antibody or inhibitor inhibits tumor metastasis via targeting ICAM3-LFA-1 interaction. (A & B) IP assay was performed to check the interaction of ICAM3 labeled with FLAG and LFA-1 in cells treated with LFA-1 antibody (A) or Lifitegrast (B). (C & D) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. Cells were treated with LFA-1 antibody or Lifitegrast or both two. (E) Proposed model of ICAM3 in mediating tumor metastasis. 2577
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
strategy for the treatment of tumor metastasis.
[15] W. Shen, J. Xie, S. Zhao, R. Du, X. Luo, H. He, S. Jiang, N. Hao, C. Chen, C. Guo, Y. Liu, Y. Chen, P. Sun, S. Yang, N. Luo, R. Xiang, Y. Luo, ICAM3 mediates inflammatory signaling to promote cancer cell stemness, Cancer Lett. 422 (2018) 29–43. [16] S.H. P, Jong Kuk Park, Kwangsup So, In Hwa Bae, Young Do Yoo, Hong-Duck Um, ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB, Int. J. Oncol. (2009) 36. [17] X. Zhang, M.T. Ling, Q. Wang, C.K. Lau, S.C. Leung, T.K. Lee, A.L. Cheung, Y.C. Wong, X. Wang, Identification of a novel inhibitor of differentiation-1 (ID-1) binding partner, caveolin-1, and its role in epithelial-mesenchymal transition and resistance to apoptosis in prostate cancer cells, J. Biol. Chem. 282 (2007) 33284–33294. [18] W. Shen, A. Chang, J. Wang, W. Zhou, R. Gao, J. Li, Y. Xu, X. Luo, R. Xiang, N. Luo, D.G. Stupack, TIFA, an inflammatory signaling adaptor, is tumor suppressive for liver cancer, Oncogene 4 (2015) e173. [19] W. Shen, R. Du, J. Li, X. Luo, S. Zhao, A. Chang, W. Zhou, R. Gao, D. Luo, J. Wang, N. Hao, Y. Liu, Y. Chen, Y. Luo, P. Sun, S. Yang, N. Luo, R. Xiang, TIFA suppresses hepatocellular carcinoma progression via MALT1-dependent and -independent signaling pathways, Sig. Transduct. Target. Ther. 1 (2016) 16013. [20] J.M. Serrador, M. Vicente-Manzanares, J. Calvo, O. Barreiro, M.C. Montoya, R. Schwartz-Albiez, H. Furthmayr, F. Lozano, F. Sanchez-Madrid, A novel serinerich motif in the intercellular adhesion molecule 3 is critical for its ezrin/radixin/ moesin-directed subcellular targeting, J. Biol. Chem. 277 (2002) 10400–10409. [21] J.M. Serrador, J.L. Alonso-Lebrero, M.A. del Pozo, H. Furthmayr, R. SchwartzAlbiez, J. Calvo, F. Lozano, F. Sanchez-Madrid, Moesin interacts with the cytoplasmic region of intercellular adhesion molecule-3 and is redistributed to the uropod of T lymphocytes during cell polarization, J. Cell Biol. 138 (1997) 1409–1423. [22] Y.S. Gho, P.N. Kim, H.C. Li, M. Elkin, H.K. Kleinman, Stimulation of tumor growth by human soluble intercellular adhesion molecule-1, Cancer Res. 61 (2001) 4253–4257. [23] P. Guo, J. Huang, L. Wang, D. Jia, J. Yang, D.A. Dillon, D. Zurakowski, H. Mao, M.A. Moses, D.T. Auguste, ICAM-1 as a molecular target for triple negative breast cancer, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) 14710–14715. [24] P. Guo, J. Yang, D. Jia, M.A. Moses, D.T. Auguste, ICAM-1-targeted, Lcn2 siRNAencapsulating liposomes are potent anti-angiogenic agents for triple negative breast cancer, Theranostics 6 (2016) 1–13. [25] Y.C. Lin, C.T. Shun, M.S. Wu, C.C. Chen, A novel anticancer effect of thalidomide: inhibition of intercellular adhesion molecule-1-mediated cell invasion and metastasis through suppression of nuclear factor-kappaB, Clin. Cancer Res. 12 (2006) 7165–7173. [26] S.F. Yang, M.K. Chen, Y.S. Hsieh, T.T. Chung, Y.H. Hsieh, C.W. Lin, J.L. Su, M.H. Tsai, C.H. Tang, Prostaglandin E2/EP1 signaling pathway enhances intercellular adhesion molecule 1 (ICAM-1) expression and cell motility in oral cancer cells, J. Biol. Chem. 285 (2010) 29808–29816. [27] A.J. Bernier, J. Zhang, E. Lillehoj, A.R. Shaw, N. Gunasekara, J.C. Hugh, Non-cysteine linked MUC1 cytoplasmic dimers are required for Src recruitment and ICAM1 binding induced cell invasion, Mol. Cancer 10 (2011) 93. [28] L. Haddon, J. Hugh, MUC1-mediated motility in breast cancer: a review highlighting the role of the MUC1/ICAM-1/Src signaling triad, Clin. Exp. Metastasis 32 (2015) 393–403. [29] D.X. Nguyen, J. Massague, Genetic determinants of cancer metastasis, Nat. Rev. Genet. 8 (2007) 341–352. [30] A. Zlotnik, A.M. Burkhardt, B. Homey, Homeostatic chemokine receptors and organ-specific metastasis, Nat. Rev. Immunol. 11 (2011) 597–606. [31] E.D. Donnenfeld, P.M. Karpecki, P.A. Majmudar, K.K. Nichols, A. Raychaudhuri, M. Roy, C.P. Semba, Safety of Lifitegrast ophthalmic solution 5.0% in patients with dry eye disease: a 1-year, multicenter, randomized, placebo-controlled study, Cornea 35 (2016) 741–748. [32] C.P. Semba, D. Swearingen, V.L. Smith, M.S. Newman, C.A. O'Neill, J.P. Burnier, D.B. Haughey, T.R. Gadek, Safety and pharmacokinetics of a novel lymphocyte function-associated antigen-1 antagonist ophthalmic solution (SAR 1118) in healthy adults, J. Ocul. Pharmacol. Ther. 27 (2011) 99–104. [33] D.M. Paton, Lifitegrast: first LFA-1/ICAM-1 antagonist for treatment of dry eye disease, Drugs Today (Barc.) 52 (2016) 485–493. [34] S.C. Pflugfelder, M. Stern, S. Zhang, A. Shojaei, LFA-1/ICAM-1 interaction as a therapeutic target in dry eye disease, J. Ocul. Pharmacol. Ther. 33 (2017) 5–12. [35] A. Abidi, P. Shukla, A. Ahmad, Lifitegrast: a novel drug for treatment of dry eye disease, J. Pharmacol. Pharmacother. 7 (2016) 194–198.
