Identification and characterisation of an aspartyl protease inhibitor homologue as a major allergen of Trichostrongylus colubriformis

International Journal for Parasitology 33 (2003) 1233–1243 www.parasitology-online.com

Invited review

Identification and characterisation of an aspartyl protease inhibitor homologue as a major allergen of Trichostrongylus colubriformisq Richard J. Shawa,*, Margaret M. McNeilla, David R. Maassa, Wayne R. Heina, Tressa K. Barbera, Mary Wheelerb, Chris A. Morrisb, Charles B. Shoemakera a

b

AgResearch Limited, Wallaceville Animal Research Centre, PO Box 40063, Upper Hutt, New Zealand AgResearch Limited, Ruakura Agricultural Research Centre, Private Bag 3123, Hamilton, New Zealand Received 24 January 2003; received in revised form 29 April 2003; accepted 19 May 2003

Abstract Allergens were identified from the gastrointestinal nematode of sheep, Trichostrongylus colubriformis, by probing Western blots of infective larvae (third stage) somatic antigen with IgE purified from the serum of sheep grazed on worm contaminated pasture. A 31 kDa allergen was frequently recognised by sera from immune sheep, particularly those deriving from a line that has been genetically selected over 23 years for parasite resistance. Using a proteomic approach, the 31 kDa allergen was identified as an aspartyl protease inhibitor homologue. The entire coding sequence of T. colubriformis aspartyl protease inhibitor (Tco-api-1) was obtained and the mature protein expressed in Escherichia coli. Anti-Tco-API-1 antibodies revealed that a commonly observed 21 kDa T. colubriformis allergen species is a truncated form of Tco-API-1. Specific IgE responses to T. colubriformis aspartyl protease inhibitor were significantly correlated with the degree of resistance to nematode infection as measured by faecal egg count in sheep. Surprisingly, IgE responses to Tco-API-1 were not correlated with breech soiling (dag score), which is thought to be caused, in part, by allergic hypersensitivity to worms. Therefore, a specific IgE response to this allergen may be a suitable marker for identifying lambs at an early age that will develop strong immunity to gastrointestinal nematodes. q 2003 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: Trichostrongylus colubriformis; IgE; Allergen; Aspartyl protease inhibitor

1. Introduction Trichostrongylus colubriformis is a nematode parasite that infects the small intestine of sheep and is of significant economic importance in New Zealand and worldwide. These parasites have a simple life cycle consisting of freeliving stages on pasture (egg to infective larvae, L3), and after ingestion, development through L4 –L5-adult in the host gastrointestinal tract. They do not have a tissue migratory phase. Trichostrongylus colubriformis live in mucus covered tunnels eroded on the surface of duodenal and intestinal villi. Sheep can develop immunity to T. colubriformis following repeated natural infections. Under natural grazing conditions, the capacity to resist nematode establishment q Nucleotide sequence data reported in this paper is available in the Genbank, EMBL and DDBJ databases under the accession number AY189824. * Corresponding author. Tel.: þ 64-4-9221569; fax: þ 64-4-9221380. E-mail address: [email protected] (R.J. Shaw).

develops after approximately 7 weeks of continuous infection (Dobson et al., 1990). However, as yet no effective anti-nematode vaccines based on defined antigens have been formulated and the only effective means of controlling T. colubriformis and other sheep nematodes is through the regular use of anthelmintics. Various studies have suggested that immunity to T. colubriformis involves the development of Th2-type immune responses, as evidenced by increased numbers of mast cells, globule leucocytes and eosinophils in the intestinal mucosa (McClure et al., 1992; Bisset et al., 1996). Elevated serum IgE levels have also been associated with protective immunity to nematode infections (Shaw et al., 1998, 1999). In this study, we have identified several T. colubriformis allergens using Western blotting techniques with purified ovine IgE from immune animals. Using 2-D electrophoresis, these allergens have been isolated and identified using mass spectrometry. An aspartyl protease inhibitor (Aspin) homologue was identified as a major nematode allergen in

0020-7519/03/$30.00 q 2003 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/S0020-7519(03)00157-7

1234

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

sheep. IgE recognising this allergen is substantially more prominent in lambs that develop an effective protective immunity to gastrointestinal parasites.

2. Materials and methods 2.1. Nematode larvae and antigen preparation Infective larvae (third stage) of T. colubriformis (TcL3) were obtained from cultures of faeces taken from monospecifically infected Romney sheep. Somatic antigen (TcL3-Homog) was prepared by homogenising exsheathed larvae under liquid nitrogen in a mortar and pestle. Soluble protein was extracted in 5 mM Tris buffer pH 7.6 with protease inhibitor (Complete, Boehringer Mannheim) added. After centrifugation at 1,700g for 10 min, the protein concentration of the supernatant was determined by absorbance at 230/260 nm, before being aliquoted and frozen at 2 70 8C. Adult antigen was prepared as per Shaw et al. (1998). 2.2. Sheep serum used in this study Lines of Romney sheep selected as lambs for either consistently low (resistant) or high (susceptible) faecal nematode egg counts (FEC) following periods of natural challenge have been maintained at AgResearch Wallaceville (see Bisset et al., 2001). These lines of sheep have been bred for 23 years and average about a 35-fold difference in FEC when receiving equivalent parasite challenge (Bisset et al., 2001). Serum samples used for 1-D Western blots were collected from 7-month-old resistant (R) and susceptible (S) selection line lambs grazed together on infected pasture in April 1997. Sera for 2-D immunoblots were obtained from penned sheep infected monospecifically with T. colubriformis (Shaw et al., 1998) or adult resistant line field sheep which showed high levels of immunity as determined by faecal egg count and post-mortem worm counts (data not shown). For immunoassay studies, serum samples were collected from the Wallaceville resistant and susceptible lines, or control sheep in January and March 2002. Faecal soiling around the breech area (dag scores) were assessed and faecal samples taken to measure FECs using a modified McMaster technique (Bisset et al., 1997). All experimental procedures and animal management protocols were undertaken with the approval of, and in accordance with, the requirements of the Wallaceville Animal Research Centre Animal Ethics Committee. 2.3. Western blotting Homogenated nematode antigen (152 mg) was separated by SDS-PAGE on 25-5% acrylamide gels using a Protean II electrophoresis apparatus (Bio-Rad Laboratories) and transferred to nitrocellulose paper using a Protean II

