- Email: [email protected]
Identification and Expression Profile of a Novel Alternative Splicing of Pax7 in Chick Skeletal Muscle
Rapid communications Identification and Expression Profile of a Novel Alternative Splicing of Pax7 in Chick Skeletal Muscle C. Mao, X. Hu, and N. Li1 College of Biological Sciences and State Key Laboratory for Agrobiotechnology, China Agricultural University, Beijing 100094, P. R. China tivation domain of Pax7. Pax7–2 lost transactivation ability. We detected the expression levels of Pax7–2 in chick pectoralis muscles at different developmental stages and found that the expression of Pax7–2 was at its peak in d-12 chick embryos. The expression levels of Pax7 and Pax-2 in chick pectoralis muscles at different developmental stages had a similar trend across the period under study, although the changes of their expression levels were different. As chicks grew up, Pax7 and Pax7–2 were expressed at much lower levels.
Key words: Pax7, alternative splicing, myoblast, chick 2008 Poultry Science 87:1919–1925 doi:10.3382/ps.2007-00479
INTRODUCTION Pax7 is a member of the paired box transcription factor family, containing paired box, octapeptide, and homeobox motifs in its highly conserved NH2-terminal region (Dahl et al., 1997). Many alternate transcripts of Pax genes have been identified (Lamey et al., 2004). In human, Pax7 has an alternative splicing form, which is the predominant transcript in ERMS, ES, NB, and MEL cell lines (Barr et al., 1999). There are at least 4 different Pax7 forms found in adult mice (Ziman et al., 1997). Chick Pax7 gene contains 10 exons, as shown in GenBank NW_001471571.1. Whether there is an alternative splicing form of chick Pax7 is unknown. Pax7 expression is throughout early chick embryogenesis (Otto et al., 2006), and Pax7 is expressed during somite development (Jostes et al., 1990). Somite is a transitory structure giving rise to dermomyotome, which is the source skeletal muscle (Christ and Ordahl, 1995; Tajbakhsh and Buckingham, 2000). After myotome is formed, embryonic and fetal myoblasts proliferate and differentiate to form primary and secondary fibers, respectively, by expressing MyoD, Myf5, MRF4, ©2008 Poultry Science Association Inc. Received November 26, 2007. Accepted April 21, 2008. 1 Corresponding author: [email protected]
and myogenin (Miller and Stockdale, 1986; Cossu et al., 1988; Smith et al., 1993). During myogensis controlled by muscle-specific transcriptional regulators, responding to external signals, myoblasts withdraw from the cell cycle and fuse together to form multinucleated myotubes (Polesskaya and Rudnicki, 2002). Growth and regeneration of skeletal muscles of mammals after birth is attributed to satellite cells, which are mononuclear cells located at the periphery of myotube and surrounded by the basal lamina (Schultz and McCormick, 1994). When injured or in response to other signals, quiescent satellite cells are activated and coexpress Pax7 and MyoD, then proliferate, downregulate Pax7, differentiate, and finally fuse to preexisting myotubes or to each other to form new myotubes (Bischoff, 1994; Zammit et al., 2004). However, some proliferating cells maintain Pax7 but lose MyoD and return to quiescent state (Zammit et al., 2004). Pax7 (−/−) mice have a decreased number of muscle satellite cells, and they are extremely deficient in muscle regeneration when injured, suggesting that Pax7 plays an important role in postnatal renewal and propagation of satellite cells (Oustanina et al., 2004; Kuang et al., 2006). Here, we found a novel alternative splicing form of chick Pax7 named Pax7–2, which lacked 22 amino acids in its COOH terminal compared with Pax7. Localization of Pax7–2 indicated that Pax7–2 was also ex-
1919
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
ABSTRACT Pax7 is essential for skeletal muscle myogenesis. The alternative splicing forms of Pax7 were found in human and mouse. In this study, we identified a new alternative splicing of chick Pax7. We named it Pax7–2 and localized it in the nucleus of chick myoblast. In Pax7–2 mRNA, exon 8 of chick Pax7 gene was spliced out. That led to a 22-amino acid deletion in the COOH terminal of Pax7–2 protein compared with Pax7 protein. Luciferase assays demonstrated that chick Pax7 could act as a transactivator and the deleted 22 amino acids in Pax7–2 may belong to the transac-
1920
Mao et al.
pressed in the nucleus of myoblast as Pax7. Luciferase assays showed that Pax7 had the transactivation ability, and Pax7–2 lost it. Then we detected the expression levels of Pax7–2 in chick pectoralis muscle at chick different developmental stages and observed that its expression trend is similar with Pax7 across the period under study.
MATERIALS AND METHODS Samples
RNA Extraction and Reverse Transcription Total RNA was extracted from skeletal muscle samples using Trizol reagent (Invitrogen, Carlsbad) according to the protocol of the manufacturer. Then, total RNA was treated with RNase-free DNase I (Stratagene, La Jolla, CA) for 30 min at 37°C to ensure that it was free of DNA contamination. First-strand cDNA was synthesized using an oligo(dT)18 and Moloney murine leukemia virus reverse transcriptase (Clontech, Mountain View, CA) according to the protocol of the manufacturer.
Detection of a New Alternative Splicing of Chick Pax7 by Reverse Transcription-PCR and Sequencing One-day-old chick pectoralis muscle cDNA was used as a template for PCR to amplify Pax7 cDNA. Ex Taq polymerase (Takara, Shiga, Japan) was used for amplification. Pax7 cDNA was PCR-amplified using primers P1 and P2 (Table 1) with the following conditions: 95°C for 30 s, 63°C for 30 s, and 72°C for 2 min for 40 cycles. The PCR product was ligated into the T/A cloning vector pMD18-T (Takara) with T4 ligase (Promega, Madison, WI) and then transformed into DH5α and plated on Luria-Bertani with ampicillin and 5-bromo4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). Positive clones were selected, and 10 clones were sequenced. A new alternative splicing of chick Pax7 named Pax7–2 was found. The plasmid containing full-length Pax7 was named pMD18-T-Pax7, and the plasmid containing Pax7–2 was named pMD18-T-Pax7–2. To show the 66-bp difference between Pax7 and Pax7–2, primers P3 and P4 (Table 1) were used with the following PCR conditions: 95°C for 30 s, 60°C for 30 s, and 72°C for 15 s for 35 cycles.