Funding This work was supported by China Postdoctoral Science Foundation (No. 179316, S. Zhao) and Guizhou Science and Technology Cooperation Program (No. 7420, D. Luo). Competing interests The authors declare no potential conflicts of interest. Transparency document The http://dx.doi.org/10.1016/j.bbadis.2018.05.002 with this article can be found, in online version.
associated
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.bbadis.2018.05.002. References [1] G. Christofori, New signals from the invasive front, Nature 441 (2006) 444–450. [2] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144 (2011) 646–674. [3] I.J. Fidler, The pathogenesis of cancer metastasis: the ‘seed and soil’ hypothesis revisited, Nat. Rev. Cancer 3 (2003) 453–458. [4] X. Li, Y. Xu, Y. Chen, S. Chen, X. Jia, T. Sun, Y. Liu, X. Li, R. Xiang, N. Li, SOX2 promotes tumor metastasis by stimulating epithelial-to-mesenchymal transition via regulation of WNT/beta-catenin signal network, Cancer Lett. 336 (2013) 379–389. [5] X. Xiao, D.D. Mruk, C.Y. Cheng, Intercellular adhesion molecules (ICAMs) and spermatogenesis, Hum. Reprod. Update 19 (2013) 167–186. [6] K.A.K.M. Skubitz, K.D. Campbell, A.P. Skubitz, CD50 (ICAM-3) is phosphorylated on tyrosine and is associated with tyrosine kinase activity in human neutrophils, J. Immunol. 154 (1995) 2888–2895. [7] L.B.K. Antonin, R. de Fougerolles, Timothy A. Springer, Cloning and expression of intercellular adhesion molecule 3 reveals strong homology to other immunoglobulin family counter-receptors for lymphocyte function-associated antigen 1, J. Exp. Med. 177 (1993) 1187–1192. [8] C.L.A. John Greenwood, Claire E. Walters, Pierre-Olivier Couraud, Ruth Lyck, Intracellular domain of brain endothelial ICAM-1 is essential for T-lymphocytemediated signalling and migration1, J. Immunol. 171 (2003) 2099–2108. [9] A. Estecha, N. Aguilera-Montilla, P. Sanchez-Mateos, A. Puig-Kroger, RUNX3 regulates intercellular adhesion molecule 3 (ICAM-3) expression during macrophage differentiation and monocyte extravasation, PLoS One 7 (2012) e33313. [10] P.P. Zhu, S.G. Yuan, Y. Liao, L.L. Qin, W.J. Liao, High level of intercellular adhesion molecule-1 affects prognosis of patients with hepatocellular carcinoma, World J. Gastroenterol. 21 (2015) 7254–7263. [11] S.T. Tsai, P.J. Wang, N.J. Liou, P.S. Lin, C.H. Chen, W.C. Chang, ICAM1 is a potential cancer stem cell marker of esophageal squamous cell carcinoma, PLoS One 10 (2015) e0142834. [12] H.S. Yu, T.H. Lin, C.H. Tang, Involvement of intercellular adhesion molecule-1 upregulation in bradykinin promotes cell motility in human prostate cancers, Int. J. Mol. Sci. 14 (2013) 13329–13345. [13] Peng Guoa, Jing Huangd, Liya Wang, Jiang Yang Di Jia, Deborah A. Dillon, David Zurakowski, Hui Mao, Marsha A. Moses, Debra T. August, ICAM-1 as a molecular target for triple negative breast cancer, PNAS 111 (2014) 14710–14715. [14] M.C. Montoya, D. Sancho, G. Bonello, Y. Collette, C. Langlet, H.T. He, P. Aparicio, A. Alcover, D. Olive, F. Sanchez-Madrid, Role of ICAM-3 in the initial interaction of T lymphocytes and APCs, Nat. Immunol. 3 (2002) 159–168.
2578
Contents lists available at ScienceDirect
BBA - Molecular Basis of Disease journal homepage: www.elsevier.com/locate/bbadis
ICAM3 mediates tumor metastasis via a LFA-1-ICAM3-ERM dependent manner
T
Wenzhi Shena, Xiaoyuan Zhanga, Renle Dub, Yan Fanb, Dehong Luod, Yonghua Baoa, ⁎ ⁎ ⁎ Wancai Yanga, Na Luob, , Yunping Luoc, , Shuangtao Zhaoe, a
Department of Pathology, Institute of Precision Medicine, Jining Medical University, Jining 272067, China Dept. of Immunology, School of Medicine, Nankai University, Tianjin 300071, China c Dept. of Immunology, Institute of Basic Medical Science, Chinese Academy of Medical Science, School of Basic Medicine, Peking Union Medical College, Beijing 100005, China d The First People's Hospital of Zunyi, Zunyi 563002, China e Dept. of Radiation Oncology, National Cancer Center/Cancer Hospital, Chinese Academy of Science and Peking Union Medical College, Beijing 100021, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: ICAM3 Tumor metastasis ERM LFA-1 Lifitegrast
ICAM3 was reported to promote metastasis in tumors. However, the underlying mechanism remains elusive. Here, we disclosed that the expression of ICAM3 was closely correlated with the TNM stage of human breast and lung cancer, as well as the dominant overexpression in high aggressive tumor cell lines (231 and A549 cells). Moreover, the knockdown of ICAM3 inhibited tumor metastasis whereas the ectopic expression of ICAM3 promoted tumor metastasis both in vitro and in vivo. In addition, exploration of the underlying mechanism demonstrated that ICAM3 not only binds to LFA-1 with its extracellular domain and structure protein ERM but also to lamellipodia with its intracellular domain which causes a tension that pulls cells apart (metastasis). Furthermore, ICAM3 extracellular or intracellular mutants alternatively abolished ICAM3 mediated tumor metastasis in vitro and in vivo. As a therapy strategy, LFA-1 antibody or Lifitegrast restrained tumor metastasis via targeting ICAM3-LFA-1 interaction. In summary, the aforementioned findings suggest a model of ICAM3 in mediating tumor metastasis. This may provide a promising target or strategy for the prevention of tumor metastasis.