Trans-Blot cell (Bio-Rad). Nitrocellulose sheets were blocked with 5% skim milk powder (Blotto) for 1 h at 37 8C then washed with distilled water and PBS. One millilitre aliquots of serum were precipitated with 37% saturated ammonium sulphate and each supernatant dialysed against PBS. IgE was purified from the ammonium sulphate precipitate supernatants using affinity purification with an anti-IgE column (Shaw et al., 1996). Strips of nitrocellulose were incubated with 2 ml of solution containing IgE preparations diluted 1:1 in 0.5% BSA in PBS –0.1% Tween-20 overnight at 4 8C. They were then washed five times with PBS –0.1% Tween-20 and incubated with 1:15 dilution of XB6-YD3 (anti ovine IgE) monoclonal antibody supernatant solution for 2 h at room temperature. After a further five washes, bound antibody was detected with anti-mouse gamma-chain-specific-HRP conjugate and developed for 30 min with 0.4 mg ml21 3-amino-9ethylcarbozole/hydrogen peroxide mixture. 2.4. Two-dimensional gel electrophoresis Sample preparation and isoelectric focusing was performed as described in the manufacturer’s instruction manual (IPGphor, Amersham Biosciences) with slight modifications. Briefly, 900 ml of TcL3-Homog (, 360– 1,900 mg) was precipitated in 3,600 ml acetone at 2 20 8C for 30– 120 min. After centrifuging at 16,000g for 30 min at 4 8C, acetone was removed and the precipitate dried. The precipitate was dissolved in , 280 ml of rehydration buffer containing 8 M urea, 3 M thiourea, 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 40 mM dithiothreitol, 0.5% ampholyte containing buffer (IPG buffer, pH 3 –10) and a trace of bromophenol blue. The solution was used to rehydrate Immobiline DryStrips (13 cm, pH 3 – 10) at 30 V for 30 –60 h on an IPGphor. Proteins were focused at 20 8C according to the following voltage protocol: 120 V for 2 h, 500 V for 1 h, 1,000 V for 1 h, 1,000– 8,000 V gradient for 30 min, 8,000 V for 6.0 –8.5 h (total Vh were 52,000 – 80,000 Vh). After a standard equilibration step, proteins were run in the second dimension by SDS-PAGE on linear 10 –18% gels. Proteins in the resolved gels were stained with microwave assisted Coomassie blue R-250 (Wong et al., 2000) or transferred to nitrocellulose (Bio-Rad) according to the manufacturer’s directions. 2.5. 2-D gel Western blotting Proteins transferred to nitrocellulose were initially detected with Ponceau S (Harper and Speicher, 1995) and the membrane marked to assist later identification of proteins in Coomassie blue stained gels. Immunoblots were developed essentially as described in Section 2.3 except that purified IgE was applied at 10 – 15 mg ml21 overnight at room temperature.

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

2.6. Protein in-gel digestion Protein spots from Coomassie blue stained gels corresponding to the IgE-detected nematode allergens from companion immunoblots were excised manually with a scapel, destained and digested with trypsin (Shevchenko et al., 1996). Briefly, excised spots were destained in 25 mM NH4HCO3 in 50% acetonitrile (ACN), dried by centrifugal evaporation and rehydrated in 20 ml 25 mM NH4HCO3 containing 250 ng trypsin, sequencing grade (Boehringer Mannheim) and incubated at 37 8C for 16 h. Peptides were then extracted sequentially with 25 mM NH4HCO3, 50% ACN/0.5% trifluoroacetic acid (TFA) (three times) and 100% ACN. The combined extracts were dried in a Speedvac, rinsed with milliQ water, and dried again. Extracts were then dissolved in 0.5% TFA. The tryptic digest was cleaned up with C18 resin containing ZipTips (Millipore) according to the manufacturer’s directions. Peptides were eluted from ZipTips in matrix solution consisting of a saturated solution of a-cyano-4-hydroxycinnamic acid in 50% ACN/0.5% TFA and spotting directly onto mass spectrometer (MS) sample plate. 2.7. Protein identification 2.7.1. Peptide mass fingerprinting (PMF) Molecular masses of tryptic peptides from each protein spot were determined on a MALDI-TOF instrument equipped with a nitrogen laser at 337 nm (Perceptive Biosystems, Voyager mass spectrometer). All MALDI spectra were externally calibrated using CALMIX 2 peptide mass standards (Perceptive Biosystems). Peptide masses were submitted for protein mass database searching at ProFound (URL: http://www.proteometrics.com/prowl-cgi/ ProFound.exe). 2.7.2. De novo peptide sequencing by electrospray ionisation Protein spots were submitted to the Australian Proteome Analysis Facility (APAF, Sydney, Australia) for determination of amino acid sequence from selected peptides. Briefly samples underwent a 16-h tryptic digest at 37 8C. The resulting peptides were purified using a ZipTip to concentrate and desalt the sample. The samples were then analysed by ESI-TOF MS/MS using a Micromass Q-TOF MS equipped with a nanospray source, using either flow injection coupled to a Waters CapLC, or manually acquired using borosilicate capillaries for nanospray acquisition. Data were acquired over the m/z (mass to charge ratio) range 400 –1,800 Da to select peptides for MS/MS analysis. After peptides were selected, the MS was switched to MS/MS mode and data collected over the m/z range 50– 2,000 Da with variable collision energy settings. Amino acid sequences were then determined from this data.

