- Email: [email protected]
Identification and characterization of the putative retinoblastoma control element of the rat insulin-like growth factor binding protein-2 gene
Cancer Letters 136 (1999) 187±194
Identi®cation and characterization of the putative retinoblastoma control element of the rat insulin-like growth factor binding protein-2 gene Eiji Kutoh*, Jean B. Margot, JuÈrg Schwander 1 Molekulare Endokrinologie, Zentrum fuÈr Lehre und Forschung, Kantonsspital Basel, 4031 Basel, Switzerland Received 29 July 1998; received in revised form 14 October 1998; accepted 15 October 1998
Abstract The authors previously identi®ed a silencer of the rat IGFBP-2 gene. Sequence examination of the silencer has revealed that it contains the target sequence for the pRb (retinoblastoma) tumour suppressor gene, referred to as the retinoblastoma control element (RCE) which is frequently found in the regulatory element of cellular oncogenes and growth factors. The presence of RCE suggests that the IGFBP-2 gene may be regulated by the pRb tumour suppressor gene. An in vitro gel retardation assay has shown that the putative RCEs from the IGFBP-2 gene are complexed with multiple nuclear factors from the rat liver BRL-3A cells. These DNA±protein complexes were not detected with the nuclear extracts from the cells that were growth arrested at the G1/S border of the cell cycle by high cell density. Using speci®c antibodies, Sp1 was shown to be one of the components for the multiple DNA±protein complex while pRb does not appear to be directly involved in the formation of the complex. q 1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Growth factor; Cell cycle; Cancer; Tumour suppressor gene
1. Introduction Insulin-like growth factors (IGFs) are metabolically active, mitogenic and differentiation-inducing polypeptide hormones that share structural homologies with proinsulin. IGFs belong to the category of 'progression' growth factors that in¯uence DNA synthesis of cells that entered the cell cycle by 'competence' growth factors [1]. IGFs bind to speci®c receptors, designated as type 1 and type II receptors * Corresponding author. Present address: Department of Biochemistry, Janssen Research Foundation, B-2340 Beerse, Belgium. Tel.: 1 32-14-605726; fax: 1 32-14-606515; e-mail: [email protected]. 1 Present address: Klinikum fuÈr Schlafmedizin, CH-5330, Zurzach, Switzerland.
(IGF-R). In addition, IGFs are complexed with binding proteins (IGFBPs) in extracellular ¯uids. The af®nity of the IGFBPs for the IGFs is higher than that demonstrated by the IGF receptor. Seven forms of IGFBPs have been puri®ed from serum from human, rat or other mammalian species [2]. IGFBP2 was originally isolated from medium conditioned by the rat liver cell line BRL-3A [3]. In contrast to other IGFBPs, the physiological role of this protein is far from being elucidated. The IGFBP-2 locus was mapped to a 4-megabase pair interval near the insulin-dependent diabetes (IDDM) susceptibility gene (chromosome 2q34) suggesting that it may be a candidate for the diabetes susceptibility gene [4]. Its gene expression is rather interesting. It shows a strict tissue-speci®c and developmental stage
0304-3835/99/$ - see front matter q 1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0304-383 5(98)00321-8
188
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
expression pattern. It is frequently produced by tumour cells, suggesting that IGFBP-2 may be an important modulator in cell growth and tumours [5± 7]. The molecular basis for this tissue-speci®c expression of IGFBP-2 remains elusive. Modulation of transcriptional activity is controlled by factors that either stimulate or repress transcription complex formation. The analysis of DNA±protein interaction suggests that regulation of the transcriptional activity is dependent on the presence of positive and negative regulatory elements. For many genes, the dominant control of speci®c expression is at the level of transcription and depends on binding of trans-acting factors to cis-regulatory DNA sequences, often located in the 5 0 -¯anking region. One possibility of the strict tissue-speci®c expression of the IGFBP-2 gene is the presence of repressor proteins that selectively silence the IGFBP-2 gene. A second possibility is the existence of IGFBP-2 gene selective transactivators. The fact that the IGFBP-2 expression is enhanced in tumour cells may suggest that this gene is regulated by tumour-speci®c transcription factors including oncogenes and tumour suppressor genes. Among the many genetic changes in neoplastic cells, inactivation of tumour suppressor genes plays an important role in the development of human cancer [8]. Retinoblastoma gene product (pRb) was the ®rst tumour suppressor gene identi®ed [9]. Studies have demonstrated that the pRb can either positively or negatively regulate expression of several genes through cis-acting elements in a cell-type-dependent manner through the retinoblastoma control element (RCE) which is present in genes responsible for cell growth and differentiation (Ref. [10] and references therein). Through sequence analysis, two putative retinoblastoma control elements (RCE) have been found in the promoter of the rat IGFBP-2 gene. This work was undertaken to explore the nature of these putative RCEs. Here we report the presence and characterization of cell-cycle dependent nuclear factors interacting with the putative RCEs of the rat IGFBP-2 gene. 2. Materials and methods All the buffers and solutions were prepared and standard techniques were employed according to Sambrook et al. [11].