1. Introduction Tumor metastasis is the key factor that compromises the prognosis of tumor patients and accounts for 90% of tumor death [1,2]. Metastasis is a multistep process by which a percentage of primary tumor cells acquire the ability to spread from their initial site to the surrounding normal tissues in the local areas or to secondary tissues/organs [3,4]. It is comprised of multiple steps, which include penetrating the walls of lymphatic and/or blood vessels, infiltration into the circulation system, re-penetration through the vessels, docking and proliferation in the distant organs to form a metastatic tumor. Failure at any one of these steps can block the entire metastatic process. Since tumor metastasis is responsible for the majority of deaths for cancer patients, a better understanding of the molecular mechanism involved in the tumor spreading process is important for specific targeting of the tumor metastasis. The intercellular adhesion molecule (ICAM) family is a subfamily of
the immunoglobulin (Ig) superfamily with five known ICAM family members (ICAM1-ICAM5) which play a role in inflammation, immune responses, and intracellular signaling [5]. All ICAMs are type I transmembrane glycoproteins that contain an N-terminus extracellular domain, a single transmembrane domain, and a C-terminus cytoplasmic domain. ICAMs possess 2–9 Ig-like C2-type domains in extracellular region and bind to the leukocyte adhesion protein LFA-1 [6–9]. The extracellular domain of ICAMs show a striking homology, but the transmembrane domain and cytoplasmic domain show little conservation. Important differences may exist among various ICAMs in regards to cell surface localization, cytoskeletal interactions, and signaling. Previous reports indicate that ICAM-1 is involved in breast cancer cell metastasis via interacting with MUC1 and Src [10–13]. Although elevated levels of other ICAM family members occur in certain carcinomas, the role of ICAMs in the tumor metastasis and clinical outcomes remains unclear. ICAM3 is a member of the ICAMs subfamily. Numerous reports
Abbreviations: ICAM3, intercellular adhesion molecule 3; LFA-1, lymphocyte function associated antigen-1; ERM, ezrin/radixin/moesin ⁎ Corresponding authors. E-mail addresses: [email protected] (N. Luo), [email protected] (Y. Luo), [email protected] (S. Zhao). https://doi.org/10.1016/j.bbadis.2018.05.002 Received 15 September 2017; Received in revised form 20 March 2018; Accepted 1 May 2018 Available online 03 May 2018 0925-4439/ © 2018 Elsevier B.V. All rights reserved.
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
2.4. Western blotting
suggest that ICAM3 is involved in immune cell interactions and T lymphocyte activation [9,14]. Our previous work proved that ICAM3 mediates the PI3K-AKT signaling to promote the inflammation and cancer cell stemness [15]. Recently, several studies have suggested that ICAM3 exerts stimulatory activity in cancer cell migration and invasion via PI3K-AKT signaling pathway [16,17]. However, the details remain elusive. In addition, the proof and model of ICAM3 mediated tumor cell metastasis are not persuasive. Here, we investigated the role of ICAM3 in tumor metastasis and found that the expression of ICAM3 was closely correlated with TNM as well as dominant overexpression in high aggressive tumor cell lines (231 and A549 cells). Moreover, knockdown of ICAM3 inhibited tumor metastasis, ectopic expression of ICAM3 promoted tumor metastasis both in vitro and in vivo. Exploration of the underlying mechanism demonstrated that ICAM3 binds to LFA-1 (extracellular domain) and structure protein ERM or lamellipodia (intracellular domain) to both give cells a tension further to pulled cells to move (metastasis). In addition, LFA-1 antibody and Lifitegrast could restrain tumor metastasis via targeting ICAM3-LFA-1 interaction. Our research revealed that targeting of ICAM3 was a promising strategy for prevention of tumor metastasis.
Cell lysates from different cell lines were prepared with RIPA buffer in the presence of protease inhibitor cocktails and Phosphatase Inhibitor Cocktail 2 and 3 (P8340, P5726 and P0044, Sigma-Aldrich, St Louis, MO, USA) [19]. Protein (20–50 μg) was loaded onto 8–15% Trisacrylamide gels and blotted with antibodies that included: ICAM3 (cat. #ab109405 Abcam Biotechnology, Inc., Abcam, Hong Kong), β-actin (cat. #sc-47778, Santa Cruz Biotechnology, Inc. Santa Cruz, CA), FLAG (cat. #14793), ERM (cat. #3142), E-cadherin (cat. #3195), LFA-1 (cat. #73663), vimentin (cat. #5741, Cell Signal Technology Inc., Danvers, MA). 2.5. Migration, invasion, and wound healing assays For migration assays, 1 × 105 MDA-MB-231 or A549 cells were resuspended in serum-free medium and seeded into Boyden chamber inserts with a 5-μm pore membrane (BD Bioscience, Franklin Lakes, NJ). Medium containing 10% FBS was added to the lower chamber. For invasion assays, the upper chamber of the insert was coated with Matrigel (BD Biosciences), and 1 × 106 MDA-MB-231 or A549 cells were added to the inserts. For wound healing assays, 1 × 106 MDA-MB231 or A549 cells were seeded and grown to 90% confluence. A sterile pipette tip was then used to create scratch wounds. Images were then taken at 0 and 12 h with an IX71 inverted microscope (Olympus, Tokyo, Japan). Three independent experiments were performed.
2. Materials and methods 2.1. Vector construction ShRNA targeting human ICAM3 and scrambled control sequence were summarized in Table 1. The palindromic DNA oligos were annealed to each other to form a double-strand oligo and ligated to the linearized pLV-H1-EF1α-puro (cat. #SORT-B19, Biosettia Inc.) vector to generate circled pLV-H1-shRNA-Puro.
2.6. Immunoprecipitation Cell protein lysates were incubated with protein A/G agarose beads (Life technology) and antibody (Abcam plc, Cambridge, UK) overnight at 4 °C. Then centrifuge at 2500 rpm for 30s and wash the pellets carefully pre-chilled PBS buffer. Finally, binding proteins were boiled to proceed SDS-PAGE. Immunoprecipitates were analyzed with the specific antibody by Western blot.
2.2. Cell culture A549 cells were cultured in RPMI-1640 with 10% FBS, 100 U/ml penicillin/streptomycin. MDA-MB-231, MDA-MB-231-luc cells were cultured in L15 medium supplemented with 10% FBS, 100 U/ml penicillin/streptomycin. A549 and 231 cells were infected with lentivirus carrying pLV-H1-shICAM3-puro or pLV-EF1α-ICAM3 (mut)-puro plasmids, followed by selection using 2 μg/ml puromycin to generate polyclonal cell populations.
2.7. Immunofluorescence and cytoskeleton staining Cells were fixed with 4% formaldehyde for 15 min and then blocked with 1% bovine serum albumin for 1 h. Then immunolabeled with primary antibodies overnight at 4 °C, followed by incubation with species-appropriate secondary antibodies at room temperature for 1 h. Nuclei were stained with DAPI, and Images were obtained using confocal microscope with 160× objective (Olympus). For cytoskeleton staining, after rinsing, the cells were incubated with 5 μg/ml FITCphalloidin (P2141, Sigma, St. Louis, MO) at room temperature for 1 h. The lamellipodia of each cell was counted to represent the cell morphology after gene expression changes. Images were obtained with confocal microscope 80× objective (Olympus).
2.3. Immunohistochemistry Immunostaining was performed on paraffin-embedded human lung cancer, stomach cancer, colon cancer, prostate cancer and breast cancer tissue microarray (80 samples from cat. # MC8010, 240 samples from cat. # Top4-240a, Alenabio Company, Shanxi, China). Expression levels of ICAM3 in the tissue microarray were scored according to the percentage of positive cells in each cancer tissues. The images were recorded by Olympus BX51 Epi-fluorescent microscopy under a 10× or 40× objective (Olympus Co., Tokyo, Japan) [18].