1235

2.7.3. N-terminal microsequencing Crude T. colubriformis L3 protein was separated by 2-D electrophoresis and electroblotted onto polyvinylidene fluoride (PVDF) membrane using standard techniques for preparing proteins for sequencing. The PVDF was stained with 0.1% Ponceau S and/or 0.025% Coomassie blue R and the spots corresponding to allergens on companion Western blots were identified and cut out. PVDF spots were then submitted for Edman degradation analysis (Protein Microchemistry Facility, Otago University, Dunedin, New Zealand) to establish the amino terminus sequence. 2.8. Cloning and expression of T. colubriformis aspartyl protease inhibitor homologue Trichostrongylus colubriformis total RNA was prepared with Trizol (Invitrogen) using manufacturers’ protocols except the initial extraction was performed by grinding larvae in the presence of Trizol under liquid nitrogen. Total RNA was converted to cDNA by standard procedures using SuperscriptII (Invitrogen) and used as the template in subsequent PCR. Based on amino acid sequence data, degenerate oligonucleotides were designed and used as primers in PCR with a spliced leader primer under permissive conditions. The primer combination successfully used in PCR was as follows. SL1 50 -GGTTTAATTACCCAAGTTTGA-30 and a primer corresponding to the tryptic peptide sequence: Tco-API-1 Arev 50 -TTTTCGTAGTT GGTGATTTCYTGYTGYTC-30 , where Y ¼ C/T. PCR conditions were as follows; 95 8C for 2 min, followed by 10 cycles of 95 8C for 30 s, 35 8C for 45 s, þ 1.0 8C per cycle, 72 8C for 45 s followed by 30 cycles of 95 8C for 30 s, 45 8C for 45 s, þ 0.2 8C per cycle, 72 8C for 60 s, and þ 2 s per cycle. A product of 240 bp was observed by agarose gel electrophoresis, cloned into pCR2.1 using TA cloning (Invitrogen) and sequenced. Analysis of the sequence revealed homology to the 50 coding end of Aspin genes. Sequences encoding the amino terminus of the 30 kDa T. colubriformis allergen (Tco-API-1) were present in this DNA fragment. PCR primers were prepared to amplify the complete mature coding DNA for Tco-API-1 based on the amino terminal coding sequence and a previously sequenced T. colubriformis EST (unpublished) containing the carboxyl coding end. The primers, containing restriction sites to facilitate cloning into the expression vector, had the following sequences: Tco-API-1 .pro.5.nde GATCGGCGCGCCATATGCTTACTGTGGGCACGATTGC Tco-API-1 not.3 GATCTGCGGCCGCATAGATCC TCGTGCAGAAGTT A PCR product of about 600 bp was obtained and sequenced. Together with the overlapping EST, this permitted determination of the complete Aspin coding

1236

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

DNA and 30 untranslated region (Genbank accession number AY189824). After PCR the products were digested with Nde1 and Not1, gel purified (Qiagen) and the coding fragment cloned into the expression vector AY2-4. This vector is a derivative of pBAD18 (Guzman et al., 1995), modified to permit precise fusion at Not1 of coding sequences to DNA encoding AAAHHHHHH followed by a stop codon. Bacteria containing the Tco-API-1/AY2-4 construct were grown in LB broth at 37 8C to an optical density (600 nm) of 0.8 at which time protein synthesis was induced by the addition of 0.2% L (þ )arabinose (BDH). Induction proceeded for 16 h at 30 8C and the bacteria were pelleted and resuspended in 300 mM NaCl/50 mM PO4 pH 8.0 buffer containing 1 mg/ml lysozyme and incubated on ice for 1 h. The bacteria were sonicated and the solution clarified by centrifugation to yield a soluble bacterial fraction. Recombinant protein was immobilised to Ni-NTA resin (Qiagen), the resin was washed with 300 mM NaCl/50 mM PO4 pH 8.0 buffer containing 20 mM imidazole and the bound protein was eluted by the addition of the same buffer plus 100 mM imidazole. The eluted protein consisted of nearly pure recombinant Tco-API-1 (as assessed by SDS-PAGE and Western blotting) and was dialysed against PBS and the protein concentration determined using absorbance at 280 nm. 2.9. Immunisation of rabbits New Zealand white rabbits were immunised with 100 mg of purified recombinant Tco-API-1 mixed with Montanide ISA50 (Seppic, France) at a ratio of 6 parts Montanide: 5 parts aqueous solution were injected intramuscularly and subcutaneously. Four weeks later a second immunising dose prepared exactly as the first, was administered by the same route. The rabbit was bled by heart puncture under anaesthetic 10 days after the second immunisation. After clotting for 1 h at room temperature the blood was centrifuged at 1,300g for 15 min. The serum was collected and stored at 2 20 8C until needed. This serum is referred to as anti-Tco-API-1. 2.10. Affinity purification of native Tco-API-1 Rabbit anti-Tco-API-1 IgG was purified from sera by Protein A sepharose affinity using standard techniques. Purified antibody was bound to N-hydroxysuccinimide (NHS)-activated sepharose (Amersham Pharmacia) as per the manufacturer’s protocols. TcL3-homog was passed through the immobilised rabbit antibody column at 0.5 –2.0 ml/min. The column was washed with buffer (20 mM phosphate buffer, 500 mM NaCl, pH 7.0) until a baseline was reached at absorbance of 280 nm. The bound native Tco-API-1 was eluted with either 0.1 M glycine or formic acid pH 3.0. The eluant was neutralised with 1 M Tris or ammonium hydrogen carbonate pH 8.0. Eluted