Primer name
Senseantisense
Primer sequence 5′-3′
P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 G1 G2
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
CGGTTGTGACATAGCCCGAAAA GTGGAAGGGAGTTGGGAAGGAG ATCCTGTTAGCAATGGCCTCTCTCCG GACTGCGAGGTCGGGAGGCTG CCAGAGCTCATGGCAGCGCTCCC GGAGTCGACCAGTAAGCTTGGCCTGTC AATGGCCTCTCTCCGCAGGTGA ACTGCGAGGTCGGGAGGCTGT CAAAACAAGATGCAGTGCTCCAG CGGACTTGATGGAGTCACTCCG CACTGTCAAGGCTGAGAACGG GATGATAACACGCTTAGCACCAC
Plasmid Construction Pax7 and Pax7–2 were amplified from pMD18-T-Pax7 and pMD18-T-Pax7–2, respectively, using primers P5 and P6 (Table 1), which contain Sac I and SalI enzyme sites with the following PCR conditions: 95°C for 30 s, 62°C for 30 s, and 72°C for 2 min for 30 cycles. Then they were inserted into pEGFP-N1 (Clontech), which was enzymed with Sac I and SalI. Positive clones were selected and sequenced to ensure correction. The 2 fusion protein expression vectors were named pEGFPN1-Pax7 and pEGFP-N1-Pax7–2, respectively.
Cell Cultures Myoblasts were prepared from the pectoralis muscle of 11-d chick embryos as described (Halevy and Lerman, 1993) with slight modifications. In brief, skeletal muscles were digested with 0.1% collagenase I and 0.25% trypsin. Cells were then filtered through a mesh (200 µm), centrifuged, and preplated on a dish for 3 h. After that, cells were cultured in DMEM/F-12 medium (Gibco BRL, Carlsbad, CA) containing 20% fetal bovine serum (Gibco BRL) and 1% penicillin-streptomycin (Gibco BRL) on dishes precoated with 1.5% gelatin (Sigma, St. Louis, MO) and were maintained at 37°C with 5% CO2.
Transfection Myoblasts were transfected with pEGFP-N1, pEGFPN1-Pax7, or pEGFP-N1-Pax7–2 using Lipofectamine 2000 (Invitrogen) according to the protocol of the manufacturer. After 24 h, photos of myoblasts were taken from a Nikon Eclipse TS100 fluorescence microscope (Nikon Inc., Melville, NY). Propidium iodide (Sigma) was used to show the nucleus of myoblast according to the protocol of the manufacturer.
Luciferase Assays For luciferase assays, 3 copies of e5 sequence were inserted into the pGL3-Promoter (Promega) vector
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Skeletal muscle samples were collected from the pectoralis muscle of White Leghorn at different developmental stages. The developmental stages are 7- to 20-d embryo stages, 1 d of age, 3 wk of age, and 1 yr of age. The collection of 7-d chick embryo pectoralis muscle was 166 h after the beginning of incubation. Collection was continued every 24 h until 20-d embryo stage. At every stage, we collected 3 independent samples.
Table 1. Primers used
IDENTIFICATION OF A VARIANT FORM OF CHICK PAX7
at MluI and BglII enzyme sites to form the pGL3Promoter-e5 vector. The e5 sequence 5′-CACCGCACGATTAGCACCGTTCCGCTCAGG-3′ was found in the Drosophila even-skipped (eve) promoter and contained the consensus-binding sequences for the paired domain (Goulding et al., 1991; Schafer et al., 1994). To normalize transfection efficiency, pRL-TK plasmid (Promega) was used. The reporter gene vector pGL3-Promoter-e5 (0.1 μg), the expression plasmid (pEGFP-N1/pEGFPN1-Pax7/pEGFP-N1-Pax7–2, 0.1 μg), and pRL-TK (2.5 μg) were cotransfected into CHO cells in each well of a 96-well plate using Lipofectamine 2000 (Invitrogen). After 24 h, cells were harvested and assayed for firefly and Renilla luciferase activity. Luciferase assays were
1921
performed using the Dual-Glo Luciferase Reporter Assay System (Promega) according to the instructions of the manufacturer. Light emission was measured using a 10-s time frame with a luminometer (Turner Biosystems, Sunnyvale, CA). Firefly luciferase light output was normalized to Renilla luciferase output.
Quantitative Real-Time Reverse Transcription-PCR Quantitative real-time reverse transcription-PCR (RT-PCR) was used to quantify the expression of Pax7 (NM_205065) and Pax7–2. Quantitative real-time RT-
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 1. Chick Pax7 and its alternative splicing Pax7–2. (A) Schematic diagram of the alternative splicing of the Pax7 gene. Introns were shown as lines, and exons were shown as boxes. The numbers 6, 7, 8, 9, and 10 in boxes represent the last 5 constitutive exons of the Pax7 gene. Compared with full-length chick Pax7, the alternative splicing of Pax7 (Pax7–2) is absent of 8 exons, which includes 66 nucleotides. The deletion of exon 8 in Pax7–2 does not change the reading frame. Primers P7, P8, P9, and P10 are used in quantitative real-time reverse transcription-PCR (B) The 66-bp difference between Pax7 cDNA and Pax7–2 cDNA in agarose gel electrophoresis. Reverse transcription-PCR was used to amplify partial sequence of Pax7 cDNA and Pax7–2 cDNA including the 66-bp region. The sense primer P3 was at exon 7, and the antisense primer P4 was at exon 9. They were shown as arrows in (A). The partial sequence of Pax7 cDNA is 262 bp, and the partial sequence of Pax7–2 cDNA is 196 bp.
1922
Mao et al.
and G2 (Table 1) were used. The following quantitative real-time RT-PCR conditions were used: 95°C for 10 min and then 40 cycles of 95°C for 15 s, 59°C for 30 s, and 72°C for 15 s.
Statistical Analysis All values were expressed as the mean ± SE, and SPSS (SPSS Inc., Chicago, IL) was used for statistical analysis. One-way ANOVA was also used. Statistical significance was set at P < 0.05.
RESULTS AND DISCUSSION Detection of an Alternative Splicing of Chick Pax7
PCR was carried out in ABIPrism 7900HT (Applied Biosystems, Foster City, CA) using SYBR Green master mix (Applied Biosystems). Plasmids (pMD18-T-Pax7, pMD18-T-Pax7–2, and pMD18-T-GAPDH) containing the target sequences were constructed and were serially diluted for making standard curves. Target values were obtained from the standard curve and were normalized to GAPDH (NM_204305). For Pax7–2, primers P7 and P8 (Table 1) were used; for Pax7, primers P9 and P10 (Table 1) were used; for GAPDH, primers G1
Pax7–2 is Localized in the Nucleus of Chick Myoblast To characterize the intracellular localization of Pax7– 2, we constructed the plasmid pEGFP-N1-Pax7–2, which was inserted in the Pax7–2 coding region at the N terminus of GFP, and the plasmid pEGFP-N1-Pax7, which was inserted in the Pax7 coding region at the N terminus of GFP. It was found that pEGFP-N1, pEGFP-N1-Pax7, and pEGFP-N1-Pax7–2 were transfected into chick myoblasts, respectively. The fluorescent signals of Pax7-EGFP fusion protein and Pax7–2-EGFP fusion protein in transfected myoblasts were in the
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 2. Pax7–2 localized in the nucleus of chick myoblast. Myoblast was transfected with mock transfection (a, b, c, d), pEGFPN1(e, f, g, h), pEGFP-N1-Pax7–2(i, j, k, l), or pEGFP-N1-Pax7 (m, n, o, p). Mock transfection means myoblast transfected with no vectors but only Lipofectamine 2000. Image was under white light(a, e, i, m), blue light(b, f, j, n), white and blue light(c, g, k, o), or green light(d, h, l, p). Propidium iodide (PI) was used to show the nucleus of myoblast. Under blue light, green fluorescent signals of EGFP protein, Pax7-EGFP fusion protein, or Pax7–2-EGFP fusion protein could be seen. Under green light, red fluorescent signals of PI could be seen. Scale bar: 10 μm.