2.8. Tumor xenografts Female NOD/SCID mice at 6–8 weeks of age were separated randomly into five groups (n = 7) for each group based on minimal 30%
Table 1 Primer sequences. Name
Sequence
ICAM3-sh1 ICAM3-sh2 SC Flag-ICAM3-F Flag-ICAM3-R
AAAAGCAGTACTGATTGTCCCAGCTTTGGATCCAAAGCTGGGACAATCAGTACTGC AAAAGCAATGGCTCTCAGATAACAGTTGGATCCAACTGTTATCTGAGAGCCATTGC AAAAGCTACACTATCGAGCAATTTTGGATCCAAAATTGCTCGATAGTGTAGC GCTCTAGAGCCACCATGGATTACAAGGATGACGACGATAAGAGCCCGATGGCCACCATGGTACC CGACGCGTTCACTCAGCTCTGGACGG
2567
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
decrease from 1 g tumors with 250 μg s.d. (standard deviation), α error of 0.05 and a β error of 0.8. In all, 3 × 106 A549 cells (A549-sc, A549shICAM3, A549-MCS, A549-ICAM3, A549-ICAM3ΔI, A549-ICAM3ΔE) were inoculated s.c. into each mouse at right axilla. Tumor volume (mm3) was measured with calipers two times per week and calculated by using the standard formula: length × width2 / 2. The individual measuring the mice was unaware of the identity of the group measured. Two months after implantation, primary tumors were harvested and analyzed by in vivo molecular imaging technology. Lungs were fixed in formalin, and embedded in paraffin, and sections were analyzed by H& E staining.
(Fig. 3C). Trans-well assay results showed that exogenous overexpression of ICAM3 promoted the cell migration capacity of both cell lines (Fig. 3D & E). The same results were obtained in invasion and wound-healing assays (Fig. 3F–H) where ectopic expression of ICAM3 promoted the migration and invasion capacity of both cell lines. Collectively, these results further support the contention of an important role for ICAM3 in tumor metastasis. 3.4. ICAM3 promotes tumor metastasis in vivo Since ICAM3 contributes to the metastatic properties of tumor cells in vitro, we next tested the results in an animal model. To this end, stable A549-sc, A549-shICAM3, A549-MCS and A549-ICAM3 cells were injected into the forth fat pad of NOD/SCID mice. As shown in Fig. 4A, the tumor growth and tumor volume in the A549-shICAM3 group showed a marked reduction versus the A549-sc control, consistently, the tumor growth and tumor volume in the A549-ICAM3 group showed a marked increase versus the A549-MCS control (Fig. 4E). Moreover, the living image results displayed a decreased primary tumor volume and lung metastasis in A549-shICAM3 group (Fig. 4B), an increased primary tumor volume and lung metastasis in A549-ICAM3 group (Fig. 4F). In addition, lung tissues from mice transplanted with A549-shICAM3 were less infiltrated than those of mice transplanted with A549-sc (Fig. 4C & G), indicating that deficient of ICAM3 inhibits tumor metastasis in vivo. At the same time, mice transplanted with A549-ICAM3 showed significantly more metastatic lung nodules and larger metastatic areas than those of mice transplanted with A549-MCS (Fig. 4D & H). Thus, our results indicated that ICAM3 promotes tumor metastasis in vivo.
2.9. Statistical analysis Values were expressed as means ± s.e.m. Significance was determined by χ2 test, others were determined by Student's t-test. A value of P < 0.05 was used as the criterion for statistical significance. * indicates significant difference with P < 0.05, ** indicates significant difference with P < 0.01, *** indicates significant difference with P < 0.001. 3. Results 3.1. Expression of ICAM3 correlates with TNM stage of human breast and lung cancers To determine whether ICAM3 plays a role in cancer metastasis, we performed immunohistochemical analyses with an ICAM3-specific antibody in tissue microarrays containing 160 samples (10 normal breast, 10 normal lung, 70 breast cancer and 70 lung cancer tissues) of human with different clinical degrees. As shown (Fig. 1A), a relatively high expression of ICAM3 was detectable in breast or lung tumor tissues, whereas, ICAM3 expression was weakly detected in normal breast or lung tissues. Moreover, ICAM3 demonstrated a higher expression in late-stage tumor. ICAM3 up-regulation was notable even in early-stage tumors (Fig. 1B).
3.5. ICAM3 mediates tumor cell metastasis via binding ezrin/radixin/ moesin (ERM) To determine the mechanism underlying the role of ICAM3, we subsequently tested the regulatory effect of ICAM3 on EMT markers. Interestingly, Western blotting showed that there was nearly no change of the expression levels of E-cadherin and vimentin with ICAM3 suppression (Fig. 5A). However, it has been reported that ICAM3 could interact with ezrin/radixin/moesin (ERM) proteins through its intercellular domain [20,21]. We next checked the expression level of ERM with ICAM3 deficiency. In accordance with our expectation, the expression level of ERM was decreased in both cell lines (Fig. 5A). To provide a visualized view of the interaction of ICAM3 and ERM, double fluorescent staining was performed in MDA-MB-231 and A549 cells. The results showed that ICAM3 and ERM had an obvious co-localization in both cell lines (Fig. 5B). To better understand the interaction of ICAM3 and ERM, we reconstituted either wild-type (WT) ICAM3, an intracellular domain defective (Mut ΔI), or an extracellular domain defective (Mut ΔE) (Fig. 5B) into two cell lines. Checking more carefully, we noted that the expression of ERM increased following expression of WT-ICAM3. However, expression of Mut ΔI and Mut ΔE, ERM level did not changed (Fig. 5C). To provide a visualized view of the interaction of ICAM3 and ERM, double fluorescent staining was enforced in A549 cells. The results showed that in WT ICAM3 overexpression cells, ERM could translocate to cell membrane and have co-expression with ICAM3. However, in the MutΔI or MutΔE overexpression groups, the abilities of ERM translocation and co-expression were reduced (Fig. 5D). In addition, an immunoprecipitation (IP) assay was performed to test the interaction between different ICAM3 forms and ERM. As shown in Fig. 5E, FLAG-WT ICAM3 antibody pulled down ERM, whereas FLAGMut ΔI antibody did not pull down ERM. Interestedly, FLAG-Mut ΔE antibody did not pull down ERM either. Furthermore, immunofluorescent staining showed that overexpression of WT-ICAM3 increased the formation of lamellipodia and this effect was partially reversed by both Mut ΔI and Mut ΔE (Fig. 5F). To explore whether the interaction of ICAM3 and ERM effects tumor
3.2. Suppression of ICAM3 inhibits tumor metastasis in vitro We next investigated whether the observations in the clinical samples were represented in tumor cell lines. The mRNA level of ICAM3 increased in breast and lung cancer cell lines relative to the normal cell line (Fig. 2A & C). Immunoblot analysis of ICAM3 protein levels supported the quantitative PCR results, suggesting that ICAM3 was in fact increased in the cancer cell lines (Fig. 2B & D). Therefore, the cell lines appeared suitable to use as a model to determine the impact of ICAM3 on tumor metastasis. To investigate the functional role of ICAM3 in tumor metastasis, we knock downed ICAM3 expression in human breast cancer cell line MDAMB-231 and human lung cancer cell line A549 (Fig. 2E) both of which have high metastatic and malignant properties. Trans-well assay was initially performed to detect the function of ICAM3 in the metastasis of both cell lines. As shown in Fig. 2F, knockdown ICAM3 expression suppressed the migration capacity of both cell lines (Fig. 2F & G). The same results were obtained in invasion and wound-healing assays (Fig. 2H–J), ICAM3 deficiency inhibited the migration and invasion capacity of both cell lines. Together, our results showed an indicative role of ICAM3 in regulating tumor metastasis. 3.3. ICAM3 overexpression promotes tumor metastasis in vitro To further evaluate the effect of ICAM3 on tumor metastasis, we also overexpressed ICAM3 in MDA-MB-231 and A549 wild type cells. We found that ICAM3 had a high overexpression efficiency as indicated by immunoblot and flow cytometry (Fig. 3A & B). Immunofluorescence results showed that ICAM3 clearly localized on the cell membrane 2568
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 1. Correlation of ICAM3 expression with tumor TNM stage of human breast & lung cancer. (A) Immunohistochemical staining of ICAM3 in paraffin-embedded human tumor tissue microarray with different TNM stage. (B) The relationship of ICAM3 expression with tissue status and TNM stage. Each point represents one sample and the middle line represents the mean value. Data are shown as the mean ± s.e.m. The number of samples and the mean values of each group are listed below the x axis (P-value was determined by Student's t-test).