fractions were vacuum dried before analysis by 1-D electrophoresis. 2.11. Pepsin inhibition assay The inhibition of haemoglobin digestion activity of porcine pepsin (Kageyama, 1998) was used to determine activity of native and recombinant Tco-API-1. Pepstatin was used as a positive control. 2.12. Enzyme immunoassay for specific IgE and IgG1 to recombinant proteins Antigen-specific IgG1 and IgE were detected by ELISA as described previously (Shaw et al., 1998). The optimal concentration of soluble recombinant Tco-API-1 was determined to be 0.2 and 5 mg ml21 in PBS for IgE and IgG1 assays, respectively. Results were expressed as mean absorbance in O.D. units. A sheep was deemed Tco-API-1 IgE positive if its mean absorbance value was greater than three times the mean of assay blank wells plus two standard deviations. 2.13. Statistical analysis All antibody O.D. values were transformed to natural logarithms, to normalise the distributions. Least squares analyses were carried out using Genstat (1994) to estimate the effects of selection or control line on each logtransformed antibody trait; results are reported after backtransforming the least squares means. Genetic correlations between antibody traits and both log FEC and dag score were estimated from records taken in January 2002 (time 1, approximately 4 months of age) or in March (time 2) using restricted maximum likelihood techniques with an animal model (Gilmour, 1997).

3. Results 3.1. IgE Western blotting of T. colubriformis L3 antigens IgE was purified from nematode parasite resistant (R) and susceptible (S) selection line lamb sera and used to assay TcL3 antigen by Western blotting (Fig. 1). IgE purified from S-line sheep showed only weak binding and no prominent TcL3 antigens were identified. In contrast, IgE from R-line lambs consistently produced prominent reaction products identifying three nematode antigens with apparent molecular weights of 21, 31 and 40 kDa, respectively. The 31 kDa antigen appeared to be the most immunogenic of the three allergens, since it generally gave the strongest reaction product and IgE-binding was observed to some extent in serum from most R-line sheep. A similar pattern and frequency of IgE recognition was found using serum samples taken from field immune sheep after 1 year of

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

1237

Fig. 1. One-dimensional immunoblot analysis of T. colubriformis L3 homogenate proteins probed with IgE samples from resistant (R) and susceptible (S) sheep bleed at 7 months of age (22/4/97).

age (data not shown), however, in these older sheep a 12 kDa antigen was also frequently detected producing a strong signal (data not shown). There was some diffuse staining in the high molecular weight region in all samples assayed and this may represent non-specific IgE-binding (Fig. 1). TcL3-homogenate was separated using 2-D electrophoresis technology, electroblotted and immunostained with affinity purified ovine IgE pooled from immune animals displaying particularly strong IgE response to T. colubriformis antigens. As shown in Fig. 2A, the major molecular species recognised by IgE was a spot, or a series of spots, at 33 kDa with pI of about 5.1. A similar recognition pattern was observed following 2-D immunoblotting with ovine IgE preparations from several individual T. colubriformis immune sheep (data not shown). 3.2. Identification of the major T. colubriformis L3 allergen recognised by immune sheep Trichostrongylus colubriformis allergens corresponding to spots from 2-D IgE immunoblots (as above) were excised from matching Coomassie blue stained gels (Fig. 2B), digested with trypsin and subjected to analysis on a MALDI-TOF MS for PMF. Using this strategy, a weakly staining, “tear-drop” shaped spot of 40 kDa and pI of 7.0 was identified as a galectin homologue (manuscript in preparation). The predominant spot at 33 kDa could not be unambiguously identified by PMF, so a trypsin digest was analysed by ESI-MS/MS to obtain peptide sequence information. One tryptic peptide with the sequence SASEQQE[L/I]TNYEK was obtained. In addition, N-terminal sequence of the intact 33 kDa antigen was obtained by Edman degradation analysis and shown to be

LTVGTI. The internal amino acid sequence data was used to design an oligonucleotide primer that worked with a spliced leader primer in a PCR to amplify a 240 bp DNA fragment from T. colubriformis L3 stage cDNA (see Section 2). From the sequence of this fragment it was possible to identify an initiator codon downstream of the spliced leader sequence that was followed by a putative signal peptide coding sequence and then sequence encoding the experimentally determined mature amino terminus of the 33 kDa immunostained protein. The encoded peptide sequence had strong homology to the Aspin family of proteins. 3.3. Characterisation of T. colubriformis aspartyl protease inhibitor (Tco-API-1) The remaining T. colubriformis Aspin (Tco-API-1) coding region was amplified from cDNA using PCR primers designed from the amino terminal coding sequence (above) and carboxyl-terminal coding sequence from an ovine EST. The complete amino acid sequence of Tco-api-1 is presented in Fig. 3 in alignment with other members of the putative nematode Aspin family. The encoded Tco-API-1 is a protein of 228 amino acids with a predicted molecular mass of 25,412 Da and a calculated pI of 5.31. The N-terminus amino acid sequence contains a putative signal peptide with a predicted cleavage site between residues 15 and 16 (alanine –alanine). N-terminal sequencing showed that the mature protein N-terminus is LTVGTI suggesting that further processing removes the amino acids APRQKR. The putative mature protein of 215 amino acids has a predicted molecular mass of 23,057 Da and pI of 4.93. The sequence does not contain N-glycosylation sites. Computer searches revealed significant homology to

1238

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

Fig. 2. Two-dimensional SDS-PAGE analysis of T. colubriformis L3 homogenate proteins. Proteins were subjected to isoelectric focusing (left to right) followed by SDS-PAGE (top to bottom). (A) Immunoblot probed with affinity purified total IgE antibodies from an immune sheep. (B) Gel stained for total proteins using Coomassie blue. Spot corresponding to Tco-API-1 is indicated by a circle and Tco-API-1 breakdown product by a square.