2.1. Cell culture and preparation of nuclear extracts BRL-3A cells were grown as monolayers in 9-cm dishes at 378C and 5% CO2 in minimal essential medium containing 10% foetal calf serum (FCS), 100 IU/ml penicillin and 100 mg/ml streptomycin (all from Gibco). Nuclear extracts were prepared by 'mini-prep' as described [12]. All the procedures were done on ice and centrifugation was performed in the cold room. Brie¯y, cells were washed with ice-cold PBS (phosphate-buffered saline, pH 7.4), 0.01 M KCl, 0.067 M MgCl2, 0.5 mM PMSF and 0.003% bmercaptoethanol. Cells were centrifuged at 15 000 rev./min for 30 s. The pellet was re-suspended in 80 ml of lysis buffer (HB-buffer 1 0.4% NP-40), incubated on ice for 10 min and centrifuged at 15 000 rev./ min for 5 min. The pellet was re-suspended in 15 ml of 0.02 M KCl buffer containing 0.002 M Tris±Cl (pH 7.4), 20% glycerol (v/v), 0.067 M MgCl2, 0.2 mM EDTA, 0.02 M KCl, 0.5 mM PMSF and 0.003% bmercaptoethanol. Then 0.6 M KCl buffer (same composition as 0.02 M KCl buffer except that 0.6 M KCl was used) was added in a dropwise manner and incubated on ice for 30 min followed by centrifugation at 15 000 rev./min for 15 min. The protein concentration of the supernatant was measured using the Biorad Protein Assay System (approximately 5 mg/ml) and it was stored at 2708C until used. 2.2. Cell cycle analysis After initial plating of cells, they were harvested at different densities and stored at ±708C. The proportion of cells in various cell cycles was determined by FACScan ¯ow cytometer (Becton-Dickinson) using the cycle TEST kit (Beckton Dickinson) and 20 000 cells/determination. The experiment at each cell density was repeated at least twice. 2.3. Gel retardation assays Nuclear extracts or vaccina virus expressed Sp1 (Promega) were assayed for in vitro DNA-binding analysis. The oligonucleotide sequences used were: TTGGGGGCCGAGTGTGTGTTGGGGTGGGCG (NRE1) CTCGTGGGGTGGAGG (NRE2)
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
189
TTGGGGGCCGAGTGTGTGTTGGttTGGGCG (mNRE1) CTCGTGGttTGGAGG (mNRE2) (mutations are shown with lower-case letters) CCCGCGCGCCACCCCTCT (c-fos) CTTTTCCCCCACGCCCTCTGCTTTGGG (cmyc) TCTTCACCTTATTTGCATAAGCG (oct) TGATCGATCGGGGCGGGGCGATG (Sp1) Hind III (5 0 end) and Bam HI (3 0 end) restriction sites were added to each end. One picomole of each doubled stranded oligonucleotide was labelled with the Klenow fragment of DNA polymerase 1 and a- 32P dCTPs. Binding reactions of 20 ml were carried out in buffer containing 10 mM Hepes (pH 7.9), 2.5 mM MgCl2, 10% (v/v) glycerol, 1 mM DDT, 1 mg of Poly(dIdC), 50 mM KCl, 2.5 fmol radio-labelled oligonucleotides and 1 ml of nuclear extract (protein concentration 5 mg/ml) or puri®ed Sp1 (0.5 fpu according to the manufacturer's protocol). Competitors (unlabelled probes) were added at the same time as radiolabelled probes. When pRb or Sp1 antibody (Santa Cruz, 1 mg/ml IgG for the super-shift product) was used, 1 mg of IgG was preincubated with 1 ml of nuclear extract on ice for 1 h. Reactions were incubated at room temperature for 15 min. Free and bound DNA were separated on non-denaturing 4% polyacrylamide (acrylamide/bis 29:1, cross-linked) gels (1 £ TBE). The gels were dried and analysed by autoradiography. In some experiments, the intensity of the DNA±protein complex was quanti®ed using computer scanner (ImageQuant; Molecular Dynamics).
Fig. 2. In vitro DNA binding assays: multiple nuclear factors are complexed with NRE1 and NRE2. Each 32P-labelled doublestranded oligonucleotide (NRE1 and NRE2) was incubated with 1 ml of nuclear extract from BRL-3A cells, followed by gel retardation assays as described in Section 2. DNA±protein complexes formed are shown with solid arrows (1, 2, 3, a, b, and c, respectively). Non-speci®c binding is shown with a dotted arrow. Free probes (unbound) are shown at the bottom.
3. Results 3.1. Identi®cation of multiple nuclear factor(s) within the silencer domain Fig. 1. In vitro DNA binding assays. RCEs (retinoblastoma control elements) The consensus sequences for the RCE in indicated genes are underlined.
Previously we identi®ed an element that has an inhibitory effect on transcription [12]. Given the background that sequence-speci®c factors play an impor-
190
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
Fig. 3. In vitro DNA binding assays: the speci®city of the DNA±protein complexes. The speci®city of the DNA±protein complex was analysed by DNA competition experiments using either a 100-fold molar excess of an unlabelled NRE1, NRE2, c-fos, octamer (A), mNRE1 and mNRE2 (B). Free probes are shown at the bottom. The DNA±protein complex is shown with an arrow.
tant role in the modulation of transcriptional activity, we were interested in testing whether any nuclear factor(s) could interact within the area (2916 to 2579, see Ref. [12]). Sequence examination of this region has revealed that it contains target sequences for pRb termed RCEs (retinoblastoma control elements) which have been found in the promoter regions of a number of growth factor genes [13]. pRb is able to regulate transcription of the c-fos, cmyc, and transforming growth factor b (TGF-b) promoters through the RCE in transient assays in either a positive or negative manner, dependent upon the cell type [13]. For a sequential summary of RECs, see Fig. 1. NRE1 and NRE2 of the rat IGFBP-2 have identical RCEs which have been identi®ed in the c-myc (for NRE1, see Fig. 1) and TGF-b promoter (for NRE2, see Fig. 1). Recently Horowitz's group identi®ed three nuclear proteins (retinoblastoma control proteins termed RCPs) that complex with the
promoter summarized in Fig. 1 [13]. NRE1 and NRE2 were radiolabelled and gel-retardation assay was performed with the nuclear extracts of rat liver BRL-3A cells that express IGFBP-2. As shown in Fig. 2, multiple nuclear factors were complexed with these elements. To address the speci®city of the DNA±protein complex, we performed a competition analysis using 100-fold excess unlabelled indicated oligonucleotides (Figs. 3A,3B). The excess amounts of the NRE1 or NRE2 (self) and c-fos oligonucleotide (Fig. 1) competed ef®ciently for the binding (Fig. 3A). On the other hand, the octamer sequence from the histon H2B or mutated NRE1 or NRE2 did not interfere with the binding (Figs. 3A,3B). This experiment established that these DNA±protein complexes were speci®c and were the same or related to those formed with the c-fos RCE [14]. We previously reported that the growth arrest of the
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
191
Table 1 The proportion of cells in the G1 or S phase at medium and high density was determined using the FACScan system as described in Section 2. The given percentages correspond to the means at least two independent experiments Cell number 5
2±3 £ 10 (low) 3 £ 106 (medium) 4±5 £ 107 (high)
% in G1
% in S
20 35 78
75 55 16
cells at the G1/S border by high cell density had a dramatic effect on IGFBP-2 expression. In highdensity cells, signi®cantly higher amounts of the message (mRNA or protein) were obtained compared to the low-density cells [15]. As shown in Table 1, cells in high density are growth arrested at the G1/S border. Given this background, we were interested in testing whether the nuclear factors interacting with NRE1 and NRE2 are also in¯uenced by cell density (cycle). Nuclear extracts from highly con¯uent (100%; ,10 £ 104 cells/cm 2) or sub-con¯uent (75%;
Fig. 5. In vitro DNA binding assays: Sp1 can bind to the NRE1 and NRE2. Each 32P-labelled double-stranded probe was incubated with 1 ml of nuclear extract from BRL-3A cells or 0.5 fpu (according to the manufacturer's protocol) of puri®ed Sp1, followed by gel retardation assays as described in Section 2.