3.6. ICAM3 promotes tumor cell metastasis selectively via interaction with LFA-1 in vitro
cell metastasis, a trans-well assay was performed to investigate the number of migrated cells. The results showed that WT-ICAM3 promoted tumor cell migration whereas both Mut ΔI and Mut ΔE partially reversed this effect in both cell lines (Fig. 5G & H). Moreover, these results were confirmed by a wound healing assay (Fig. 5I). Taken together, these results suggest that ICAM3 interacted with ERM to alter lamellipodia formation which plays a role in tumor cell metastasis. More importantly, both the extracellular domain and intracellular domain of ICAM3 were dispensable for this process.
Since we established that Mut ΔE was essential for ICAM3-ERM interaction and tumor cell metastasis, we next explored the underlying mechanism involved in this process. Since LFA-1 is the sole receptor for ICAM3, we first detected the expression level of LFA-1 in both the cell supernatant and total proteins. Western blotting results showed that LFA-1 was expressed in both the cell supernatant and total proteins, but no significant difference was observed in different ICAM3 forms reconstituted groups (Fig. 6A). To identify whether ICAM3 interacted
2569
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 2. Suppression of ICAM3 inhibits tumor metastasis in vitro. (A) QPCR was performed to detect the ICAM3 mRNA expression in normal breast cell line MCF-10A and breast cancer cell line T47D, 231 cell lines. (B) Western was used to check ICAM3 protein expression in MCF-10A, T47D and 231 cell lines. (C) QPCR to detect the ICAM3 mRNA expression in normal lung cell line MRC5 and lung cancer cell line H460, A549 cell lines. (D) Western was used to check ICAM3 protein expression in MRC5, H460 and A549 cell lines. (E) Western to check the knockdown efficiency of ICAM3 (sh1 and sh2) in 231 and A549 cell lines. (F & G) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. (H) Statistic results of invasion assay on invaded cells were shown. ***P < 0.001. (I & J) Representative images of wound healing assay and statistic results on migrated cells were shown. ***P < 0.001.
that exogenous LFA-1 accelerated cell migration in both cell lines (Fig. 6D & E). Since macrophages abundantly express LFA-1 similar to other tumor associated immunocytes (e.g., monocytes), we supposed that LFA-1 signaling also involved macrophages. To clarify our supposition, we co-cultured THP-1 cells with tumor cells that expressed different ICAM3 forms. Wound healing assay results demonstrated that THP-1 cells accelerated the WT-ICAM3 overexpression tumor cell
with LFA-1, we performed an IP assay. As shown in Fig. 6B, LFA-1 could be detected in both cell lines when using FLAG-ICAM3 antibody to pull down. To further investigate the function role of LFA-1 in ICAM3 mediated tumor cell metastasis, we added the human recombinant LFA1 protein into cells. Western blotting results showed that expression of ERM increased whereas ICAM3 had no significant change following LFA-1 stimulation (Fig. 6C). In addition, trans-well assay results showed 2570
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 3. Overexpression of ICAM3 promotes tumor metastasis in vitro. (A) Western to check ICAM3 overexpression efficiency in 231 and A549 cell lines. (B) Flow cytometry assay was performed to detect ICAM3 overexpression efficiency in 231 and A549 cell lines. (C) Immunofluorescence assay was used to detect ICAM3 overexpression efficiency and location in 231 and A549 cell lines. (D & E) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. (F) Statistic results of invasion assay on invaded cells were shown. ***P < 0.001. (G & H) Representative images of wound healing assay and statistic results on migrated cells were shown. ***P < 0.001.
2571
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 4. ICAM3 promotes tumor metastasis in vivo. (A) Tumor growth curve of different groups (sc and shICAM3) and several tumors separated from each group were shown. (B) Living image was used to check tumors and lung metastasis of different groups (sc and shICAM3). (C) Representative images of H&E staining on tumors from A549-shICAM3 and A549-sc groups were shown. (D) Statistic results of metastatic nodules and areas in the lungs from A549-shICAM3 and A549-sc groups were shown. **P < 0.01. (E) Tumor growth curve of different groups (MCS and ICAM3) and several tumors separated from each group were shown. (F) Living image was used to check tumors and lung metastasis of different groups (MCS and ICAM3). (G) Representative images of H& E staining on tumors from A549-ICAM3 and A549MCS groups were shown. (H) Statistic results of metastatic nodules and areas in the lungs from A549ICAM3 and A549-MCS groups were shown. **P < 0.01.
