- Email: [email protected]
Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development
Biochemical and Biophysical Research Communications xxx (2016) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development Bin Yao a, b, c, Jiangfan Xie c, Nanbo Liu d, Tao Yan e, Zhao Li a, Yufan Liu d, Sha Huang a, c, *, Xiaobing Fu a, c, ** a
Wound Healing and Cell Biology Laboratory, Institute of Basic Medical Sciences, General Hospital of PLA, Beijing 100853, PR China School of Medicine, Nankai University, Tianjin 300052, PR China Key Laboratory of Tissue Repair and Regeneration of PLA, Beijing Key Research Laboratory of Skin Injury, Repair and Regeneration, First Hospital Affiliated to General Hospital of PLA, Beijing 100048, PR China d Southern Medical University, Guangzhou 510515, PR China e Chengdu Institute of Computer Applications, Chinese Academy of Sciences, Chengdu 610041, PR China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 September 2016 Accepted 28 September 2016 Available online xxx
Sweat gland cells are responsible for the regulation of body temperature and are critical for wound repair. Furthermore, they have the regenerative potential in response to injury, and show a substantial turnover during both wound healing and homeostasis. However, as a usual research model of sweat gland, mice have not too much glandular cells for experiments. In this study, we identify previously unreported sweat gland progenitor population in mice and characterize them. The progenitor characteristics of sweat gland were confirmed using cellular immunofluorescence assay and quantitative realtime PCR assay. K8 and K18 expression was barely detected in the early stage of skin development (Embryo 17.5d) and increased to a high level at P5d (postnatal 5d), then showed reduction at adult stage (P28d). Further investigation of K8 and K18 positive cells using tissue immunofluorescence revealed the presence of sweat gland progenitors in back epidermis of mice at early stage of sweat gland development and continuous reduction during the developmental process. In vivo transplantation assay with animal models elucidated that sweat gland specific niche in paw pads was critical for the development of sweat gland cells. Although the relationship between new sweat gland progenitors and their niche still needs to be further investigated, the presence of these cells implicates that there is more source ascribed to sweat glands in addition to serving as progenitors in mice. © 2016 Elsevier Inc. All rights reserved.
Keywords: Back epidermis Sweat gland progenitors Niche Sweat gland development Wound healing
1. Introduction Sweat glands are abundant in the body and essential for thermoregulation, failure to regulate body temperature in hot climates can lead to hyperthermia, stroke, and death [1]. Several studies assumed that ESGC (eccrine sweat gland cells) show a certain capacity to form a stratified epithelium in culture and in vivo [2e4],
* Corresponding author. Wound Healing and Cell Biology Laboratory, Institute of Basic Medical Sciences, General Hospital of PLA, Beijing 100853, PR China. ** Corresponding author. Key Laboratory of Tissue Repair and Regeneration of PLA, Beijing Key Research Laboratory of Skin Injury, Repair and Regeneration, First Hospital Affiliated to General Hospital of PLA, 51 Fu Cheng Road, Beijing 100048, PR China. E-mail addresses: [email protected] (S. Huang), [email protected] (X. Fu).
which contributes significantly to skin regeneration. Most domestic mammals lack eccrine glands over most of their body surface. Mouse is the usual research model of sweat gland due to the similarity of human glandular morphology and function. However, eccrine sweat glands were long thought to be exclusively presented in the pads of their paws which posed technical impracticalities and limited resources restricted sweat glands application for wound healing research [5]. Tissue morphogenesis and the specific position information are destined in embryonic development, which depends on signals received from neighboring complex interactions between stem cells and their microenvironment-so called ‘‘niche’’ [6]. The human and animal bodies provide a large range of different niches to maintain necessary and functional cell heterogeneity [7]. Footpad of mice contains abundant eccrine units (sweat glands and ducts), whereas there are enormous hair follicles and sebaceous glands in
http://dx.doi.org/10.1016/j.bbrc.2016.09.155 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
2
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
backskin, which demonstrated that niche in distinct body sites distinguished with each other. The overall keratins expression was changed in the process of sweat gland development and K8 and K18 that highly expressed in the eccrine sweat gland specifically could be seen as the functional marker [8]. The objective of our study was to verify the additional sweat gland progenitor population in epidermis of mice and to test the essence of niche in sweat gland development. To achieve this, we isolated epidermal cells from back epidermis throughout SG (sweat gland) developmental process and detected the sweat gland biomarkers in protein and gene level. We performed tissue section and immunofluorescence to see the location of K8 and K18 positive cells of which only in epidermis and reduced during the development. Furthermore, we showed that the K8 and K18 positive cells have the capability to form sweat gland tissues engrafting to paw pads. The expression profile of K5 and K14 at protein and gene level was coincident with previous studies, which reflect the reliability of our experiments. Our findings confirmed previously unreported sweat gland progenitor population exists in mice and further provide evidence that niche plays vital role during SG development.