,7:5 £ 104 cells/cm 2) cells were prepared and in vitro gel retardation assays were performed using these extracts, and NRE1 or NRE2. The octamer-dependent DNA binding activity was slightly higher in the highdensity cells than that in sub-con¯uent cells. However, in contrast to this, very little, if any, DNA binding activity with NRE1 and NRE2 was observed in the high density cells (Fig. 4). 3.2. Sp1 but not pRb is one of the components for the DNA±protein complex
Fig. 4. In vitro DNA binding assays: cell-density dependence of the DNA±protein complexes. Equal amounts of proteins (approximately 5 mg) of nuclear extracts from high density (high; , 10 £ 104 cells/cm 2) or sub-con¯uent (sub; , 7:5 £ 104 cels/cm 2) cells were incubated with 32P-labelled NRE1 or NRE2. The DNA± protein complex formed is shown with an arrow.
Sp1 was reported to interact with RCEs from c-myc, c-fos, and TGF-b genes [13]. To test whether Sp1 could also bind to NRE1 and NRE2, we performed gel retardation assays employing puri®ed Sp1 protein (Fig. 5). This result established that Sp1 could interact with the NRE1 and NRE2 with lower af®nity compared to the consensus Sp1 sequence from the SV40 promoter [13]. We, then, performed the same gel retardation assay employing the nuclear extracts from the BRL-3A cells and calculated the ratio of the intensity of the DNA±protein complex (nuclear extracts/puri®ed Sp1) in each probe using the computer scanner as described in Section 2. Five- to 6-fold higher intensity was observed with NRE1 and 3- to 4-fold with NRE2 versus Sp1 in two independent experiments (Table 2). These results support our previous results (Fig. 2) that multiple factors are complexed with the NRE1 and NRE2. To test the possibility that pRb is directly bound to the RCE or RCPs, we used antibody raised against pRb in the gel retardation assay (Fig. 6) using the c-
192
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
Table 2 The intensity of the DNA±protein complex was monitored by the computer scanner (ImageQuant; Molecular Dynamics) and the ratio of the intensity of the DNA±protein complex of nuclear extracts (NE) versus Sp1 (Fig. 5) was calculated
NRE1 NRE2
NRE2 (Fig. 6A). In contrast, neither Sp1 nor pRb antibody had any effect on the octamer binding (Fig. 6B).
Ratio (fold)
4. Discussion
5±6 3±4
4.1. Nuclear factor(s) interacting within the NRE
myc (Fig. 1), NRE1, NRE2, octamer sequence and Sp1 sequence. In advance, we had checked that BRL-3A cells contain signi®cant amount of pRb or Sp1 protein by Western blot and the speci®city of the antibody (results not shown). These antibodies were shown to be speci®c and were designed for the supershift experiment (Santa Cruz). pRb antibody had no effect on the DNA±protein complex with any DNA oligonucleotide tested including the established RCE from the c-myc promoter, NRE1 or NRE2 (see Figs. 6A and 6B). In contrast, Sp1 antibody formed a super-shift with the consensus Sp1 element (Fig. 6A) or c-myc promoter (Fig. 6B) and inhibited the binding to the NRE1 and
In this work we have identi®ed and characterized the two elements (2778 to 2752 and 2701 to 2687) located in the silencer domain of the rat IGFBP-2 gene [12]. They are complexed to multiple nuclear factors from rat liver BRL-3A cells (Fig. 2 and Table 2). Interestingly nuclear extracts prepared from the growth-arrested cells at the G1/S border of the cell cycle failed to form complexes with these elements (Fig. 4). This result might support the idea that the multiple factor(s) complexed with the NRE1 or NRE2 are really suppressors that are not present in such a condition (high-density cells) where the high amount of the IGFBP-2 message is expressed. Cell-cycledependent modulation of transcription factors may be an important observation that factors responsible for cell growth and differentiation (e.g. cyclin-dependent kinase) are regulated by such transcription factors. Further biochemical analysis will be required to clarify these nuclear factors observed in this work. In addition, in order to demonstrate that NRE1 and NRE2 are potentially involved in the overall negative regulation of the IGFBP-2 gene, reporter gene assays containing these elements can be performed. 4.2. Is pRb directly involved in RCE?
Fig. 6. In vitro DNA binding assays: immunological properties of the RCE±protein complex. Each 32P-labelled double-stranded probe (B: c-myc and Oct; A: NRE1, NRE2 and Sp1) was incubated with 1 ml of nuclear extract from BRL-3A cells that were pre-treated with or without antibody (1 mg) raised against the c-terminal of pRb or Sp1 (Santa Cruz), followed by gel retardation assays. The supershifted band is shown with an asterisk.
Moreover, these two elements contain the sequence termed the RCE (retinoblastoma control element). The Rb gene located in human chromosome 13, encodes a nuclear phosphoprotein (pRb). The pRb negatively regulates cell growth in the G1 phase [16]. These actions are mediated through the RCE. As reported by Pietenpol et al. [17], the c-myc RCE is capable of forming multiple DNA±protein complexes in vitro with cellular factors. In this report, they have argued the possibility that pRb directly binds to the RCE present in the c-myc promoter. They reported that no binding of the RCE oligonucleotide was obtained with cellular extracts co-precipitated with antibodies against pRb. Furthermore,
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
they have carried out in vitro DNA binding assay with cell extracts isolated from cells with a defective Rb gene in comparison to extracts from cells with an intact Rb gene. They reported greatly diminished RCE binding in the Rb-defective cells. These results disagree with the report by Kim et al. [14] that no difference in DNA±protein complexes was seen either from Rb-de®cient or Rb-intact cells. Our data (Figs. 6A,6B) and that of others [13,14] show that pRb does not appear to be directly bound to RCEs nor associated with the RCPs (RCE binding proteins), suggesting the possibility that the action of pRb through the RCE is mediated by other factor(s). On the other hand, we have supported data suggesting that Sp1 interacts with RCEs [13,14]. Sp1 antibodies gave a super-shift in the gel retardation assay experiments using the consensus Sp1 or c-myc probe. However, employing the NRE1 or NRE2 probe, Sp1 antibodies inhibited the binding and no clear super-shift was observed. If multiple factors are complexed with NRE1 or NRE2, they might change the conformation of the Sp1 protein; hence, it displayed a different pattern compared to the consensus Sp1 or c-myc probe. In an effort to identify a functional role of pRb in the IGFBP-2 expression, pRb