2572
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 5. ICAM3 mediates tumor cell metastasis via binding ezrin/radixin/moesin (ERM). (A) Western was used to check the expression of EMT markers and ERM in 231 and A549 ICAM3 knockdown or sc cells. (B) Overview of different ICAM3 mutants structure. (C) Western was used to check the expression of ERM in different ICAM3 mutants reconstituted cells. (D) Immunofluorescence assay was used to detect ICAM3 and ERM co-location in A549 expressed different constructs cells. (E) IP assay was performed to detect the interaction of different ICAM3 mutants labeled with FLAG tag and ERM. (F) To detect F-actin rearrangement in various ICAM3 mutants transfected 231 and A549 cells, the cytoskeleton was stained with FITC-phalloidin. (G & H) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. (I) Statistic results of wound healing assay on migrated cells were shown. ***P < 0.001. 2573
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
migration, whereas this effect was abolished by ICAM3 ΔI or ΔE mutation (Fig. 6F & G). These results together imply that LFA-1 selectively interacts with ICAM3 to further promote tumor cell metastasis in vitro.
inflammation, immune responses and in intracellular signaling events. Recently, a number of studies have reported that ICAM-1 is present in several cancer types (e.g., prostate, breast, oral cancers) and is at least partly involved in their progression and metastasis [22–26]. As a vital member of ICAMs, ICAM3 shares its function with ICAM1 in cancer progression. In this regard, ICAM1 and ICAM3 possess the same extracellular domain and have the same receptor (i.e., LFA-1). However, ICAM1 and ICAM3 possess different intracellular domains in order to mediate disparate functions. Our study shows that ICAM3 binds LFA-1 and ERM at the same time in order to give the tumor cells a tension that mediates cell movement. This contrasts with ICAM1 function that induces cell metastasis via binding MUC1 and Src [27,28]. These findings provide a new insight into the way that ICAMs mediate cell movement. Metastasis is a multistep process whereby the acceleration of any particular step may finally lead to the promotion of the entire metastatic process. Malignant cells break away from the primary tumor and attach to and degrade proteins within the surrounding extracellular matrix (ECM) which separates the tumor from adjoining tissues. By degrading these proteins, cancer cells breach the ECM and escape [29,30]. ICAMs work as the adhesion molecules and therefore may play a vital role in this metastatic process In our study, we found that ICAM3 has no effect on ECM protein degradation since the expression of Ecadherin and vimentin was not changed with ICAM3 overexpression. However, ICAM3 is involved in the cancer cell “escape” process. Our results showed that with the assistance of LFA-1 expressed in tumor associated monocytes and the structure protein ERM expressed in tumor cells, ICAM3 linked these two proteins and worked as a “leg” to promote cancer cell movement or escape. That is to say, cancer cell movement or escape is accentuated when cancer cells express high levels of ICAM3. These findings provide a new insight into the role of ICAMs and the promotion of metastasis. All ICAM proteins are type I transmembrane glycoproteins, containing an N-terminus extracellular domain, a single transmembrane domain, and a C-terminus cytoplasmic domain. ICAM3 is a member of the ICAMs subfamily and not only functions as an adhesion molecule, but also as a potent signaling molecule. In this study, we constructed different ICAM3 mutants that is, the extracellular domain deficient mutant ΔE and intracellular domain deficient mutant ΔI. Our in vivo results showed that ΔI or ΔE not only abolishes ICAM3 mediated lung metastasis, but also reduces tumor growth. That is to say, ICAM3 works as a signaling molecule and may play a role in promoting tumor growth or tumor stemness. The extracellular domain and intracellular domain were both indispensable for ICAM3 mediated signaling transduction. These findings provide novel information for the role of ICM3 in the metastatic process. Lifitegrast (trade name Xiidra) is an FDA approved drug indicated for the treatment of signs and symptoms of dry eye [31]. Lifitegrast inhibits an integrin, lymphocyte function-associated antigen 1 (LFA-1) [32], from binding to ICAM-1 which down-regulates inflammation mediated by T lymphocytes [33–35]. ICAM1 and ICAM3 possess nearly the same extracellular domain and the same binding to LFA-1. We therefore used Lifitegrast to inhibit ICAM3 and LFA-1 interaction and ultimately to inhibit tumor metastasis caused by ICAM3. Our results show that Lifitegrast inhibits ICAM3 and LFA-1 interaction and also suppresses tumor cell metastasis. These effects are especially enhanced with the combined treatment using Lifitegrast and LFA-1 antibody which significantly inhibits tumor metastasis. These findings provide potential new targets for tumor metastasis treatment. In conclusion, our results demonstrate that ICAM3 correlates with the tumor TNM stage and promotes tumor metastasis in vitro and in vivo. The underlying mechanism involves ICAM3 interaction not only with LFA-1 through its extracellular domain but also ERM through its intracellular domain simultaneously which in turn causes a tension within cells that pulls cells apart (metastasis). Furthermore, Lifitegrast and LFA-1 antibody restrain tumor metastasis via targeting ICAM3-LFA1 interaction. Therefore, our findings may provide a novel potential