2. Methods and materials All animal procedures were approved under the guidelines of the Institutional Animal Care and Use Committee of Chinese PLA General Hospital (Beijing, China).
2.1. Mice C57BL/6-Tg (ACTB-EGFP) 1Osb/J mice were purchased from Jackson lab. Male and female mice were put together at night and separated in the morning and the time point was counted as 0.5d. Embryonic 17.5d (E17.5), postpartum 5d (P5) and postpartum 28d (P28) mice were picked up for experiments.
2.3. Cell immunofluorescence staining All samples were fixed in 4% paraformaldehyde for 15 mins, then permeabilized with 0.1% Triton X-100 for 15min and blocked in goat serum working solution for 1 h at room temperature. Primary antibodies were incubated in PBS overnight at 4 C and washed with PBS for 5min twice. Secondary antibodies were incubated in PBS for 2 h at room temperature. The incubated sections of antibodies were mounted by DAPI fluoromount-G (Southern Biotech, USA) and were scanned with confocal microscope (Leica, TCSSP8, Germany). Antibodies and dilutions used are as follows: K8 (rabbit, 1:300, Abcam), K5 (rabbit, 1:300, Abcam), K14 (rabbit, 1:300, Abcam), K18 (mouse, 1:300, Abcam), Goat anti Rabbit Alexa Flour 488 (1:300, Beyotime, A0423), Goat anti Mouse Alexa Flour 488 (1:300, Beyotime, A0428). The incubated antibodies cells were mounted by DAPI (1:300, Beyotime, C1002) and scanned with confocal microscope. 2.4. Tissue immunofluorescence staining All tissue sections were fixed in 10% formalin. Then the left carried out as previously described as tissue immunofluorescence staining. The incubated sections of antibodies were mounted by DAPI fluoromount-G (Southern Biotech, USA) and were scanned with confocal microscope (Leica, TCSSP8, Germany). 2.5. Quantitative real-time polymerase chain reaction (PCR) Cells were lysed in TRIzol (Invitrogen) and RNA was isolated following the manufacturing protocol. Total RNA was reversetranscribed with TaKaRa PrimeScript™ RT-PCR Kit and amplified with SYBR Premix Ex Taq™ II (TaKaRa). All primers were listed on Table 1. The PCR was performed with a Eco (illumina) system under the following procedure: initiation for 30 s at 95 C, followed by 40 thermal cycles each at 95 C for 3 s, 55 C for 30 s and 72 C for 30s, then 95 C for 15s, 65 C for 60s and 95 C for 15s. All data were analyzed with the C(t) value comparison method.