expression vector (pHuRb, [18]) was co-transfected with the IGFBP-2 promoter fused with the CAT reporter gene. However, we failed to obtain consistent results in this experiment (results not shown). One explanation for this inconsistent result is that the pRb is a constitutively expressed protein. We observed that it is also present in the nuclear extracts of BRL-3A cells by Westernblot analysis (results not shown). It is, therefore, conceivable that the level of pRb is already saturated in this cell and exogenously expressed pRb plays no role. To address this point, an in vitro transcription experiment using the pRb depleted nuclear extracts (e.g. by immunoprecipitation) could be considered. Loss of Rb function, through deletion or mutational inactivation of the Rb gene, is associated with the genesis of a subset of human cancers, including retinoblastoma, osteosarcoma, small cell lung, bladder, and breast carcinomas [16]. In many cancers, IGFBP-2 protein production is increased [5±7]. pRb is phosphorylated in a cell cycle-regulated manner. In cells in early to mid G1, the vast majority of pRb is unphosphorylated. From late G1 to the onset of DNA
193
synthesis (S phase), it is phosphorylated by cyclindependent kinases. It exerts its growth inhibition activity under an unphosphorylated form [16]. Thus, another explanation for the inconsistent result of the pRb co-transfection study mentioned above is that transfection was done to the cells where the pRb is inactive (phosphorylated form at the late G1 phase). As has been shown, the expression of IGFBP-2 (both mRNA and protein) is highly elevated at the G1/S border [15,19,20] where pRb is phosphorylated and inactive. Thus, this evidence might argue that pRb negatively regulates the IGFBP-2 gene expression. During the preparation of this manuscript, it was reported that induction of IGFBP-3 gene expression by p53, another tumour suppressor gene, is associated with enhanced secretion of an active form of IGFBP3, which functions as a negative regulator of the action of IGF [21]. Thus, it is conceivable that the IGF system in general is regulated by the tumour suppressor genes. Recent evidence suggests that the IGF-signalling pathway is required both for cell growth and tumorigenesis [1]. Therefore, therapeutics that interfere with this signalling pathway may be useful in the treatment of cancer. Further studies of IGFBPs as regards the dependence or independence from the IGF signalling pathway might shed light on cancer research. Acknowledgements The authors thank Drs. Jean-Luc Mary, Paul Robbins, Jonathan Horowitz, Ron Ninnis, Jean-Paul Giacobino, Alan Richardson and Didier de Chaffoy for discussions and Nicolas Ongenae, An Claeskens and Katja de Waepenaert for the preparation of the manuscript. This work was supported by the Schweizerische National Fond No. 32-31026.91 and 3206037314.93. References [1] R. Baserga, The insulin-like growth factor I receptor: a key to tumor growth?, Cancer Res. 55 (1995) 249±252. [2] S Rajaram, D.J. Baylink, S. Mohan, Insulin-like growth factor-binding proteins in serum and other biological ¯uids: regulation and functions, Endocrine Rev. 8(6) (1997) 801± 831.
194
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
[3] C. Mottola, R. MacDonald, J. Brackett, J. Mole, J. Anderson, M. Czech, Puri®cation and amino-terminal sequence of an insulin-like growth factor binding protein secreted by rat liver BRL-3A cells, J. Biol. Chem. 261 (1986) 11180±11188. [4] G. Morahan, D. Huang, B.D. Tait, P.G. Colman, L.C. Harrison, Markers on distal chromosome 2q linked to insulin-dependent diabetes mellitus, Science 272(21) (1996) 1811±1813. [5] J. Schwander, J.-L. Mary, The RIA for IGFBP-2 in man- a meagre catch?, Growth 3 (1993) 104±108. [6] J.G. Reeve, J. Morgan, J. Schwander, N.M. Bleehen, Role for membrane and secreted insulin-like growth factor-binding protein-2 in the regulation of insulin-like growth factor action in lung tumors, Cancer Res. 53 (1993) 4680±4685. [7] M.W. Elmlinger, K. Wimmer, E. Biemer, L. Dannecker, W.F. Blum, M.B. Ranke, G.E. Dannecker, Insulin-like growth factor binding protein 2 is differentially expressed in leukemic B- and T-cell lines, Growth Reg. 6 (1996) 152±157. [8] R.A. Weinberg, Oncogenes, anti-oncogenes and the molecular basis of multistep carcinogenesis, Cancer Res. 49 (1989) 3713±3721. [9] S.H. Friend, R. Bernards, S. Rogeji, R.A. Weinberg, J.M. Rapport, D.M. Albert, T.P. Dryja, A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteocarcinoma, Nature 323 (1986) 643±646. [10] G. Mulligan, T. Jacks, The retinoblastoma gene family: cousins with overlapping interests, Trends Genet. 6 (1998) 223±229. [11] J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd, 1989. [12] J. Schwander, E. Kutoh, J.-L. Mary, L. Ritz, The gene regulation of insulin-like growth factor binding protein-2 (IGFBP2), in: Baxter (Ed.), Elsevier, Amsterdam, 1994, pp. 151. [13] A. Udvadia, K. Rogers, P. Higgins, Y. Murata, K. Martin, P.
[14]
[15] [16] [17]
[18] [19]
[20]
[21]
Humphrey, J. Horowitz, A common set of nuclear factors bind to promoter elements regulated by the retinoblastoma protein, Proc. Natl. Acad. Sci. USA 90 (1993) 3265±3269. S. Kim, U. Onwuta, Y. Lee, R. Li, M.R. Botchman, P.D. Robbins, The retinoblastoma gene product regulates Sp1 mediated transcription. Mol. Cell. Biol. 12 (1992) 2455± 2463. E. Kutoh, J. Schwander, J. Margot, Cell density-dependent modulation of the rat insulin-like growth factor binding protein-2 and its gene, Eur. J. Biochem. 234 (1995) 557±562. R.A. Weinberg, The retinoblastoma protein and cell cycle control, Cell 81 (1995) 323±330. J. A. Pientenpol, K. MuÈnger, P. Howley, R. Stein, H. Moses, Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor beta 1 and by the retinoblastoma gene product, Proc. Natl. Acad. Sci. USA 88 (1991) 10227±10231. P. Robbins, J. Horowitz, R. Mulligan, Negative regulation of human c-fos expression by the retinoblastoma gene product, Nature 346 (1990) 668±671. V. Cazals, B. Mouhieddine, B. Maittre, Y. Le Bouc, K.. Chadelat, J. Brondy, A. Clement, Insulin-like growth factor, their binding proteins, and transforming growth factor-b1 in oxidant-arrested lung alveolar epithelial cells, J. Biol. Chem. 269 (1994) 14111±14117. O.B. Mouhieddine, V. Cazals, E. Kuto, Y. Le Bouc, A. Clement, Glucocorticoid-induced growth arrest of lung alveolar epithelial cells is associated with increased production of insulin-like growth factor binding protein-2, Endocrinology 137 (1996) 287±295. L. Buckbinder, R. Talbott, S. Velasco-Miguel, I. Takenaka, B. Faha, B.R. Seizinger, N. Kley, Induction of the growth inhibitor IGF-binding protein 3 by p53, Nature 377 (1995) 646± 649.