To amplify chick Pax7 cDNA, RT-PCR was conducted. The ~1.87-kb PCR product was inserted into pMD1 8-T and then 10 randomly picked-up plasmids were sequenced. Compared with the full-length chick Pax7 (NM_205065), 1 alternative splicing of chick Pax7, named Pax7–2, was found. Full-length chick Pax7 has 1,575 nucleotides in its CDS from position 186 to 1760, but Pax7–2 is 66 nt shorter. The 66-nt sequence from position 1332 to 1397 comes from exon 8 of the Pax7 gene. Exclusion of the 66-nt sequence leads to the deletion of 22 amino acids in Pax7–2 protein without changing the reading frame. The structures of Pax7 and Pax7–2 and the 66-nucleotide sequence were shown in Figure 1. Previous research indicated that there were alternative splicing forms of Pax7 in human and mouse. In human, the alternative splicing of Pax7 has the ninth exon compared with Pax7, which changes the C-terminal coding regions of the coded product (Barr et al., 1999). In mouse, 1 alternative splicing of Pax7 contains a hexanucleotide insertion in the paired box, 1 is about 10-bp deleted in the homeobox, and 1 only comprises the paired box (Ziman et al., 1997). In our study, the 66-bp exon absent in the alternative splicing of chick Pax7 (Pax7–2) is exon 8 of chick Pax7 gene, and there are 2 exons following it. The 66-bp exon neither belongs to the paired domain nor to the homeodomain according to the TRANSFAC database.
IDENTIFICATION OF A VARIANT FORM OF CHICK PAX7
1923
area of the nucleus, whereas the fluorescent signal of GFP protein was everywhere in transfected myoblast (Figure 2). Propidium iodide staining showed the colocalization of Pax7 isoforms and DNA. It indicated that Pax7–2 was localized in the nucleus of chick myoblast as Pax7. Although in previous studies using Pax7 antibody, Pax7 was localized in the nuclei of cells, here we first directly showed the localization of Pax7 and its alternative splicing Pax7–2 in nuclei. Furthermore, our nuclear localization of Pax7–2 indicated that the exclusion of a 66-bp exon did not influence the nuclear localization. Functional analyses of human Pax3 and Pax7 exons 6, 7, and 8 showed that they encoded transcriptional activation domains and interacted with transcriptional repression domains in N-teminal (Chalepakis et al., 1994; Bennicelli et al., 1999). Whether the 66-bp exon of chick Pax7 encodes the transcriptional activation domain should be further investigated. Because Pax7–2 retains the paired domain and homeodomain, which contains the DNA-binding domain, it may competitively bind to the downstream targeted genes of Pax7.
The Deleted 22 Amino Acids in Pax7–2 Belong to the Transactivation Domain of Pax7 To test whether the deleted 22 amino acids belong to the transactivation domain of Pax7, luciferase assays were performed in CHO cell line. As a reporter gene, 3 copies of e5 sequence were inserted into the pGL3Promoter vector. The e5 sequence was found in the Drosophila even-skipped (eve) promoter and contained the consensus-binding sequences for the paired domain
(Goulding et al., 1991; Schafer et al., 1994). Cotransfection of this reporter construct with the expression vector pEGFP-N1-Pax7 for Pax7 and pRL-TK resulted in a ~0.5-fold increase in luciferase activity (Figure 3), when compared with the expression vector pEGFP-N1 and pRL-TK. This demonstrated that chick Pax7 can act as a transactivator. However, cotransfection of this reporter construct with the expression vector pEGFPN1-Pax7–2 for Pax7–2 and pRL-TK resulted in a ~0.3fold decrease in luciferase activity (Figure 3), when compared with the expression vector pEGFP-N1 and pRL-TK. These experiments suggested that the deleted 22 amino acids may belong to the transactivation domain of Pax7. Note that the e5 site is a low-affinity site for Pax7, which may explain the relatively low transactivation by Pax7 (Schafer et al., 1994).
Expression Profile of Pax7–2 in Chick Skeletal Muscles at Different Development Stages To detect the expression levels of Pax7–2 in chick pectoralis muscle at different development stages, quantitative real-time RT-PCR was used. Muscles were prepared from d-7 to d-20 chick embryos, 1-d-old chicks, 3-wk-old chicks, and 1-yr-old chicks, respectively. Expression profile of Pax7–2 was shown in Figure 4A. Pax7–2 was expressed greatest on embryonic d 12 (P < 0.05). Compared with the expression pattern of Pax7 in Figure 4B, the expression trend of Pax7–2 was similar with Pax7, although there were some slight differences. From d 7 to 9 of incubation, the expression levels of Pax7 and Pax7–2 were almost the same everyday. Then from d 10 to d 12 of incubation, the expres-
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 3. The deleted 22 amino acids in Pax7–2 belong to the transactivation domain of Pax7. Control group = CHO cells cotransfected with pGL3-Promoter-e5, pEGFP-N1, and pRL-TK; pEGFP-N1-Pax7 group = CHO cells cotransfected with pGL3-Promoter-e5, pEGFP-N1-Pax7, and pRL-TK; pEGFP-N1-Pax7–2 group = CHO cells cotransfected with pGL3-Promoter-e5, pEGFP-N1-Pax7–2, and pRL-TK. Firefly luciferase activity was normalized by Renilla luciferase activity. Luminometer measurements (±SE) were expressed as fold of the control group. All transfection experiments were repeated 5 times.