Aspin homologues from Ostertagia ostertagi (CAD10783): (% identity/% similarity) (86%/90%), Parelaphostrongylus tenuis (AAG50205): (71%/83%), Caenorhabditis elegans (AAC46663): (50%/68%), Acanthocheilonema viteae (S23229): (40%/59%), Dirofilaria immitis (AAA70419): (42%/57%) and Onchocerca volvulus (AAA29419):

(42%/60%). These proteins share distinct homology to a known Aspin from the intestinal nematode Ascaris suum (Martzen et al., 1990). Tco-API-1 coding DNA encoding the mature protein was cloned within an Escherichia coli expression vector fused, in frame, to DNA coding for a carboxyl terminal epitope tag

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

1239

Fig. 3. Alignment of Tco-API-1 with other members of the putative aspartyl protease inhibitor family. Database accession numbers for the previously sequenced members are: (Oo) O. ostertagi (CAD10783), (Pt) P. tenuis (AAG50205), (Ce) C. elegans (AAC46663), (Di) D. immitis (AAA70419), (Ov) O. volvulus (AAA29419), (Av) A. viteae (S23229). Alignment begins at the putative initiating methionines. The conserved amino acid residues RDL of putative YVRDLT sequence motif suggested to be critical for inhibitor function are shown by p . Invariant cysteine residues are marked by ˆ .

and hexahistidine to facilitate purification. Recombinant Tco-API-1 was produced in E. coli and approximately half of the induced product was present within the soluble fraction and purified to near homogeneity by nickel affinity. purified recombinant Tco-API-1 was used in ELISAs and to immunise rabbits to prepare antiserum.

The spot at 21 kDa, pI 5.7 is apparently the same as a weakly staining spot also seen in Fig. 2A and further indicates that the 21 kDa allergen frequently recognised by immune sheep IgE is the truncated form of Tco-API-1. The blurred spot at 58.8 kDa, pI 5.6 is possibly a dimer form of Tco-API-1. 3.5. Inhibitory activity against pepsin

3.4. Characterisation of native Tco-API-1 Tco-API-1 was purified by immunoaffinity from crude TcL3-homogenate. An SDS-PAGE gel (Fig. 4) revealed two bands of molecular weight 33 and 21 kDa. Both bands were recognised by anti-Tco-API-1 rabbit antiserum and by purified IgE from nematode immune sheep. To determine whether the smaller protein was a proteolytic product of full-size Tco-API-1, a PVDF transferred spot was submitted for N-terminal sequence analysis. Edman sequencing revealed that the 21 kDa band had the same N-terminal amino acid sequence of LTVGTI, as 33 kDa Tco-API-1. This demonstrates that a 21 kDa truncated form of Tco-API1 is present within T. colubriformis homogenates. As this 21 kDa form of Tco-API-1 is also recognised by IgE from immune sheep, it is almost certainly responsible for the 21 kDa band seen frequently in 1-D blots with IgE purified from nematode immune serum (see Fig. 1). When rabbit antiserum produced to Tco-API-1 was applied to a 2-D blot of TcL3 homogenate, a series of closely placed spots of 32.2 – 34.5 kDa and pI 4.9 –5.7 (Fig. 5) were identified. As expected, these correspond in localisation to the spots identified as Tco-API-1 in Fig. 2A.

No inhibitory activity could be demonstrated against pepsin digestion of haemoglobin by either recombinant or native Tco-API-1. Pepstatin at 2.5 mg would inhibit 6 mg of

Fig. 4. One-dimensional SDS-PAGE gel of affinity purified native Tco-API1 stained with silver stain and corresponding immunoblot developed with purified IgE (lane A), rabbit anti-Tco-API-1 sera (lane B) and goat anti rabbit–HRP conjugate (lane C).

1240

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

Fig. 5. Two-dimensional immunoblot analysis of T. colubriformis L3 homogenate proteins. Proteins were subjected to isoelectric focusing (left to right) followed by SDS-PAGE (top to bottom). Immunoblot was probed with serum from rabbit immunised with purified recombinant Tco-API-1.

pepsin, however, neither form of Tco-API-1 showed activity at up to 10 mg. 3.6. Specific IgE response to Tco-API-1 in nematode infected sheep IgE and IgG1 responses to recombinant Tco-API-1 were measured in lambs grazing on infected pasture (Table 1).