Identi®cation and characterization of the putative retinoblastoma control element of the rat insulin-like growth factor binding protein-2 gene Eiji Kutoh*, Jean B. Margot, JuÈrg Schwander 1 Molekulare Endokrinologie, Zentrum fuÈr Lehre und Forschung, Kantonsspital Basel, 4031 Basel, Switzerland Received 29 July 1998; received in revised form 14 October 1998; accepted 15 October 1998
Abstract The authors previously identi®ed a silencer of the rat IGFBP-2 gene. Sequence examination of the silencer has revealed that it contains the target sequence for the pRb (retinoblastoma) tumour suppressor gene, referred to as the retinoblastoma control element (RCE) which is frequently found in the regulatory element of cellular oncogenes and growth factors. The presence of RCE suggests that the IGFBP-2 gene may be regulated by the pRb tumour suppressor gene. An in vitro gel retardation assay has shown that the putative RCEs from the IGFBP-2 gene are complexed with multiple nuclear factors from the rat liver BRL-3A cells. These DNA±protein complexes were not detected with the nuclear extracts from the cells that were growth arrested at the G1/S border of the cell cycle by high cell density. Using speci®c antibodies, Sp1 was shown to be one of the components for the multiple DNA±protein complex while pRb does not appear to be directly involved in the formation of the complex. q 1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Growth factor; Cell cycle; Cancer; Tumour suppressor gene
1. Introduction Insulin-like growth factors (IGFs) are metabolically active, mitogenic and differentiation-inducing polypeptide hormones that share structural homologies with proinsulin. IGFs belong to the category of 'progression' growth factors that in¯uence DNA synthesis of cells that entered the cell cycle by 'competence' growth factors [1]. IGFs bind to speci®c receptors, designated as type 1 and type II receptors * Corresponding author. Present address: Department of Biochemistry, Janssen Research Foundation, B-2340 Beerse, Belgium. Tel.: 1 32-14-605726; fax: 1 32-14-606515; e-mail: [email protected]. 1 Present address: Klinikum fuÈr Schlafmedizin, CH-5330, Zurzach, Switzerland.
(IGF-R). In addition, IGFs are complexed with binding proteins (IGFBPs) in extracellular ¯uids. The af®nity of the IGFBPs for the IGFs is higher than that demonstrated by the IGF receptor. Seven forms of IGFBPs have been puri®ed from serum from human, rat or other mammalian species [2]. IGFBP2 was originally isolated from medium conditioned by the rat liver cell line BRL-3A [3]. In contrast to other IGFBPs, the physiological role of this protein is far from being elucidated. The IGFBP-2 locus was mapped to a 4-megabase pair interval near the insulin-dependent diabetes (IDDM) susceptibility gene (chromosome 2q34) suggesting that it may be a candidate for the diabetes susceptibility gene [4]. Its gene expression is rather interesting. It shows a strict tissue-speci®c and developmental stage
0304-3835/99/$ - see front matter q 1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0304-383 5(98)00321-8
188
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
expression pattern. It is frequently produced by tumour cells, suggesting that IGFBP-2 may be an important modulator in cell growth and tumours [5± 7]. The molecular basis for this tissue-speci®c expression of IGFBP-2 remains elusive. Modulation of transcriptional activity is controlled by factors that either stimulate or repress transcription complex formation. The analysis of DNA±protein interaction suggests that regulation of the transcriptional activity is dependent on the presence of positive and negative regulatory elements. For many genes, the dominant control of speci®c expression is at the level of transcription and depends on binding of trans-acting factors to cis-regulatory DNA sequences, often located in the 5 0 -¯anking region. One possibility of the strict tissue-speci®c expression of the IGFBP-2 gene is the presence of repressor proteins that selectively silence the IGFBP-2 gene. A second possibility is the existence of IGFBP-2 gene selective transactivators. The fact that the IGFBP-2 expression is enhanced in tumour cells may suggest that this gene is regulated by tumour-speci®c transcription factors including oncogenes and tumour suppressor genes. Among the many genetic changes in neoplastic cells, inactivation of tumour suppressor genes plays an important role in the development of human cancer [8]. Retinoblastoma gene product (pRb) was the ®rst tumour suppressor gene identi®ed [9]. Studies have demonstrated that the pRb can either positively or negatively regulate expression of several genes through cis-acting elements in a cell-type-dependent manner through the retinoblastoma control element (RCE) which is present in genes responsible for cell growth and differentiation (Ref. [10] and references therein). Through sequence analysis, two putative retinoblastoma control elements (RCE) have been found in the promoter of the rat IGFBP-2 gene. This work was undertaken to explore the nature of these putative RCEs. Here we report the presence and characterization of cell-cycle dependent nuclear factors interacting with the putative RCEs of the rat IGFBP-2 gene. 2. Materials and methods All the buffers and solutions were prepared and standard techniques were employed according to Sambrook et al. [11].