1924
Mao et al.
sion levels of Pax7 were greater than Pax7–2. On d 12 of incubation, the expression level of Pax7 was 2-fold greater than Pax7–2, and the difference was significant (P < 0.05). We observed that the expression of Pax7 showed dramatic decline on d 13 of incubation. Although the expression of Pax7–2 also turned down on d 13 of incubation, it was greater than Pax7 (P < 0.05). From d 14 to d 16 of incubation, the expression levels of Pax7–2 were always greater than Pax7, although the difference did not reach significance. After d 16 of incubation, both Pax7 and Pax7–2 were expressed at much lower levels. In addition, on d 20 of incubation, Pax7–2 was expressed greater than Pax7, although the difference was not significant. However, 1 d later when chicks were born, the expression level of Pax7 turned up when the expression level of Pax7 turned down, and the difference was significant (P < 0.05). As chicks grew up, Pax7 and Pax7–2 were expressed at much lower
levels. This is consistent with the phenomenon that Pax7 protein expressed the strongest by 1 d posthatch and declined on d 3 and 6 to a similar level (Halevy et al., 2004). Compared with the outside environment, the environment of the embryo stage is more stable. But many inner factors could influence the expression of Pax7 and have an effect on myogenesis. Pax3 represses Pax7 during neural tube and somite development (Borycki et al., 1999). The similar expression trend of Pax7–2 and Pax7 in pectoralis muscle across the period under study may be the result of many factors working together. In conclusion, we identified an alternative splicing of chick Pax7 (Pax7–2) and localized it in the nucleus of chick myoblast. The deleted 22 amino acids in Pax7–2 may be very important for the transactivation ability of Pax7, because Pax7–2 lost the transactivation ability. Expression profiles of Pax7–2 and Pax7 in chick pecto-
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 4. Quantitative real-time reverse transcription-PCR to detect the expression of Pax7 and Pax7–2 in chick pectoralis muscle at different developmental stages. The numbers 7 to 20 in the x-axis represent 7- to 20-d embryo stages, respectively; 1d in the x-axis represents 1 d of age; 3w in the x-axis represents 3 wk of age; 1y in x-axis represents 1 yr of age. Original quantities of target genes are obtained from standard curves. Quantity of interest is normalized to the quantity of GAPDH and multiplied by 106 forming new values. Three independent samples in each stage were performed in triplicate. Values on the y-axis represent the mean values (with standard errors) of target genes. (A) Pax7–2 expression levels. (B) Pax7 expression levels.
IDENTIFICATION OF A VARIANT FORM OF CHICK PAX7
ralis muscle help us know more details of them in chick development.
ACKNOWLEDGMENTS We thank Junguang He from China Agricultural University for technical help. This work is supported by the Major State Basic Research Development Program of China (2006CB102100) and National Natural Science Foundation of China (30671496).
REFERENCES
Yablonka-Reuveni. 2004. Pattern of Pax7 expression during myogenesis in the posthatch chicken establishes a model for satellite cell differentiation and renewal. Dev. Dyn. 231:489–502. Jostes, B., C. Walther, and P. Gruss. 1990. The murine paired box gene, Pax7, is expressed specifically during the development of the nervous and muscular system. Mech. Dev. 33:27–37. Kuang, S., S. B. Charge, P. Seale, M. Huh, and M. A. Rudnicki. 2006. Distinct roles for Pax7 and Pax3 in adult regenerative myogenesis. J. Cell Biol. 172:103–113. Lamey, T. M., A. Koenders, and M. Ziman. 2004. Pax genes in myogenesis: Alternate transcripts add complexity. Histol. Histopathol. 19:1289–1300. Miller, J. B., and F. E. Stockdale. 1986. Developmental regulation of the multiple cell lineages of the avian embryo. J. Cell Biol. 103:2197–2208. Otto, A., C. Schmidt, and K. Patel. 2006. Pax3 and Pax7 expression and regulation in the avian embryo. Anat. Embryol. (Berl.) 211:293–310. Oustanina, S., G. Hause, and T. Braun. 2004. Pax7 directs postnatal renewal and propagation of myogenic satellite cells but not their specification. EMBO J. 23:3430–3439. Polesskaya, A., and M. A. Rudnicki. 2002. A MyoD-dependent differentiation checkpoint: Ensuring genome integrity. Dev. Cell 3:757–758. Schafer, B. W., T. Czerny, M. Bernasconi, M. Genini, and M. Busslinger. 1994. Molecular cloning and characterization of a human PAX-7 cDNA expressed in normal and neoplastic myocytes. Nucleic Acids Res. 22:4574–4582. Schultz, E., and K. M. McCormick. 1994. Skeletal muscle satellite cells. Rev. Physiol. Biochem. Pharmacol. 123:213– 257. Smith, T. H., N. E. Block, S. J. Rhodes, S. F. Konieczny, and J. B. Miller. 1993. A unique pattern of expression of the four muscle regulatory factor proteins distinguishes somitic from embryonic, fetal and newborn mouse myogenic cells. Development 117:1125–1133. Tajbakhsh, S., and M. E. Buckingham. 2000. The birth of muscle progenitor cells in the mouse: Spatiotemporal considerations. Curr. Top. Dev. Biol. 48:225–268. Zammit, P. S., J. P. Golding, Y. Nagata, V. Hudon, T. A. Partridge, and J. R. Beauchamp. 2004. Muscle satellite cells adopt divergent fates: A mechanism for self-renewal? J. Cell Biol. 166:347–357. Ziman, M. R., S. Fletcher, and P. H. Kay. 1997. Alternate Pax7 transcripts are expressed specifically in skeletal muscle, brain and other organs of adult mice. Int. J. Biochem. Cell Biol. 29:1029–1036.
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Barr, F. G., J. C. Fitzgerald, J. P. Ginsberg, R. J. Davis, and J. L. Bennicelli. 1999. Predominant expression of alternative Pax3 and Pax7 forms in myogenic and neural tumor cell lines. Cancer Res. 59:5443–5448. Bennicelli, J. L., S. Advani, B. W. Schafer, and F. G. Barr. 1999. Pax3 and Pax7 exhibit conserved cis-acting transcription repression domains and utilize a common gain of function mechanism in alveolar rhabdomyosarcoma. Oncogene 18:4348–4356. Bischoff, R. 1994. The satellite cell and muscle regeneration. Pages 97–118 in Myology. A. G. Engel and C. FanziniArmstrong, ed. McGraw-Hill, New York, NY. Borycki, A. G., J. Li, F. Jin, C. P. Emerson, and J. A. Epstein. 1999. Pax3 functions in cell survival and in Pax7 regulation. Development 126:1665–1674. Chalepakis, G., F. S. Jones, G. M. Edelman, and P. Gruss. 1994. Pax-3 contains domains for transcription activation and transcription inhibition. Proc. Natl. Acad. Sci. USA 91:12745–12749. Christ, B., and C. P. Ordahl. 1995. Early stages of chick somite development. Anat. Embryol. (Berl.) 191:381–396. Cossu, G., G. Ranaldi, M. I. Senni, M. Molinaro, and E. Vivarelli. 1988. ‘Early’ mammalian myoblasts are resistant to phorbol ester-induced block of differentiation. Development 102:65–69. Dahl, E., H. Koseki, and R. Balling. 1997. Pax genes and organogenesis. Bioessays 19:755–765. Goulding, M. D., G. Chalepakis, U. Deutsch, J. R. Erselius, and P. Gruss. 1991. Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J. 10:1135–1147. Halevy, O., and O. Lerman. 1993. Retinoic acid induces adult muscle cell differentiation mediated by the retinoic acid receptor-α. J. Cell. Physiol. 154:566–572. Halevy, O., Y. Piestun, M. Z. Allouh, B. W. Rosser, Y. Rinkevich, R. Reshef, I. Rozenboim, M. Wleklinski-Lee, and Z.