Included in this study were members of the Wallaceville Romney selection lines of sheep bred for resistance (R) or susceptibility (S). Resistant line lambs had significantly higher levels of anti-Tco-API-1 IgE than did susceptible or control line lambs in serum samples taken in January and March when the lambs were approximately 4 and 6 months of age. In contrast, anti-Tco-API-1 IgG1 levels were significantly different only between resistant and susceptible lines of sheep. These results show that specific IgE reactivity in lambs as early as 4 months of age to the nematode allergen Tco-API-1 could be used to identify sheep that are better able to develop effective nematode worm immunity. Forty-nine percent of R-line sheep were Tco-API-1 IgE positive in January and this increased to 58% by March. By contrast, 3 and 5% of S-line lambs, and 18 and 28% of the control line, were positive in January and March, respectively. Very similar results were obtained for R-line samples when they were assayed on native Tco-API-1 (data not shown). Furthermore, a strong negative genetic correlation was found between Tco-API-1 (IgE) and log-transformed faecal egg count (Table 2). For example, the genetic correlation of Tco-API-1January (IgE) with loge(FECJanuary þ 100) was 2 0.35 (S.E., 0.15; P , 0:05), and with loge(FECMarch þ 100) was 2 0.52 (S.E., 0.15; P , 0:001). No significant genetic correlation was found between specific IgE to Aspin and dag score. The genetic correlation indicates the degree to which genes controlling the expression of one performance measure in an animal are also associated with the expression of another performance measure.

Table 1 Mean specific antibody O.D. values (back-transformed) for Wallaceville selection line male lambs born in 2001; significance tests comparing each line with the resistant line Sheep line type

Tco-API-1 IgE Jan

Tco-API-1 IgE Mar

Tco-API-1 IgG1 Jan

Tco-API-1 IgG1 Mar

Number of sheep

Susceptible Controls Resistant

0.001a 0.022a 0.200

0.009a 0.047a 0.390

0.559b 0.641NS 0.688

0.300a 0.471NS 0.529

37 49 51

a b

NS, not significant. P , 0:001. P , 0:05.

Table 2 Genetic correlations between measured antibody traits and loge FEC or breech soiling score (dag score) Genetic correlation with

loge(Tco-API-1 IgE: Jan) loge(Tco-API-1 IgE: Mar) loge(Tco-API-1 IgG1: Jan) loge(Tco-API-1 IgG1: Mar)

a b

loge(FECJan þ 100)

loge(FECMar þ 100)

Dag score 1 (Jan)

Dag score 2 (Mar)

20.35 S.E. 0.15b 20.37 S.E. 0.13a 0.03 S.E. 0.14NS 20.42 S.E. 0.25NS

20.52 S.E. 0.15a 20.50 S.E. 0.14a 20.12 S.E. 0.15NS 20.31 S.E. 0.20NS

0.18 S.E. 0.22NS 0.21 S.E. 0.18NS 0.11 S.E. 0.21NS 0.28 S.E. 0.25NS

0.03 S.E. 0.251NS 0.01 S.E. 0.20NS 0.01 S.E. 0.25NS 0.08 S.E. 0.32NS

NS, not significant. S.E., standard error of genetic correlations. P , 0:001. P , 0:05.

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

4. Discussion In this study we report the identification of a dominant allergen from the sheep intestinal nematode T. colubriformis. We established that a 31– 33 kDa band following SDSPAGE was frequently recognised on Western blots by IgE purified from sheep that have been exposed to nematode parasites. Sheep from a line that has been selected for nematode parasite resistance (R-line) are much more likely to mount an IgE response against this antigen than are nematode susceptible sheep (S-line) or unselected controlline sheep. Using a combination of proteomic and molecular biology techniques we have unambiguously shown that this major 31 – 33 kDa T. colubriformis allergen species has significant sequence homology to nematode Aspins. A second common allergen species in T. colubriformis extracts that migrates at 21– 22 kDa on SDS-PAGE has been identified as a truncated form of the same protein. This may represent a proteolytically processed version of the larger Aspin or it could be the product of an alternatively spliced transcript. The free-living soil nematode C. elegans, has an Aspin gene homologue (F32A5.4) that is expressed in two forms through an alternative splicing mechanism. Unlike Tco-API-1, the truncated form of C. elegans-Aspin has a different amino-terminus than the larger form. Despite having a deduced molecular weight of 23,057 Da, recombinant Tco-API-1 with six histidine tag ran on SDSPAGE gels at 27,500 Da, and native Tco-API-1 at , 33,000 Da. While no evidence of N-linked glycosylation was found, these differences in experimental size suggest other post-translational modifications may exist in the native molecule. Homologues of Aspins have been identified in at least seven other parasitic nematode species in addition to C. elegans. Structural features common to the nematode Aspins include the presence of a signal peptide sequence and the conservation of all four cysteine residues in the mature protein. Interestingly, the YVRDLT sequence motif, suggested as being of crucial functional importance in several filarial nematode inhibitors (Willenbucher et al., 1993), is not well conserved in Tco-API-1 as this protein retains only a shortened RDL sequence motif at the equivalent position. Related inhibitors from O. volvulus, Ov33 (Tume et al., 1997) and A. suum, PI-3 (Martzen et al., 1990; Kageyama, 1998) inhibit the in vitro activity of aspartyl proteases such as pepsin and cathepsin E. However, using porcine pepsin, we were unable to demonstrate similar inhibitory activity with either recombinant or native TcoAPI-1. IgG based immunoassays have been developed to detect nematode Aspins as diagnostic tests for infection. Such tests have been reported for O. volvulus (Lucius et al., 1988; Tume et al., 1997; Chandrashekar et al., 1991) in humans, D. immitis in dogs (Hong et al., 1996; Mejia et al., 1994) and cats (Frank et al., 1998), and P. tenius in red deer (Duffy et al., 2002). However, none of the assays