2.1. Cell culture and preparation of nuclear extracts BRL-3A cells were grown as monolayers in 9-cm dishes at 378C and 5% CO2 in minimal essential medium containing 10% foetal calf serum (FCS), 100 IU/ml penicillin and 100 mg/ml streptomycin (all from Gibco). Nuclear extracts were prepared by 'mini-prep' as described [12]. All the procedures were done on ice and centrifugation was performed in the cold room. Brie¯y, cells were washed with ice-cold PBS (phosphate-buffered saline, pH 7.4), 0.01 M KCl, 0.067 M MgCl2, 0.5 mM PMSF and 0.003% bmercaptoethanol. Cells were centrifuged at 15 000 rev./min for 30 s. The pellet was re-suspended in 80 ml of lysis buffer (HB-buffer 1 0.4% NP-40), incubated on ice for 10 min and centrifuged at 15 000 rev./ min for 5 min. The pellet was re-suspended in 15 ml of 0.02 M KCl buffer containing 0.002 M Tris±Cl (pH 7.4), 20% glycerol (v/v), 0.067 M MgCl2, 0.2 mM EDTA, 0.02 M KCl, 0.5 mM PMSF and 0.003% bmercaptoethanol. Then 0.6 M KCl buffer (same composition as 0.02 M KCl buffer except that 0.6 M KCl was used) was added in a dropwise manner and incubated on ice for 30 min followed by centrifugation at 15 000 rev./min for 15 min. The protein concentration of the supernatant was measured using the Biorad Protein Assay System (approximately 5 mg/ml) and it was stored at 2708C until used. 2.2. Cell cycle analysis After initial plating of cells, they were harvested at different densities and stored at ±708C. The proportion of cells in various cell cycles was determined by FACScan ¯ow cytometer (Becton-Dickinson) using the cycle TEST kit (Beckton Dickinson) and 20 000 cells/determination. The experiment at each cell density was repeated at least twice. 2.3. Gel retardation assays Nuclear extracts or vaccina virus expressed Sp1 (Promega) were assayed for in vitro DNA-binding analysis. The oligonucleotide sequences used were: TTGGGGGCCGAGTGTGTGTTGGGGTGGGCG (NRE1) CTCGTGGGGTGGAGG (NRE2)
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
189
TTGGGGGCCGAGTGTGTGTTGGttTGGGCG (mNRE1) CTCGTGGttTGGAGG (mNRE2) (mutations are shown with lower-case letters) CCCGCGCGCCACCCCTCT (c-fos) CTTTTCCCCCACGCCCTCTGCTTTGGG (cmyc) TCTTCACCTTATTTGCATAAGCG (oct) TGATCGATCGGGGCGGGGCGATG (Sp1) Hind III (5 0 end) and Bam HI (3 0 end) restriction sites were added to each end. One picomole of each doubled stranded oligonucleotide was labelled with the Klenow fragment of DNA polymerase 1 and a- 32P dCTPs. Binding reactions of 20 ml were carried out in buffer containing 10 mM Hepes (pH 7.9), 2.5 mM MgCl2, 10% (v/v) glycerol, 1 mM DDT, 1 mg of Poly(dIdC), 50 mM KCl, 2.5 fmol radio-labelled oligonucleotides and 1 ml of nuclear extract (protein concentration 5 mg/ml) or puri®ed Sp1 (0.5 fpu according to the manufacturer's protocol). Competitors (unlabelled probes) were added at the same time as radiolabelled probes. When pRb or Sp1 antibody (Santa Cruz, 1 mg/ml IgG for the super-shift product) was used, 1 mg of IgG was preincubated with 1 ml of nuclear extract on ice for 1 h. Reactions were incubated at room temperature for 15 min. Free and bound DNA were separated on non-denaturing 4% polyacrylamide (acrylamide/bis 29:1, cross-linked) gels (1 £ TBE). The gels were dried and analysed by autoradiography. In some experiments, the intensity of the DNA±protein complex was quanti®ed using computer scanner (ImageQuant; Molecular Dynamics).
Fig. 2. In vitro DNA binding assays: multiple nuclear factors are complexed with NRE1 and NRE2. Each 32P-labelled doublestranded oligonucleotide (NRE1 and NRE2) was incubated with 1 ml of nuclear extract from BRL-3A cells, followed by gel retardation assays as described in Section 2. DNA±protein complexes formed are shown with solid arrows (1, 2, 3, a, b, and c, respectively). Non-speci®c binding is shown with a dotted arrow. Free probes (unbound) are shown at the bottom.
3. Results 3.1. Identi®cation of multiple nuclear factor(s) within the silencer domain Fig. 1. In vitro DNA binding assays. RCEs (retinoblastoma control elements) The consensus sequences for the RCE in indicated genes are underlined.
Previously we identi®ed an element that has an inhibitory effect on transcription [12]. Given the background that sequence-speci®c factors play an impor-
190
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
Fig. 3. In vitro DNA binding assays: the speci®city of the DNA±protein complexes. The speci®city of the DNA±protein complex was analysed by DNA competition experiments using either a 100-fold molar excess of an unlabelled NRE1, NRE2, c-fos, octamer (A), mNRE1 and mNRE2 (B). Free probes are shown at the bottom. The DNA±protein complex is shown with an arrow.
tant role in the modulation of transcriptional activity, we were interested in testing whether any nuclear factor(s) could interact within the area (2916 to 2579, see Ref. [12]). Sequence examination of this region has revealed that it contains target sequences for pRb termed RCEs (retinoblastoma control elements) which have been found in the promoter regions of a number of growth factor genes [13]. pRb is able to regulate transcription of the c-fos, cmyc, and transforming growth factor b (TGF-b) promoters through the RCE in transient assays in either a positive or negative manner, dependent upon the cell type [13]. For a sequential summary of RECs, see Fig. 1. NRE1 and NRE2 of the rat IGFBP-2 have identical RCEs which have been identi®ed in the c-myc (for NRE1, see Fig. 1) and TGF-b promoter (for NRE2, see Fig. 1). Recently Horowitz's group identi®ed three nuclear proteins (retinoblastoma control proteins termed RCPs) that complex with the
promoter summarized in Fig. 1 [13]. NRE1 and NRE2 were radiolabelled and gel-retardation assay was performed with the nuclear extracts of rat liver BRL-3A cells that express IGFBP-2. As shown in Fig. 2, multiple nuclear factors were complexed with these elements. To address the speci®city of the DNA±protein complex, we performed a competition analysis using 100-fold excess unlabelled indicated oligonucleotides (Figs. 3A,3B). The excess amounts of the NRE1 or NRE2 (self) and c-fos oligonucleotide (Fig. 1) competed ef®ciently for the binding (Fig. 3A). On the other hand, the octamer sequence from the histon H2B or mutated NRE1 or NRE2 did not interfere with the binding (Figs. 3A,3B). This experiment established that these DNA±protein complexes were speci®c and were the same or related to those formed with the c-fos RCE [14]. We previously reported that the growth arrest of the
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
191
Table 1 The proportion of cells in the G1 or S phase at medium and high density was determined using the FACScan system as described in Section 2. The given percentages correspond to the means at least two independent experiments Cell number 5
2±3 £ 10 (low) 3 £ 106 (medium) 4±5 £ 107 (high)
% in G1
% in S
20 35 78
75 55 16
cells at the G1/S border by high cell density had a dramatic effect on IGFBP-2 expression. In highdensity cells, signi®cantly higher amounts of the message (mRNA or protein) were obtained compared to the low-density cells [15]. As shown in Table 1, cells in high density are growth arrested at the G1/S border. Given this background, we were interested in testing whether the nuclear factors interacting with NRE1 and NRE2 are also in¯uenced by cell density (cycle). Nuclear extracts from highly con¯uent (100%; ,10 £ 104 cells/cm 2) or sub-con¯uent (75%;
Fig. 5. In vitro DNA binding assays: Sp1 can bind to the NRE1 and NRE2. Each 32P-labelled double-stranded probe was incubated with 1 ml of nuclear extract from BRL-3A cells or 0.5 fpu (according to the manufacturer's protocol) of puri®ed Sp1, followed by gel retardation assays as described in Section 2.