1925
Key words: Pax7, alternative splicing, myoblast, chick 2008 Poultry Science 87:1919–1925 doi:10.3382/ps.2007-00479
INTRODUCTION Pax7 is a member of the paired box transcription factor family, containing paired box, octapeptide, and homeobox motifs in its highly conserved NH2-terminal region (Dahl et al., 1997). Many alternate transcripts of Pax genes have been identified (Lamey et al., 2004). In human, Pax7 has an alternative splicing form, which is the predominant transcript in ERMS, ES, NB, and MEL cell lines (Barr et al., 1999). There are at least 4 different Pax7 forms found in adult mice (Ziman et al., 1997). Chick Pax7 gene contains 10 exons, as shown in GenBank NW_001471571.1. Whether there is an alternative splicing form of chick Pax7 is unknown. Pax7 expression is throughout early chick embryogenesis (Otto et al., 2006), and Pax7 is expressed during somite development (Jostes et al., 1990). Somite is a transitory structure giving rise to dermomyotome, which is the source skeletal muscle (Christ and Ordahl, 1995; Tajbakhsh and Buckingham, 2000). After myotome is formed, embryonic and fetal myoblasts proliferate and differentiate to form primary and secondary fibers, respectively, by expressing MyoD, Myf5, MRF4, ©2008 Poultry Science Association Inc. Received November 26, 2007. Accepted April 21, 2008. 1 Corresponding author: [email protected]
and myogenin (Miller and Stockdale, 1986; Cossu et al., 1988; Smith et al., 1993). During myogensis controlled by muscle-specific transcriptional regulators, responding to external signals, myoblasts withdraw from the cell cycle and fuse together to form multinucleated myotubes (Polesskaya and Rudnicki, 2002). Growth and regeneration of skeletal muscles of mammals after birth is attributed to satellite cells, which are mononuclear cells located at the periphery of myotube and surrounded by the basal lamina (Schultz and McCormick, 1994). When injured or in response to other signals, quiescent satellite cells are activated and coexpress Pax7 and MyoD, then proliferate, downregulate Pax7, differentiate, and finally fuse to preexisting myotubes or to each other to form new myotubes (Bischoff, 1994; Zammit et al., 2004). However, some proliferating cells maintain Pax7 but lose MyoD and return to quiescent state (Zammit et al., 2004). Pax7 (−/−) mice have a decreased number of muscle satellite cells, and they are extremely deficient in muscle regeneration when injured, suggesting that Pax7 plays an important role in postnatal renewal and propagation of satellite cells (Oustanina et al., 2004; Kuang et al., 2006). Here, we found a novel alternative splicing form of chick Pax7 named Pax7–2, which lacked 22 amino acids in its COOH terminal compared with Pax7. Localization of Pax7–2 indicated that Pax7–2 was also ex-
1919
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
ABSTRACT Pax7 is essential for skeletal muscle myogenesis. The alternative splicing forms of Pax7 were found in human and mouse. In this study, we identified a new alternative splicing of chick Pax7. We named it Pax7–2 and localized it in the nucleus of chick myoblast. In Pax7–2 mRNA, exon 8 of chick Pax7 gene was spliced out. That led to a 22-amino acid deletion in the COOH terminal of Pax7–2 protein compared with Pax7 protein. Luciferase assays demonstrated that chick Pax7 could act as a transactivator and the deleted 22 amino acids in Pax7–2 may belong to the transac-
1920
Mao et al.
pressed in the nucleus of myoblast as Pax7. Luciferase assays showed that Pax7 had the transactivation ability, and Pax7–2 lost it. Then we detected the expression levels of Pax7–2 in chick pectoralis muscle at chick different developmental stages and observed that its expression trend is similar with Pax7 across the period under study.
MATERIALS AND METHODS Samples
RNA Extraction and Reverse Transcription Total RNA was extracted from skeletal muscle samples using Trizol reagent (Invitrogen, Carlsbad) according to the protocol of the manufacturer. Then, total RNA was treated with RNase-free DNase I (Stratagene, La Jolla, CA) for 30 min at 37°C to ensure that it was free of DNA contamination. First-strand cDNA was synthesized using an oligo(dT)18 and Moloney murine leukemia virus reverse transcriptase (Clontech, Mountain View, CA) according to the protocol of the manufacturer.
Detection of a New Alternative Splicing of Chick Pax7 by Reverse Transcription-PCR and Sequencing One-day-old chick pectoralis muscle cDNA was used as a template for PCR to amplify Pax7 cDNA. Ex Taq polymerase (Takara, Shiga, Japan) was used for amplification. Pax7 cDNA was PCR-amplified using primers P1 and P2 (Table 1) with the following conditions: 95°C for 30 s, 63°C for 30 s, and 72°C for 2 min for 40 cycles. The PCR product was ligated into the T/A cloning vector pMD18-T (Takara) with T4 ligase (Promega, Madison, WI) and then transformed into DH5α and plated on Luria-Bertani with ampicillin and 5-bromo4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). Positive clones were selected, and 10 clones were sequenced. A new alternative splicing of chick Pax7 named Pax7–2 was found. The plasmid containing full-length Pax7 was named pMD18-T-Pax7, and the plasmid containing Pax7–2 was named pMD18-T-Pax7–2. To show the 66-bp difference between Pax7 and Pax7–2, primers P3 and P4 (Table 1) were used with the following PCR conditions: 95°C for 30 s, 60°C for 30 s, and 72°C for 15 s for 35 cycles.
Primer name
Senseantisense
Primer sequence 5′-3′
P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 G1 G2
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
CGGTTGTGACATAGCCCGAAAA GTGGAAGGGAGTTGGGAAGGAG ATCCTGTTAGCAATGGCCTCTCTCCG GACTGCGAGGTCGGGAGGCTG CCAGAGCTCATGGCAGCGCTCCC GGAGTCGACCAGTAAGCTTGGCCTGTC AATGGCCTCTCTCCGCAGGTGA ACTGCGAGGTCGGGAGGCTGT CAAAACAAGATGCAGTGCTCCAG CGGACTTGATGGAGTCACTCCG CACTGTCAAGGCTGAGAACGG GATGATAACACGCTTAGCACCAC
Plasmid Construction Pax7 and Pax7–2 were amplified from pMD18-T-Pax7 and pMD18-T-Pax7–2, respectively, using primers P5 and P6 (Table 1), which contain Sac I and SalI enzyme sites with the following PCR conditions: 95°C for 30 s, 62°C for 30 s, and 72°C for 2 min for 30 cycles. Then they were inserted into pEGFP-N1 (Clontech), which was enzymed with Sac I and SalI. Positive clones were selected and sequenced to ensure correction. The 2 fusion protein expression vectors were named pEGFPN1-Pax7 and pEGFP-N1-Pax7–2, respectively.