3.7. The extracellular and intracellular domain of ICAM3 were indispensable for ICAM3 mediated tumor metastasis in vivo To evaluate the impact of different ICAM3 expression forms on tumor dissemination in vivo, we next tested the effect of different ICAM3 expression forms in a xenograft animal model. To this end, stable A549-MCS, A549-WTICAM3, A549-MutΔI and A549-MutΔE cells were injected into the forth fat pad of NOD/SCID mice. The results indicated that the tumor growth and tumor volume increased in the WtICAM3 group compared with the MCS control group and that this effect was abolished by the ICAM3 ΔI or ΔE mutation (Fig. 7A & B). In addition, lung tissues from WT-ICAM3 mice were more heavily infiltrated compared with the MCS control group. However, the ΔI or ΔE mutation groups reduced the infiltrated tumor nodules and areas (Fig. 7C & D). To further verify the above results, we overexpressed the truncate constructs in A549-shICAM3 (sh2) cells. Western blot was performed to detect FLAG-ICAM3 overexpression efficiency (Fig. 7E). 2 × 106 A549shICAM3-OEICAM3, A549-shICAM3-MutΔI and A549-shICAM3-MutΔE cells were injected into NOD/SCID mice subcutaneously and when tumors were palpable (15 days), the tumor volume was calculated. The living image was used to check tumor lung metastasis (Fig. 7G). At 40 days after injection, the mice were sacrificed and tumors were harvested and analyzed (Fig. 7F). The results showed that ICAM3-MutΔI and ICAM3-MutΔE could not only abolish ICAM3 mediated lung metastasis, but also reduced tumor growth. These results indicate that the extracellular and intracellular domains of ICAM3 are indispensable for ICAM3 mediated tumor metastasis in vivo. 3.8. Antibody or inhibitor inhibits tumor metastasis via targeting ICAM3LFA-1 interaction Since ICAM3-LFA-1 interaction mediated tumor metastasis in vitro and in vivo, we used the LFA-1 antibody or a small molecular inhibitor to arrest tumor metastasis. Previous reports have indicated that Lifitegrast prevents the binding of LFA-1 and ICAMs. So, we combined the LFA-1 antibody and Lifitegrast to arrest tumor cell metastasis. First, we checked the ICAM3 and LFA-1 interaction after LFA-1 antibody or Lifitegrast treatment in both cell lines. The IP results showed that ICAM3 and LFA-1 interaction was suppressed by LFA-1 antibody and Lifitegrast treatment (Fig. 8A & B). Second, trans-well assay results showed that LFA-1 antibody or Lifitegrast restrained cell migration in both cell lines and that the combination of LFA-1 antibody with Lifitegrast remarkably inhibited tumor cell migration (Fig. 8C & D). Collectively, these data suggest that the LFA-1 antibody and Lifitegrast arrest tumor metastasis via targeting ICAM3-LFA-1 interaction. 3.9. Proposed model of ICAM3 in mediating tumor metastasis ICAM3 works as a transmembrane protein with its extracellular domain binding to LFA-1 and its intracellular domain binding to the structure protein ERM and lamellipodia. As a result, LFA-1 and ERM cause a tension within cells that pulls cells apart (metastasis). Furthermore, LFA-1 antibody and Lifitegrast restrain tumor metastasis via targeting ICAM3-LFA-1 interaction (Fig. 8E). 4. Discussion The intercellular adhesion molecule (ICAM) family is a subfamily of immunoglobulin (Ig) superfamily. Five ICAM family members (ICAM1 to ICAM5) are known to date. ICAMs proteins are expressed in a number of epithelial and endothelial cells, leukocytes, fibroblasts, erythrocytes, platelets as well as neurons. ICAMs proteins play a role in 2574
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 6. ICAM3 promotes tumor cell metastasis selectively via interaction with LFA-1 in vitro. (A) Western was used to check the expression of LFA-1 in supernatant or total protein from various ICAM3 mutants transfected cells. (B) IP assay to detect the interaction of ICAM3 with LFA-1 or ERM. (C) Western to check the expression of ERM and ICAM3 in cells treated with different concentration LFA-1 recombinant protein. (D & E) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. Various ICAM3 mutants transfected cells were treated with 10 μg/ml LFA-1 recombinant protein. (F & G) Representative images of wound healing assay and statistic results on migrated cells were shown. ***P < 0.001. Various ICAM3 mutants transfected cells were co-cultured with THP-1 cells or supernatant.
2575
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 7. The extracellular and intracellular domains of ICAM3 were indispensable for ICAM3 mediated tumor metastasis in vivo. (A) Tumor growth curve of MCS control, ICAM3 and ICAM3 mutants were shown. (B) Tumors harvested from different groups were shown. (C) Representative images of H&E staining on tumors from different groups were shown. (D) Statistic results of metastatic nodules in the lungs from different groups were shown. **P < 0.01. (E) Western blot was performed to check the overexpression efficiency of different constructs in A549-shICAM3 cells. (F) Tumor growth curve of different groups (ICAM3, MutΔI and MutΔE) and several tumors separated from each group were shown. (G) Living image was used to check tumors and lung metastasis of different groups (ICAM3, MutΔI and MutΔE).
2576
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
Fig. 8. Antibody or inhibitor inhibits tumor metastasis via targeting ICAM3-LFA-1 interaction. (A & B) IP assay was performed to check the interaction of ICAM3 labeled with FLAG and LFA-1 in cells treated with LFA-1 antibody (A) or Lifitegrast (B). (C & D) Representative images of trans-well assay and statistic results on migrated cells were shown. ***P < 0.001. Cells were treated with LFA-1 antibody or Lifitegrast or both two. (E) Proposed model of ICAM3 in mediating tumor metastasis. 2577
BBA - Molecular Basis of Disease 1864 (2018) 2566–2578
W. Shen et al.
strategy for the treatment of tumor metastasis.
[15] W. Shen, J. Xie, S. Zhao, R. Du, X. Luo, H. He, S. Jiang, N. Hao, C. Chen, C. Guo, Y. Liu, Y. Chen, P. Sun, S. Yang, N. Luo, R. Xiang, Y. Luo, ICAM3 mediates inflammatory signaling to promote cancer cell stemness, Cancer Lett. 422 (2018) 29–43. [16] S.H. P, Jong Kuk Park, Kwangsup So, In Hwa Bae, Young Do Yoo, Hong-Duck Um, ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB, Int. J. Oncol. (2009) 36. [17] X. Zhang, M.T. Ling, Q. Wang, C.K. Lau, S.C. Leung, T.K. Lee, A.L. Cheung, Y.C. Wong, X. Wang, Identification of a novel inhibitor of differentiation-1 (ID-1) binding partner, caveolin-1, and its role in epithelial-mesenchymal transition and resistance to apoptosis in prostate cancer cells, J. Biol. Chem. 282 (2007) 33284–33294. [18] W. Shen, A. Chang, J. Wang, W. Zhou, R. Gao, J. Li, Y. Xu, X. Luo, R. Xiang, N. Luo, D.G. Stupack, TIFA, an inflammatory signaling adaptor, is tumor suppressive for liver cancer, Oncogene 4 (2015) e173. [19] W. Shen, R. Du, J. Li, X. Luo, S. Zhao, A. Chang, W. Zhou, R. Gao, D. Luo, J. Wang, N. Hao, Y. Liu, Y. Chen, Y. Luo, P. Sun, S. Yang, N. Luo, R. Xiang, TIFA suppresses hepatocellular carcinoma progression via MALT1-dependent and -independent signaling pathways, Sig. Transduct. Target. Ther. 1 (2016) 16013. [20] J.M. Serrador, M. Vicente-Manzanares, J. Calvo, O. Barreiro, M.C. Montoya, R. Schwartz-Albiez, H. Furthmayr, F. Lozano, F. Sanchez-Madrid, A novel