,7:5 £ 104 cells/cm 2) cells were prepared and in vitro gel retardation assays were performed using these extracts, and NRE1 or NRE2. The octamer-dependent DNA binding activity was slightly higher in the highdensity cells than that in sub-con¯uent cells. However, in contrast to this, very little, if any, DNA binding activity with NRE1 and NRE2 was observed in the high density cells (Fig. 4). 3.2. Sp1 but not pRb is one of the components for the DNA±protein complex
Fig. 4. In vitro DNA binding assays: cell-density dependence of the DNA±protein complexes. Equal amounts of proteins (approximately 5 mg) of nuclear extracts from high density (high; , 10 £ 104 cells/cm 2) or sub-con¯uent (sub; , 7:5 £ 104 cels/cm 2) cells were incubated with 32P-labelled NRE1 or NRE2. The DNA± protein complex formed is shown with an arrow.
Sp1 was reported to interact with RCEs from c-myc, c-fos, and TGF-b genes [13]. To test whether Sp1 could also bind to NRE1 and NRE2, we performed gel retardation assays employing puri®ed Sp1 protein (Fig. 5). This result established that Sp1 could interact with the NRE1 and NRE2 with lower af®nity compared to the consensus Sp1 sequence from the SV40 promoter [13]. We, then, performed the same gel retardation assay employing the nuclear extracts from the BRL-3A cells and calculated the ratio of the intensity of the DNA±protein complex (nuclear extracts/puri®ed Sp1) in each probe using the computer scanner as described in Section 2. Five- to 6-fold higher intensity was observed with NRE1 and 3- to 4-fold with NRE2 versus Sp1 in two independent experiments (Table 2). These results support our previous results (Fig. 2) that multiple factors are complexed with the NRE1 and NRE2. To test the possibility that pRb is directly bound to the RCE or RCPs, we used antibody raised against pRb in the gel retardation assay (Fig. 6) using the c-
192
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
Table 2 The intensity of the DNA±protein complex was monitored by the computer scanner (ImageQuant; Molecular Dynamics) and the ratio of the intensity of the DNA±protein complex of nuclear extracts (NE) versus Sp1 (Fig. 5) was calculated
NRE1 NRE2
NRE2 (Fig. 6A). In contrast, neither Sp1 nor pRb antibody had any effect on the octamer binding (Fig. 6B).
Ratio (fold)
4. Discussion
5±6 3±4
4.1. Nuclear factor(s) interacting within the NRE
myc (Fig. 1), NRE1, NRE2, octamer sequence and Sp1 sequence. In advance, we had checked that BRL-3A cells contain signi®cant amount of pRb or Sp1 protein by Western blot and the speci®city of the antibody (results not shown). These antibodies were shown to be speci®c and were designed for the supershift experiment (Santa Cruz). pRb antibody had no effect on the DNA±protein complex with any DNA oligonucleotide tested including the established RCE from the c-myc promoter, NRE1 or NRE2 (see Figs. 6A and 6B). In contrast, Sp1 antibody formed a super-shift with the consensus Sp1 element (Fig. 6A) or c-myc promoter (Fig. 6B) and inhibited the binding to the NRE1 and
In this work we have identi®ed and characterized the two elements (2778 to 2752 and 2701 to 2687) located in the silencer domain of the rat IGFBP-2 gene [12]. They are complexed to multiple nuclear factors from rat liver BRL-3A cells (Fig. 2 and Table 2). Interestingly nuclear extracts prepared from the growth-arrested cells at the G1/S border of the cell cycle failed to form complexes with these elements (Fig. 4). This result might support the idea that the multiple factor(s) complexed with the NRE1 or NRE2 are really suppressors that are not present in such a condition (high-density cells) where the high amount of the IGFBP-2 message is expressed. Cell-cycledependent modulation of transcription factors may be an important observation that factors responsible for cell growth and differentiation (e.g. cyclin-dependent kinase) are regulated by such transcription factors. Further biochemical analysis will be required to clarify these nuclear factors observed in this work. In addition, in order to demonstrate that NRE1 and NRE2 are potentially involved in the overall negative regulation of the IGFBP-2 gene, reporter gene assays containing these elements can be performed. 4.2. Is pRb directly involved in RCE?
Fig. 6. In vitro DNA binding assays: immunological properties of the RCE±protein complex. Each 32P-labelled double-stranded probe (B: c-myc and Oct; A: NRE1, NRE2 and Sp1) was incubated with 1 ml of nuclear extract from BRL-3A cells that were pre-treated with or without antibody (1 mg) raised against the c-terminal of pRb or Sp1 (Santa Cruz), followed by gel retardation assays. The supershifted band is shown with an asterisk.
Moreover, these two elements contain the sequence termed the RCE (retinoblastoma control element). The Rb gene located in human chromosome 13, encodes a nuclear phosphoprotein (pRb). The pRb negatively regulates cell growth in the G1 phase [16]. These actions are mediated through the RCE. As reported by Pietenpol et al. [17], the c-myc RCE is capable of forming multiple DNA±protein complexes in vitro with cellular factors. In this report, they have argued the possibility that pRb directly binds to the RCE present in the c-myc promoter. They reported that no binding of the RCE oligonucleotide was obtained with cellular extracts co-precipitated with antibodies against pRb. Furthermore,
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
they have carried out in vitro DNA binding assay with cell extracts isolated from cells with a defective Rb gene in comparison to extracts from cells with an intact Rb gene. They reported greatly diminished RCE binding in the Rb-defective cells. These results disagree with the report by Kim et al. [14] that no difference in DNA±protein complexes was seen either from Rb-de®cient or Rb-intact cells. Our data (Figs. 6A,6B) and that of others [13,14] show that pRb does not appear to be directly bound to RCEs nor associated with the RCPs (RCE binding proteins), suggesting the possibility that the action of pRb through the RCE is mediated by other factor(s). On the other hand, we have supported data suggesting that Sp1 interacts with RCEs [13,14]. Sp1 antibodies gave a super-shift in the gel retardation assay experiments using the consensus Sp1 or c-myc probe. However, employing the NRE1 or NRE2 probe, Sp1 antibodies inhibited the binding and no clear super-shift was observed. If multiple factors are complexed with NRE1 or NRE2, they might change the conformation of the Sp1 protein; hence, it displayed a different pattern compared to the consensus Sp1 or c-myc probe. In an effort to identify a functional role of pRb in the IGFBP-2 expression, pRb