Cell Cultures Myoblasts were prepared from the pectoralis muscle of 11-d chick embryos as described (Halevy and Lerman, 1993) with slight modifications. In brief, skeletal muscles were digested with 0.1% collagenase I and 0.25% trypsin. Cells were then filtered through a mesh (200 µm), centrifuged, and preplated on a dish for 3 h. After that, cells were cultured in DMEM/F-12 medium (Gibco BRL, Carlsbad, CA) containing 20% fetal bovine serum (Gibco BRL) and 1% penicillin-streptomycin (Gibco BRL) on dishes precoated with 1.5% gelatin (Sigma, St. Louis, MO) and were maintained at 37°C with 5% CO2.
Transfection Myoblasts were transfected with pEGFP-N1, pEGFPN1-Pax7, or pEGFP-N1-Pax7–2 using Lipofectamine 2000 (Invitrogen) according to the protocol of the manufacturer. After 24 h, photos of myoblasts were taken from a Nikon Eclipse TS100 fluorescence microscope (Nikon Inc., Melville, NY). Propidium iodide (Sigma) was used to show the nucleus of myoblast according to the protocol of the manufacturer.
Luciferase Assays For luciferase assays, 3 copies of e5 sequence were inserted into the pGL3-Promoter (Promega) vector
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Skeletal muscle samples were collected from the pectoralis muscle of White Leghorn at different developmental stages. The developmental stages are 7- to 20-d embryo stages, 1 d of age, 3 wk of age, and 1 yr of age. The collection of 7-d chick embryo pectoralis muscle was 166 h after the beginning of incubation. Collection was continued every 24 h until 20-d embryo stage. At every stage, we collected 3 independent samples.
Table 1. Primers used
IDENTIFICATION OF A VARIANT FORM OF CHICK PAX7
at MluI and BglII enzyme sites to form the pGL3Promoter-e5 vector. The e5 sequence 5′-CACCGCACGATTAGCACCGTTCCGCTCAGG-3′ was found in the Drosophila even-skipped (eve) promoter and contained the consensus-binding sequences for the paired domain (Goulding et al., 1991; Schafer et al., 1994). To normalize transfection efficiency, pRL-TK plasmid (Promega) was used. The reporter gene vector pGL3-Promoter-e5 (0.1 μg), the expression plasmid (pEGFP-N1/pEGFPN1-Pax7/pEGFP-N1-Pax7–2, 0.1 μg), and pRL-TK (2.5 μg) were cotransfected into CHO cells in each well of a 96-well plate using Lipofectamine 2000 (Invitrogen). After 24 h, cells were harvested and assayed for firefly and Renilla luciferase activity. Luciferase assays were
1921
performed using the Dual-Glo Luciferase Reporter Assay System (Promega) according to the instructions of the manufacturer. Light emission was measured using a 10-s time frame with a luminometer (Turner Biosystems, Sunnyvale, CA). Firefly luciferase light output was normalized to Renilla luciferase output.
Quantitative Real-Time Reverse Transcription-PCR Quantitative real-time reverse transcription-PCR (RT-PCR) was used to quantify the expression of Pax7 (NM_205065) and Pax7–2. Quantitative real-time RT-
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 1. Chick Pax7 and its alternative splicing Pax7–2. (A) Schematic diagram of the alternative splicing of the Pax7 gene. Introns were shown as lines, and exons were shown as boxes. The numbers 6, 7, 8, 9, and 10 in boxes represent the last 5 constitutive exons of the Pax7 gene. Compared with full-length chick Pax7, the alternative splicing of Pax7 (Pax7–2) is absent of 8 exons, which includes 66 nucleotides. The deletion of exon 8 in Pax7–2 does not change the reading frame. Primers P7, P8, P9, and P10 are used in quantitative real-time reverse transcription-PCR (B) The 66-bp difference between Pax7 cDNA and Pax7–2 cDNA in agarose gel electrophoresis. Reverse transcription-PCR was used to amplify partial sequence of Pax7 cDNA and Pax7–2 cDNA including the 66-bp region. The sense primer P3 was at exon 7, and the antisense primer P4 was at exon 9. They were shown as arrows in (A). The partial sequence of Pax7 cDNA is 262 bp, and the partial sequence of Pax7–2 cDNA is 196 bp.
1922
Mao et al.
and G2 (Table 1) were used. The following quantitative real-time RT-PCR conditions were used: 95°C for 10 min and then 40 cycles of 95°C for 15 s, 59°C for 30 s, and 72°C for 15 s.
Statistical Analysis All values were expressed as the mean ± SE, and SPSS (SPSS Inc., Chicago, IL) was used for statistical analysis. One-way ANOVA was also used. Statistical significance was set at P < 0.05.
RESULTS AND DISCUSSION Detection of an Alternative Splicing of Chick Pax7
PCR was carried out in ABIPrism 7900HT (Applied Biosystems, Foster City, CA) using SYBR Green master mix (Applied Biosystems). Plasmids (pMD18-T-Pax7, pMD18-T-Pax7–2, and pMD18-T-GAPDH) containing the target sequences were constructed and were serially diluted for making standard curves. Target values were obtained from the standard curve and were normalized to GAPDH (NM_204305). For Pax7–2, primers P7 and P8 (Table 1) were used; for Pax7, primers P9 and P10 (Table 1) were used; for GAPDH, primers G1
Pax7–2 is Localized in the Nucleus of Chick Myoblast To characterize the intracellular localization of Pax7– 2, we constructed the plasmid pEGFP-N1-Pax7–2, which was inserted in the Pax7–2 coding region at the N terminus of GFP, and the plasmid pEGFP-N1-Pax7, which was inserted in the Pax7 coding region at the N terminus of GFP. It was found that pEGFP-N1, pEGFP-N1-Pax7, and pEGFP-N1-Pax7–2 were transfected into chick myoblasts, respectively. The fluorescent signals of Pax7-EGFP fusion protein and Pax7–2-EGFP fusion protein in transfected myoblasts were in the
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 2. Pax7–2 localized in the nucleus of chick myoblast. Myoblast was transfected with mock transfection (a, b, c, d), pEGFPN1(e, f, g, h), pEGFP-N1-Pax7–2(i, j, k, l), or pEGFP-N1-Pax7 (m, n, o, p). Mock transfection means myoblast transfected with no vectors but only Lipofectamine 2000. Image was under white light(a, e, i, m), blue light(b, f, j, n), white and blue light(c, g, k, o), or green light(d, h, l, p). Propidium iodide (PI) was used to show the nucleus of myoblast. Under blue light, green fluorescent signals of EGFP protein, Pax7-EGFP fusion protein, or Pax7–2-EGFP fusion protein could be seen. Under green light, red fluorescent signals of PI could be seen. Scale bar: 10 μm.