serinerich motif in the intercellular adhesion molecule 3 is critical for its ezrin/radixin/ moesin-directed subcellular targeting, J. Biol. Chem. 277 (2002) 10400–10409. [21] J.M. Serrador, J.L. Alonso-Lebrero, M.A. del Pozo, H. Furthmayr, R. SchwartzAlbiez, J. Calvo, F. Lozano, F. Sanchez-Madrid, Moesin interacts with the cytoplasmic region of intercellular adhesion molecule-3 and is redistributed to the uropod of T lymphocytes during cell polarization, J. Cell Biol. 138 (1997) 1409–1423. [22] Y.S. Gho, P.N. Kim, H.C. Li, M. Elkin, H.K. Kleinman, Stimulation of tumor growth by human soluble intercellular adhesion molecule-1, Cancer Res. 61 (2001) 4253–4257. [23] P. Guo, J. Huang, L. Wang, D. Jia, J. Yang, D.A. Dillon, D. Zurakowski, H. Mao, M.A. Moses, D.T. Auguste, ICAM-1 as a molecular target for triple negative breast cancer, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) 14710–14715. [24] P. Guo, J. Yang, D. Jia, M.A. Moses, D.T. Auguste, ICAM-1-targeted, Lcn2 siRNAencapsulating liposomes are potent anti-angiogenic agents for triple negative breast cancer, Theranostics 6 (2016) 1–13. [25] Y.C. Lin, C.T. Shun, M.S. Wu, C.C. Chen, A novel anticancer effect of thalidomide: inhibition of intercellular adhesion molecule-1-mediated cell invasion and metastasis through suppression of nuclear factor-kappaB, Clin. Cancer Res. 12 (2006) 7165–7173. [26] S.F. Yang, M.K. Chen, Y.S. Hsieh, T.T. Chung, Y.H. Hsieh, C.W. Lin, J.L. Su, M.H. Tsai, C.H. Tang, Prostaglandin E2/EP1 signaling pathway enhances intercellular adhesion molecule 1 (ICAM-1) expression and cell motility in oral cancer cells, J. Biol. Chem. 285 (2010) 29808–29816. [27] A.J. Bernier, J. Zhang, E. Lillehoj, A.R. Shaw, N. Gunasekara, J.C. Hugh, Non-cysteine linked MUC1 cytoplasmic dimers are required for Src recruitment and ICAM1 binding induced cell invasion, Mol. Cancer 10 (2011) 93. [28] L. Haddon, J. Hugh, MUC1-mediated motility in breast cancer: a review highlighting the role of the MUC1/ICAM-1/Src signaling triad, Clin. Exp. Metastasis 32 (2015) 393–403. [29] D.X. Nguyen, J. Massague, Genetic determinants of cancer metastasis, Nat. Rev. Genet. 8 (2007) 341–352. [30] A. Zlotnik, A.M. Burkhardt, B. Homey, Homeostatic chemokine receptors and organ-specific metastasis, Nat. Rev. Immunol. 11 (2011) 597–606. [31] E.D. Donnenfeld, P.M. Karpecki, P.A. Majmudar, K.K. Nichols, A. Raychaudhuri, M. Roy, C.P. Semba, Safety of Lifitegrast ophthalmic solution 5.0% in patients with dry eye disease: a 1-year, multicenter, randomized, placebo-controlled study, Cornea 35 (2016) 741–748. [32] C.P. Semba, D. Swearingen, V.L. Smith, M.S. Newman, C.A. O'Neill, J.P. Burnier, D.B. Haughey, T.R. Gadek, Safety and pharmacokinetics of a novel lymphocyte function-associated antigen-1 antagonist ophthalmic solution (SAR 1118) in healthy adults, J. Ocul. Pharmacol. Ther. 27 (2011) 99–104. [33] D.M. Paton, Lifitegrast: first LFA-1/ICAM-1 antagonist for treatment of dry eye disease, Drugs Today (Barc.) 52 (2016) 485–493. [34] S.C. Pflugfelder, M. Stern, S. Zhang, A. Shojaei, LFA-1/ICAM-1 interaction as a therapeutic target in dry eye disease, J. Ocul. Pharmacol. Ther. 33 (2017) 5–12. [35] A. Abidi, P. Shukla, A. Ahmad, Lifitegrast: a novel drug for treatment of dry eye disease, J. Pharmacol. Pharmacother. 7 (2016) 194–198.
Funding This work was supported by China Postdoctoral Science Foundation (No. 179316, S. Zhao) and Guizhou Science and Technology Cooperation Program (No. 7420, D. Luo). Competing interests The authors declare no potential conflicts of interest. Transparency document The http://dx.doi.org/10.1016/j.bbadis.2018.05.002 with this article can be found, in online version.
associated
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.bbadis.2018.05.002. References [1] G. Christofori, New signals from the invasive front, Nature 441 (2006) 444–450. [2] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144 (2011) 646–674. [3] I.J. Fidler, The pathogenesis of cancer metastasis: the ‘seed and soil’ hypothesis revisited, Nat. Rev. Cancer 3 (2003) 453–458. [4] X. Li, Y. Xu, Y. Chen, S. Chen, X. Jia, T. Sun, Y. Liu, X. Li, R. Xiang, N. Li, SOX2 promotes tumor metastasis by stimulating epithelial-to-mesenchymal transition via regulation of WNT/beta-catenin signal network, Cancer Lett. 336 (2013) 379–389. [5] X. Xiao, D.D. Mruk, C.Y. Cheng, Intercellular adhesion molecules (ICAMs) and spermatogenesis, Hum. Reprod. Update 19 (2013) 167–186. [6] K.A.K.M. Skubitz, K.D. Campbell, A.P. Skubitz, CD50 (ICAM-3) is phosphorylated on tyrosine and is associated with tyrosine kinase activity in human neutrophils, J. Immunol. 154 (1995) 2888–2895. [7] L.B.K. Antonin, R. de Fougerolles, Timothy A. Springer, Cloning and expression of intercellular adhesion molecule 3 reveals strong homology to other immunoglobulin family counter-receptors for lymphocyte function-associated antigen 1, J. Exp. Med. 177 (1993) 1187–1192. [8] C.L.A. John Greenwood, Claire E. Walters, Pierre-Olivier Couraud, Ruth Lyck, Intracellular domain of brain endothelial ICAM-1 is essential for T-lymphocytemediated signalling and migration1, J. Immunol. 171 (2003) 2099–2108. [9] A. Estecha, N. Aguilera-Montilla, P. Sanchez-Mateos, A. Puig-Kroger, RUNX3 regulates intercellular adhesion molecule 3 (ICAM-3) expression during macrophage differentiation and monocyte extravasation, PLoS One 7 (2012) e33313. [10] P.P. Zhu, S.G. Yuan, Y. Liao, L.L. Qin, W.J. Liao, High level of intercellular adhesion molecule-1 affects prognosis of patients with hepatocellular carcinoma, World J. Gastroenterol. 21 (2015) 7254–7263. [11] S.T. Tsai, P.J. Wang, N.J. Liou, P.S. Lin, C.H. Chen, W.C. Chang, ICAM1 is a potential cancer stem cell marker of esophageal squamous cell carcinoma, PLoS One 10 (2015) e0142834. [12] H.S. Yu, T.H. Lin, C.H. Tang, Involvement of intercellular adhesion molecule-1 upregulation in bradykinin promotes cell motility in human prostate cancers, Int. J. Mol. Sci. 14 (2013) 13329–13345. [13] Peng Guoa, Jing Huangd, Liya Wang, Jiang Yang Di Jia, Deborah A. Dillon, David Zurakowski, Hui Mao, Marsha A. Moses, Debra T. August, ICAM-1 as a molecular target for triple negative breast cancer, PNAS 111 (2014) 14710–14715. [14] M.C. Montoya, D. Sancho, G. Bonello, Y. Collette, C. Langlet, H.T. He, P. Aparicio, A. Alcover, D. Olive, F. Sanchez-Madrid, Role of ICAM-3 in the initial interaction of T lymphocytes and APCs, Nat. Immunol. 3 (2002) 159–168.
2578