2.2. Epidermal cells and sweat gland cells isolation
2.6. Engraftment assay
Epidermal cells isolation Mice was killed and put in 75% ethanol (Beijing Chemical Works, Beijing, China) for 20 min, then cut back skin down and diced to pieces about 1 cm*1 cm. Digested the pieces in 2 mg/ml Dispase overnight at 4 C,then separated epidermis and dermis with tweezers and discard the dermis. Then epidermis was minced and placed in 0.05% Trypsin-EDTA for 20 min at 37 C. All the suspension passed the cell strainer (FALCON, 40 mm Nylon, 352340) and dropped in a 50 ml centrifuge tube to centrifuge at 1000 rpm for 5min. The pellet is epidermal cells and resuspend with Keratinocyte Serum Free Medium (GIBCO, 10724-011) and seeded on 100 mm culture plate. All operations were under sterile conditions. Sweat gland cells isolation Mice was killed and put in 75% ethanol (Beijing Chemical Works, Beijing, China) for 20 min, then foot pads were cut down and diced to pieces about 10 mm*10 mm. Digested the pieces in 2 mg/ml Collagenase I for 2 h, aspirated the sweat gland cells with micropipette (Eppendrof, Germany) and cultured in sweat gland cells specific medium at 37 C, 5%CO2. The specific medium contains 50% DMEM (Gibco, New York, NY) and 50% F12 (Gibco) supplemented with 5% fetal calf serum (Gibco), 1 mL/ 100 mL penicillin-streptomycin solution, 2 ng/mL liothyronine sodium (Gibco), 0.4 mg/mL hydrocortisone succinate (Gibco), 10 ng/ mL epidermal growth factor (Peprotech, Rocky Hill, NJ), and 1 mL/ 100 mL insulin-transferrin-selenium (Gibco). All operations were under sterile conditions.
Epidermal cells of P5-GFP-transgenic mice were isolated for transplantation as the above protocol. The GFP-labeled epidermal cells were collected when cell confluent grow up to 85e90% and injected into the paw pad of wild-type neonatal mice with Microliter™ Syringes (Hamilton, 7655-01). Then killed the wild-type mice in p28, cut their feet and fixed with 10% formalin overnight for frozen section. The section was observed with fluorescence microscope. 3. Results 3.1. Immunofluorescent staining of sweat gland specific keratins at molecular and cellular level of back epidermal cells Epidermal progenitors routinely maintain the main epidermal markers CK5 and CK14. Once the stratified epithelia differentiate into sweat gland cells, they should lose the basic epithelial markers (CK5, CK14) and gain luminal epithelial markers (CK8, CK18) [9]. According to previous research, epithelial progenitors were destined to differentiating into hair follicles and sebaceous gland in back, but grow into sweat gland in footpad [5]. In order to understand the sweat gland specific keratins at molecular and cellular level, we isolated epidermal cells or sweat gland cells at these three time points from back epidermis and foot pads for immunofluorescent staining. Expression of K5 of back epidermis cells was
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6 Table 1 Primer sequences. Primer
Sequences
b-actin-F b-actin-R
GTGGGCCGCTCTAGGCACCA TGGCCTTAGGGTTCAGGGGGG TCCAGTGTGTCCTTCCGAAGT TGCCTCCGCCAGAACTGTA TCTTGGCGGTGGTATTGGTGAT CAGGCTCTGCTCCGTCTCAAACT CTCACTAGCCCTGGCTTCAG ACAGCTGTCTCCCCGTGA TGTGACATCTTCCCTCTTCTCC TTCAACATGGGCACCAATAAAG
Cytokeratin-5(F) Cytokeratin-5(R) Cytokeratin-14(F) Cytokeratin-14(R) Cytokeratin-8 (F) Cytokeratin-8(R) Cytokeratin-18(F) Cytokeratin-18(R)
3
extracted the total RNAs of epidermal cells and sweat gland cells at different stages and performed quantitative real-time PCR. As shown in Fig. 2, K5 and K14 expression of back epidermis cells was higher than sweat gland cells, while expression of K8 and K18 of sweat gland cells was stronger across the development. K5 and K14 were increasingly expressed but K8 and K18 expression was decreased following the development process of back epidermal cells. The expression of K8 and K18 of sweat gland cells was increased from E17.5 to P28. However, K5 and K14 expression decreased to the minimum at P5 and show minor rise at P28. 3.3. Sweat gland specific keratins are present in back epithelium
completely different with K14. K5 expressed increasingly from E17.5 to P28 while K14 expression was decreased. Otherwise, K5 and K14 expression of sweat gland cells was increased following the sweat gland development (Fig. 1A and B). Compared with the rising tendency and strong expression of sweat gland cells, K8 and K18 expression showed a decrease during the development process but still weakly expressed at P28 of epidermal cells (Fig. 1C and D). Cell immunofluorescent studies of epidermal cells and sweat gland cells at E17.5, P5, and P28 revealed that keratin 8 (K8) and keratin18 (K18) expressed at the similar level during the embryonic and fetal stage, while at the adult mice, K8 and K18 expressed in sweat gland cells are higher than epidermal cells.