To amplify chick Pax7 cDNA, RT-PCR was conducted. The ~1.87-kb PCR product was inserted into pMD1 8-T and then 10 randomly picked-up plasmids were sequenced. Compared with the full-length chick Pax7 (NM_205065), 1 alternative splicing of chick Pax7, named Pax7–2, was found. Full-length chick Pax7 has 1,575 nucleotides in its CDS from position 186 to 1760, but Pax7–2 is 66 nt shorter. The 66-nt sequence from position 1332 to 1397 comes from exon 8 of the Pax7 gene. Exclusion of the 66-nt sequence leads to the deletion of 22 amino acids in Pax7–2 protein without changing the reading frame. The structures of Pax7 and Pax7–2 and the 66-nucleotide sequence were shown in Figure 1. Previous research indicated that there were alternative splicing forms of Pax7 in human and mouse. In human, the alternative splicing of Pax7 has the ninth exon compared with Pax7, which changes the C-terminal coding regions of the coded product (Barr et al., 1999). In mouse, 1 alternative splicing of Pax7 contains a hexanucleotide insertion in the paired box, 1 is about 10-bp deleted in the homeobox, and 1 only comprises the paired box (Ziman et al., 1997). In our study, the 66-bp exon absent in the alternative splicing of chick Pax7 (Pax7–2) is exon 8 of chick Pax7 gene, and there are 2 exons following it. The 66-bp exon neither belongs to the paired domain nor to the homeodomain according to the TRANSFAC database.
IDENTIFICATION OF A VARIANT FORM OF CHICK PAX7
1923
area of the nucleus, whereas the fluorescent signal of GFP protein was everywhere in transfected myoblast (Figure 2). Propidium iodide staining showed the colocalization of Pax7 isoforms and DNA. It indicated that Pax7–2 was localized in the nucleus of chick myoblast as Pax7. Although in previous studies using Pax7 antibody, Pax7 was localized in the nuclei of cells, here we first directly showed the localization of Pax7 and its alternative splicing Pax7–2 in nuclei. Furthermore, our nuclear localization of Pax7–2 indicated that the exclusion of a 66-bp exon did not influence the nuclear localization. Functional analyses of human Pax3 and Pax7 exons 6, 7, and 8 showed that they encoded transcriptional activation domains and interacted with transcriptional repression domains in N-teminal (Chalepakis et al., 1994; Bennicelli et al., 1999). Whether the 66-bp exon of chick Pax7 encodes the transcriptional activation domain should be further investigated. Because Pax7–2 retains the paired domain and homeodomain, which contains the DNA-binding domain, it may competitively bind to the downstream targeted genes of Pax7.
The Deleted 22 Amino Acids in Pax7–2 Belong to the Transactivation Domain of Pax7 To test whether the deleted 22 amino acids belong to the transactivation domain of Pax7, luciferase assays were performed in CHO cell line. As a reporter gene, 3 copies of e5 sequence were inserted into the pGL3Promoter vector. The e5 sequence was found in the Drosophila even-skipped (eve) promoter and contained the consensus-binding sequences for the paired domain
(Goulding et al., 1991; Schafer et al., 1994). Cotransfection of this reporter construct with the expression vector pEGFP-N1-Pax7 for Pax7 and pRL-TK resulted in a ~0.5-fold increase in luciferase activity (Figure 3), when compared with the expression vector pEGFP-N1 and pRL-TK. This demonstrated that chick Pax7 can act as a transactivator. However, cotransfection of this reporter construct with the expression vector pEGFPN1-Pax7–2 for Pax7–2 and pRL-TK resulted in a ~0.3fold decrease in luciferase activity (Figure 3), when compared with the expression vector pEGFP-N1 and pRL-TK. These experiments suggested that the deleted 22 amino acids may belong to the transactivation domain of Pax7. Note that the e5 site is a low-affinity site for Pax7, which may explain the relatively low transactivation by Pax7 (Schafer et al., 1994).
Expression Profile of Pax7–2 in Chick Skeletal Muscles at Different Development Stages To detect the expression levels of Pax7–2 in chick pectoralis muscle at different development stages, quantitative real-time RT-PCR was used. Muscles were prepared from d-7 to d-20 chick embryos, 1-d-old chicks, 3-wk-old chicks, and 1-yr-old chicks, respectively. Expression profile of Pax7–2 was shown in Figure 4A. Pax7–2 was expressed greatest on embryonic d 12 (P < 0.05). Compared with the expression pattern of Pax7 in Figure 4B, the expression trend of Pax7–2 was similar with Pax7, although there were some slight differences. From d 7 to 9 of incubation, the expression levels of Pax7 and Pax7–2 were almost the same everyday. Then from d 10 to d 12 of incubation, the expres-
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 3. The deleted 22 amino acids in Pax7–2 belong to the transactivation domain of Pax7. Control group = CHO cells cotransfected with pGL3-Promoter-e5, pEGFP-N1, and pRL-TK; pEGFP-N1-Pax7 group = CHO cells cotransfected with pGL3-Promoter-e5, pEGFP-N1-Pax7, and pRL-TK; pEGFP-N1-Pax7–2 group = CHO cells cotransfected with pGL3-Promoter-e5, pEGFP-N1-Pax7–2, and pRL-TK. Firefly luciferase activity was normalized by Renilla luciferase activity. Luminometer measurements (±SE) were expressed as fold of the control group. All transfection experiments were repeated 5 times.
1924
Mao et al.