1241

tested IgE reactivity to the Aspin. Onchocerca volvulus (Ov33) has, however, been shown to induce specific IgE and IgG4 in vitro in peripheral blood mononuclear cells from sensitised individuals (Garraud et al., 1995). In this paper we show that R-line (low FEC) lambs produce significantly more IgE specific to Tco-API-1 than S-line (high FEC) or control-line lambs. This confirmed our earlier Western blotting results which showed that a 31 kDa allergen (Tco-API-1) was readily identified by sera from R-line sheep but not from S-line or high FEC controlline sheep. These results extend previous work in which we reported a negative genetic correlation between FEC and IgE responses of R and S-line lambs exposed to nematode challenge while grazing (Shaw et al., 1999). However, unlike the previous work where specific IgE to a crude mixture of TcL3 ES antigens showed a positive genetic correlation to the level of breech soiling (“dag score”) in March, there was no such correlation between Tco-API-1 specific IgE and dag score in the present study. This suggests that selection of sheep for parasite resistance based on specific IgE levels to Tco-API-1 should not simultaneously select for increased breech soiling. The formation of dags in the breech area is brought about by diarrhoea thought to be associated with inflammatory responses to nematode infections and is particularly evident on some resistant line sheep (Bisset et al., 2001). It may thus be possible to devise more practical tests to measure IgE levels specific for defined allergens, apart from ELISA, which could be used as part of a selective breeding program. For example, Tco-API-1, and perhaps Aspins from other gastrointestinal nematodes, might have efficacy in an intradermal skin test aimed at rapidly identifying nematode-resistant sheep under field conditions. As for many eukaryotes, aspartyl proteases appear to be secreted endogenously in several nematode species, although no clear functional roles have been ascribed to them (Jolodar and Miller, 1998; Geldhof et al., 2000). Nematodes are, however, unusual insofar as they are the only taxonomic group in which Aspins have been identified to date (Martzen et al., 1990; Kageyama, 1998; Girdwood and Berry, 2000). The presence of Aspin homologues in the free-living nematode C. elegans suggests that one function of these inhibitors could be to regulate endogenous nematode aspartyl proteases in ways that are unrelated to the development of parasitism (Girdwood and Berry, 2000). It is also conceivable that secretion of Aspins by parasitic nematodes might assist in the establishment of parasitism. For example, localised inhibition of pepsin activity as nematodes transit through the gastric environment may enhance survival of infective larvae. However, the fact that we were unable to demonstrate any inhibitory activity of native or recombinant Tco-API-1 towards pepsin does not support a role in pepsin inhibition for this protein. Nematode

1242

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243

Aspins have also been shown to inhibit cathepsin E (Kageyama, 1998). The cathepsins, including cathepsin E, have long been implicated as playing an important role in processing of exogenous antigens for presentation to cells of the immune system on class II MHC proteins (Bennett et al., 1992; Hewitt et al., 1997; Riese and Chapman, 2000). Although not tested in the present experiments, it is plausible that secretion of Tco-API-1 may inhibit the activity of host cathepsin E and thereby assist the nematode to evade specific components of the host immune response. Proteases, and their inhibitors, are prominent among well characterised allergens (Lobos 1997). The allergenicity of this group of compounds appears to be strongly linked with biological activity, since the inactivity of recombinant proteases usually coincides with a loss of allergenicity after immunisation. Interestingly, purified native or recombinant Tco-API-1 have not proved effective at inducing a specific IgE response when injected into sheep in a variety of adjuvants (data not shown). Nonetheless, it is clear that when expressed endogenously within a parasitic nematode, Tco-API-1 is a potent allergen which induces a strong IgE response in genetically predisposed animals (e.g. resistant line sheep). It remains unclear why Tco-API-1 is a potent allergen in sheep when presented by the nematodes but not when administered separately.

Acknowledgements This research has been facilitated by access to the Australian Proteome Analysis Facility established under the Australian Government’s Major National Research Facilities Program. The NZ Foundation for Research, Science and Technology supported this work financially. Components of this work are the subject of a patent application, NZ Pat Appln No. 521434.

References Bennett, K., Levine, T., Ellis, J.S., Peanasky, R.J., Samloff, I.M., Kay, J., Chain, B.M., 1992. Antigen processing for presentation by class II major histocompatibility complex requires cleavage by cathepsin E. Eur. J. Immunol. 22, 1519–1524. Bisset, S.A., Vlassoff, A., Douch, P.G., Jonas, W.E., West, C.J., Green, R.S., 1996. Nematode burdens and immunological responses following natural challenge in Romney lambs selectively bred for low or high faecal worm egg count. Vet. Parasitol. 61, 249–263. Bisset, S.A., Vlassoff, A., West, C.J., Morrison, L., 1997. Epidemiology of nematodosis in Romney lambs selectively bred for resistance or susceptibility to nematode infection. Vet. Parasitol. 70, 255 –269. Bisset, S.A., Morris, C.A., McEwan, J.C., Vlassoff, A., 2001. Breeding sheep in New Zealand that are less reliant on anthelmintics to maintain health and productivity. N. Z. Vet. J. 49, 236 –246. Chandrashekar, R., Masood, K., Alvarez, R.M., Ogunrinade, A.F., Lujan, R., Richards, F.O., Weil, G.J., 1991. Molecular cloning and