expression vector (pHuRb, [18]) was co-transfected with the IGFBP-2 promoter fused with the CAT reporter gene. However, we failed to obtain consistent results in this experiment (results not shown). One explanation for this inconsistent result is that the pRb is a constitutively expressed protein. We observed that it is also present in the nuclear extracts of BRL-3A cells by Westernblot analysis (results not shown). It is, therefore, conceivable that the level of pRb is already saturated in this cell and exogenously expressed pRb plays no role. To address this point, an in vitro transcription experiment using the pRb depleted nuclear extracts (e.g. by immunoprecipitation) could be considered. Loss of Rb function, through deletion or mutational inactivation of the Rb gene, is associated with the genesis of a subset of human cancers, including retinoblastoma, osteosarcoma, small cell lung, bladder, and breast carcinomas [16]. In many cancers, IGFBP-2 protein production is increased [5±7]. pRb is phosphorylated in a cell cycle-regulated manner. In cells in early to mid G1, the vast majority of pRb is unphosphorylated. From late G1 to the onset of DNA
193
synthesis (S phase), it is phosphorylated by cyclindependent kinases. It exerts its growth inhibition activity under an unphosphorylated form [16]. Thus, another explanation for the inconsistent result of the pRb co-transfection study mentioned above is that transfection was done to the cells where the pRb is inactive (phosphorylated form at the late G1 phase). As has been shown, the expression of IGFBP-2 (both mRNA and protein) is highly elevated at the G1/S border [15,19,20] where pRb is phosphorylated and inactive. Thus, this evidence might argue that pRb negatively regulates the IGFBP-2 gene expression. During the preparation of this manuscript, it was reported that induction of IGFBP-3 gene expression by p53, another tumour suppressor gene, is associated with enhanced secretion of an active form of IGFBP3, which functions as a negative regulator of the action of IGF [21]. Thus, it is conceivable that the IGF system in general is regulated by the tumour suppressor genes. Recent evidence suggests that the IGF-signalling pathway is required both for cell growth and tumorigenesis [1]. Therefore, therapeutics that interfere with this signalling pathway may be useful in the treatment of cancer. Further studies of IGFBPs as regards the dependence or independence from the IGF signalling pathway might shed light on cancer research. Acknowledgements The authors thank Drs. Jean-Luc Mary, Paul Robbins, Jonathan Horowitz, Ron Ninnis, Jean-Paul Giacobino, Alan Richardson and Didier de Chaffoy for discussions and Nicolas Ongenae, An Claeskens and Katja de Waepenaert for the preparation of the manuscript. This work was supported by the Schweizerische National Fond No. 32-31026.91 and 3206037314.93. References [1] R. Baserga, The insulin-like growth factor I receptor: a key to tumor growth?, Cancer Res. 55 (1995) 249±252. [2] S Rajaram, D.J. Baylink, S. Mohan, Insulin-like growth factor-binding proteins in serum and other biological ¯uids: regulation and functions, Endocrine Rev. 8(6) (1997) 801± 831.
194
E. Kutoh et al. / Cancer Letters 136 (1999) 187±194
[3] C. Mottola, R. MacDonald, J. Brackett, J. Mole, J. Anderson, M. Czech, Puri®cation and amino-terminal sequence of an insulin-like growth factor binding protein secreted by rat liver BRL-3A cells, J. Biol. Chem. 261 (1986) 11180±11188. [4] G. Morahan, D. Huang, B.D. Tait, P.G. Colman, L.C. Harrison, Markers on distal chromosome 2q linked to insulin-dependent diabetes mellitus, Science 272(21) (1996) 1811±1813. [5] J. Schwander, J.-L. Mary, The RIA for IGFBP-2 in man- a meagre catch?, Growth 3 (1993) 104±108. [6] J.G. Reeve, J. Morgan, J. Schwander, N.M. Bleehen, Role for membrane and secreted insulin-like growth factor-binding protein-2 in the regulation of insulin-like growth factor action in lung tumors, Cancer Res. 53 (1993) 4680±4685. [7] M.W. Elmlinger, K. Wimmer, E. Biemer, L. Dannecker, W.F. Blum, M.B. Ranke, G.E. Dannecker, Insulin-like growth factor binding protein 2 is differentially expressed in leukemic B- and T-cell lines, Growth Reg. 6 (1996) 152±157. [8] R.A. Weinberg, Oncogenes, anti-oncogenes and the molecular basis of multistep carcinogenesis, Cancer Res. 49 (1989) 3713±3721. [9] S.H. Friend, R. Bernards, S. Rogeji, R.A. Weinberg, J.M. Rapport, D.M. Albert, T.P. Dryja, A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteocarcinoma, Nature 323 (1986) 643±646. [10] G. Mulligan, T. Jacks, The retinoblastoma gene family: cousins with overlapping interests, Trends Genet. 6 (1998) 223±229. [11] J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd, 1989. [12] J. Schwander, E. Kutoh, J.-L. Mary, L. Ritz, The gene regulation of insulin-like growth factor binding protein-2 (IGFBP2), in: Baxter (Ed.), Elsevier, Amsterdam, 1994, pp. 151. [13] A. Udvadia, K. Rogers, P. Higgins, Y. Murata, K. Martin, P.
[14]
[15] [16] [17]
[18] [19]
[20]
[21]
Humphrey, J. Horowitz, A common set of nuclear factors bind to promoter elements regulated by the retinoblastoma protein, Proc. Natl. Acad. Sci. USA 90 (1993) 3265±3269. S. Kim, U. Onwuta, Y. Lee, R. Li, M.R. Botchman, P.D. Robbins, The retinoblastoma gene product regulates Sp1 mediated transcription. Mol. Cell. Biol. 12 (1992) 2455± 2463. E. Kutoh, J. Schwander, J. Margot, Cell density-dependent modulation of the rat insulin-like growth factor binding protein-2 and its gene, Eur. J. Biochem. 234 (1995) 557±562. R.A. Weinberg, The retinoblastoma protein and cell cycle control, Cell 81 (1995) 323±330. J. A. Pientenpol, K. MuÈnger, P. Howley, R. Stein, H. Moses, Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor beta 1 and by the retinoblastoma gene product, Proc. Natl. Acad. Sci. USA 88 (1991) 10227±10231. P. Robbins, J. Horowitz, R. Mulligan, Negative regulation of human c-fos expression by the retinoblastoma gene product, Nature 346 (1990) 668±671. V. Cazals, B. Mouhieddine, B. Maittre, Y. Le Bouc, K.. Chadelat, J. Brondy, A. Clement, Insulin-like growth factor, their binding proteins, and transforming growth factor-b1 in oxidant-arrested lung alveolar epithelial cells, J. Biol. Chem. 269 (1994) 14111±14117. O.B. Mouhieddine, V. Cazals, E. Kuto, Y. Le Bouc, A. Clement, Glucocorticoid-induced growth arrest of lung alveolar epithelial cells is associated with increased production of insulin-like growth factor binding protein-2, Endocrinology 137 (1996) 287±295. L. Buckbinder, R. Talbott, S. Velasco-Miguel, I. Takenaka, B. Faha, B.R. Seizinger, N. Kley, Induction of the growth inhibitor IGF-binding protein 3 by p53, Nature 377 (1995) 646± 649.