sion levels of Pax7 were greater than Pax7–2. On d 12 of incubation, the expression level of Pax7 was 2-fold greater than Pax7–2, and the difference was significant (P < 0.05). We observed that the expression of Pax7 showed dramatic decline on d 13 of incubation. Although the expression of Pax7–2 also turned down on d 13 of incubation, it was greater than Pax7 (P < 0.05). From d 14 to d 16 of incubation, the expression levels of Pax7–2 were always greater than Pax7, although the difference did not reach significance. After d 16 of incubation, both Pax7 and Pax7–2 were expressed at much lower levels. In addition, on d 20 of incubation, Pax7–2 was expressed greater than Pax7, although the difference was not significant. However, 1 d later when chicks were born, the expression level of Pax7 turned up when the expression level of Pax7 turned down, and the difference was significant (P < 0.05). As chicks grew up, Pax7 and Pax7–2 were expressed at much lower
levels. This is consistent with the phenomenon that Pax7 protein expressed the strongest by 1 d posthatch and declined on d 3 and 6 to a similar level (Halevy et al., 2004). Compared with the outside environment, the environment of the embryo stage is more stable. But many inner factors could influence the expression of Pax7 and have an effect on myogenesis. Pax3 represses Pax7 during neural tube and somite development (Borycki et al., 1999). The similar expression trend of Pax7–2 and Pax7 in pectoralis muscle across the period under study may be the result of many factors working together. In conclusion, we identified an alternative splicing of chick Pax7 (Pax7–2) and localized it in the nucleus of chick myoblast. The deleted 22 amino acids in Pax7–2 may be very important for the transactivation ability of Pax7, because Pax7–2 lost the transactivation ability. Expression profiles of Pax7–2 and Pax7 in chick pecto-
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Figure 4. Quantitative real-time reverse transcription-PCR to detect the expression of Pax7 and Pax7–2 in chick pectoralis muscle at different developmental stages. The numbers 7 to 20 in the x-axis represent 7- to 20-d embryo stages, respectively; 1d in the x-axis represents 1 d of age; 3w in the x-axis represents 3 wk of age; 1y in x-axis represents 1 yr of age. Original quantities of target genes are obtained from standard curves. Quantity of interest is normalized to the quantity of GAPDH and multiplied by 106 forming new values. Three independent samples in each stage were performed in triplicate. Values on the y-axis represent the mean values (with standard errors) of target genes. (A) Pax7–2 expression levels. (B) Pax7 expression levels.
IDENTIFICATION OF A VARIANT FORM OF CHICK PAX7
ralis muscle help us know more details of them in chick development.
ACKNOWLEDGMENTS We thank Junguang He from China Agricultural University for technical help. This work is supported by the Major State Basic Research Development Program of China (2006CB102100) and National Natural Science Foundation of China (30671496).
REFERENCES
Yablonka-Reuveni. 2004. Pattern of Pax7 expression during myogenesis in the posthatch chicken establishes a model for satellite cell differentiation and renewal. Dev. Dyn. 231:489–502. Jostes, B., C. Walther, and P. Gruss. 1990. The murine paired box gene, Pax7, is expressed specifically during the development of the nervous and muscular system. Mech. Dev. 33:27–37. Kuang, S., S. B. Charge, P. Seale, M. Huh, and M. A. Rudnicki. 2006. Distinct roles for Pax7 and Pax3 in adult regenerative myogenesis. J. Cell Biol. 172:103–113. Lamey, T. M., A. Koenders, and M. Ziman. 2004. Pax genes in myogenesis: Alternate transcripts add complexity. Histol. Histopathol. 19:1289–1300. Miller, J. B., and F. E. Stockdale. 1986. Developmental regulation of the multiple cell lineages of the avian embryo. J. Cell Biol. 103:2197–2208. Otto, A., C. Schmidt, and K. Patel. 2006. Pax3 and Pax7 expression and regulation in the avian embryo. Anat. Embryol. (Berl.) 211:293–310. Oustanina, S., G. Hause, and T. Braun. 2004. Pax7 directs postnatal renewal and propagation of myogenic satellite cells but not their specification. EMBO J. 23:3430–3439. Polesskaya, A., and M. A. Rudnicki. 2002. A MyoD-dependent differentiation checkpoint: Ensuring genome integrity. Dev. Cell 3:757–758. Schafer, B. W., T. Czerny, M. Bernasconi, M. Genini, and M. Busslinger. 1994. Molecular cloning and characterization of a human PAX-7 cDNA expressed in normal and neoplastic myocytes. Nucleic Acids Res. 22:4574–4582. Schultz, E., and K. M. McCormick. 1994. Skeletal muscle satellite cells. Rev. Physiol. Biochem. Pharmacol. 123:213– 257. Smith, T. H., N. E. Block, S. J. Rhodes, S. F. Konieczny, and J. B. Miller. 1993. A unique pattern of expression of the four muscle regulatory factor proteins distinguishes somitic from embryonic, fetal and newborn mouse myogenic cells. Development 117:1125–1133. Tajbakhsh, S., and M. E. Buckingham. 2000. The birth of muscle progenitor cells in the mouse: Spatiotemporal considerations. Curr. Top. Dev. Biol. 48:225–268. Zammit, P. S., J. P. Golding, Y. Nagata, V. Hudon, T. A. Partridge, and J. R. Beauchamp. 2004. Muscle satellite cells adopt divergent fates: A mechanism for self-renewal? J. Cell Biol. 166:347–357. Ziman, M. R., S. Fletcher, and P. H. Kay. 1997. Alternate Pax7 transcripts are expressed specifically in skeletal muscle, brain and other organs of adult mice. Int. J. Biochem. Cell Biol. 29:1029–1036.
Downloaded from http://ps.oxfordjournals.org/ by guest on March 25, 2015
Barr, F. G., J. C. Fitzgerald, J. P. Ginsberg, R. J. Davis, and J. L. Bennicelli. 1999. Predominant expression of alternative Pax3 and Pax7 forms in myogenic and neural tumor cell lines. Cancer Res. 59:5443–5448. Bennicelli, J. L., S. Advani, B. W. Schafer, and F. G. Barr. 1999. Pax3 and Pax7 exhibit conserved cis-acting transcription repression domains and utilize a common gain of function mechanism in alveolar rhabdomyosarcoma. Oncogene 18:4348–4356. Bischoff, R. 1994. The satellite cell and muscle regeneration. Pages 97–118 in Myology. A. G. Engel and C. FanziniArmstrong, ed. McGraw-Hill, New York, NY. Borycki, A. G., J. Li, F. Jin, C. P. Emerson, and J. A. Epstein. 1999. Pax3 functions in cell survival and in Pax7 regulation. Development 126:1665–1674. Chalepakis, G., F. S. Jones, G. M. Edelman, and P. Gruss. 1994. Pax-3 contains domains for transcription activation and transcription inhibition. Proc. Natl. Acad. Sci. USA 91:12745–12749. Christ, B., and C. P. Ordahl. 1995. Early stages of chick somite development. Anat. Embryol. (Berl.) 191:381–396. Cossu, G., G. Ranaldi, M. I. Senni, M. Molinaro, and E. Vivarelli. 1988. ‘Early’ mammalian myoblasts are resistant to phorbol ester-induced block of differentiation. Development 102:65–69. Dahl, E., H. Koseki, and R. Balling. 1997. Pax genes and organogenesis. Bioessays 19:755–765. Goulding, M. D., G. Chalepakis, U. Deutsch, J. R. Erselius, and P. Gruss. 1991. Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J. 10:1135–1147. Halevy, O., and O. Lerman. 1993. Retinoic acid induces adult muscle cell differentiation mediated by the retinoic acid receptor-α. J. Cell. Physiol. 154:566–572. Halevy, O., Y. Piestun, M. Z. Allouh, B. W. Rosser, Y. Rinkevich, R. Reshef, I. Rozenboim, M. Wleklinski-Lee, and Z.
1925