characterization of recombinant parasite antigens for immunodiagnosis of onchocerciasis. J. Clin. Invest. 88, 1460–1466. Dobson, R.J., Waller, P.J., Donald, A.D., 1990. Population dynamics of Trichostrongylus colubriformis in sheep: the effect of infection rate on the establishment of infective larvae and parasite fecundity. Int. J. Parasitol. 20, 347 –352. Duffy, M.S., MacAfee, N., Burt, M.D., Appleton, J.A., 2002. An aspartyl protease inhibitor orthologue expressed by Parelaphostrongylus tenuis is immunogenic in an atypical host. Clin. Diagn. Lab. Immunol. 9, 763 –770. Frank, G.R., Mondesire, R.R., Brandt, K.S., Wisnewski, N., 1998. Antibody to the Dirofilaria immitis aspartyl protease inhibitor homologue is a diagnostic marker for feline heartworm infections. J. Parasitol. 84, 1231–1236. Garraud, O., Nkenfou, C., Bradley, J.E., Perler, F.B., Nutman, T.B., 1995. Identification of recombinant filarial proteins capable of inducing polyclonal and antigen-specific IgE and IgG4 antibodies. J. Immunol. 155, 1316–1325. Geldhof, P., Claerebout, E., Knox, D.P., Jagneessens, J., Vercruysse, J., 2000. Proteinases released in vitro by the parasitic stages of the bovine abomasal nematode Ostertagia ostertagi. Parasitology 121, 639 –647. Genstat, 1994. Statistical Package: Genstat 5, Release 3.1. Lawes Agricultural Trust, Rothamsted Experimental Station, UK. Gilmour, A.R., 1997. ASREML for testing fixed effects and estimating multiple trait variance components. Proc. Assoc. Adv. Anim. Breed. Genet. 12, 386–390. Girdwood, K., Berry, C., 2000. The disulphide bond arrangement in the major pepsin inhibitor PI-3 of Ascaris suum. FEBS Lett. 474, 253 –254. Guzman, L.M., Belin, D., Carson, M.J., Beckwith, J., 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121–4130. Harper, S., Speicher, D.W., 1995. Detection of proteins on blot membranes. Current Protocols in Protein Science 10.8.1, John Wiley and Sons, New York. Hewitt, E.W., Treumann, A., Morrice, N., Tatnell, P.J., Kay, J., Watts, C., 1997. Natural processing sites for human cathepsin E and cathepsin D in tetanus toxin: implications for T cell epitope generation. J. Immunol. 159, 4693–4699. Hong, X.Q., Mejia, S.J., Kumar, S., Perler, F.B., Carlow, C.K., 1996. Cloning and expression of DiT33 from Dirofilaria immitis: a specific and early marker of heartworm infection. Parasitology 112, 331 –338. Jolodar, A., Miller, D.J., 1998. Identification of a novel family of nonlysosomal aspartic proteases in nematodes. Biochim. Biophys. Acta 1382, 13–16. Kageyama, T., 1998. Molecular cloning, expression and characterization of an Ascaris inhibitor for pepsin and cathepsin E. Eur. J. Biochem. 253, 804 –809. Lobos, E., 1997. The basis of IgE responses to specific antigenic determinants in helminthiasis. Chem. Immunol. 66, 1– 25. Lucius, R., Erondu, N., Kern, A., Donelson, J.E., 1988. Molecular cloning of an immunodominant antigen of Onchocerca volvulus. J. Exp. Med. 168, 1199–1204. Martzen, M.R., McMullen, B.A., Smith, N.E., Fujikawa, K., Peanasky, R.J., 1990. Primary structure of the major pepsin inhibitor from the intestinal parasitic nematode Ascaris suum. Biochemistry 29, 7366–7372. McClure, S.J., Emery, D.L., Wagland, B.M., Jones, W.O., 1992. A serial study of rejection of Trichostrongylus colubriformis by immune sheep. Int. J. Parasitol. 22, 227–234. Mejia, S.J., Nkenfou, C., Southworth, M.W., Perler, F.B., Carlow, C.K., 1994. Expression of an Onchocerca volvulus Ov33 homolog in Dirofilaria immitis: potential in immunodiagnosis of heartworm infection. Parasite Immunol. 16, 297– 303. Riese, R.J., Chapman, H.A., 2000. Cathepsins and compartmentalization in antigen presentation. Curr. Opin. Immunol. 12, 107– 113.

R.J. Shaw et al. / International Journal for Parasitology 33 (2003) 1233–1243 Shaw, R.J., Grimmett, D.J., Donaghy, M.J., Gatehouse, T.K., Shirer, C.L., Douch, P.G.C., 1996. Production and characterisation of monoclonal antibodies recognising ovine IgE. Vet. Immunol. Immunopathol. 51, 235–251. Shaw, R.J., Gatehouse, T.K., McNeill, M.M., 1998. Serum IgE responses during primary and challenge infections of sheep with Trichostrongylus colubriformis. Int. J. Parasitol. 28, 293 –302. Shaw, R.J., Morris, C.A., Green, R.S., Wheeler, M., Bisset, S.A., Vlassoff, A., Douch, P.G.C., 1999. Genetic and phenotypic parameters for Trichostrongylus colubriformis-specific immunoglobulin E and its relationships with anti-Trichostrongylus colubriformis antibody, immunoglobulin G1, faecal egg count and body weight traits in grazing Romney. Livest. Prod. Sci. 58, 25–32.

1243

Shevchenko, A., Wilm, M., Vorm, O., Mann, M., 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68, 850–858. Tume, C.B., Ngu, J.L., McKerrow, J.L., Seigel, J., Sun, E., Barr, P.J., Bathurst, I., Morgan, G., Nkenfou, C., Asonganyi, T., Lando, G., 1997. Characterization of a recombinant Onchocerca volvulus antigen (Ov33) produced in yeast. Am. J. Trop. Med. Hyg. 57, 626–633. Willenbucher, J., Hofle, W., Lucius, R., 1993. The filarial antigens Av33/ Ov33-3 show striking similarities to the major pepsin inhibitor from Ascaris suum. Mol. Biochem. Parasitol. 57, 349–351. Wong, C., Sridhara, S., Bardwell, J.C.A., Jakob, U., 2000. Heating greatly speeds Coomassie blue staining and destaining. Biotechniques 28, 426– 432.