Fig. 3 shows the representative tissue immunofluorescence images of mice. In the back epidermis, K8 and K18 were hardly detected at E17.5, then increased sharply and expressed highly at P5, as mice developed to P28, the expression of K8 and K19 decreased to a low level. K5 and K14 expressed weakly at E17.5 and reached the peak at P5. Though decreasing at P28 but still is stronger than E17.5. Remarkably, in back epidermis, expression of K5, K14, K8 and K18 was observed in dermis and epidermis at E17.5 and P5, but only showed in epidermis at P28. In the foot pads, during the whole developmental process, the expression of K5, K14, K8 and K18 increased slowly and expressed highly at P28. Not like in back epidermis, K8 and K18 expression were observed in dermis only at P28 (see Fig. 4).
3.2. Analyses of the expression of sweat gland specific keratins by qRT-PCR
3.4. Dorsal epidermal cells transplantation to footpad involves sweat gland formation
To examine the expression of keratins of back epidermis and foot pad in gene level during the development process, we
We next asked whether sweat gland specific niche could recall the capability of adult back epidermis cells with K8 positive
Fig. 1. Expression profile of K5, K14, K8 and K18 in epidermal cells and sweat gland cells during sweat gland development. Immunofluorescent staining revealed the cellular expression of cytokeratins at different stages: (A) K5 (B) K14 (C) K8 (D) K18. All nuclei were counterstained with DAPI (DAPI: blue; K5, K14, K8, K18: red) (all bars ¼ 200 mm). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
4
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
Fig. 2. Quantitative PCR analyses of K5, K14, K8 and K18 in epidermal cells and sweat gland cells. MRNA levels of cytokeratins expression during the developmental process of eccrine sweat gland cells: (A) K5 (B) K14 (C) K8 (D) K18. The histograms show K5, K14, K8, K18 expression at differential stages by statistical analysis. (All data are consistent with statistical significance, n ¼ 3, *P < 0.05).
Fig. 3. Expression profile and location of K5, K14, K8 and K18 in back epidermis and foot pads during sweat gland development. Immunofluorescent staining revealed the location and expression of cytokeratins at different stages: (A) K5 (B) K14 (C) K8 (D) K18. All nuclei were counterstained with DAPI (DAPI: blue; K5, K14, K8, K18: red) (all bars ¼ 200 mm). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
expression, which might be sweat gland progenitors, differentiating to and forming sweat gland tissues. To examine our
hypothesis, we challenged the back epidermis cells that extracted from GFP-transgenic mice to make tissue de novo by transplanting
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
5
Fig. 4. Schematic elucidating the transplantation assay with GFP-labeled cells. Immunofluorescent staining showed the engrafting GFP-labeled epidermal cells differentiated into sweat glands 28 d later. All nuclei were counterstained with DAPI (DAPI: blue) (all bars ¼ 200 mm). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
them into foot pads of nascent wild mice. The paw pads were examined immunohistologically after 28 days the time sweat gland mature. Histology revealed that the secretory partial of sweat gland tissues were GFP labeled. This suggested that dorsal epidermal cells were sweat gland progenitors and they couldn't develop into sweat glands tissue because of niche deficiency.
4. Discussion Eccrine sweat gland cells are the most abundant appendages in the human skin and sweating plays important role in regulating body temperature. Patients who loss of sweating function suffer danger of heat stroke, potentially death [10]. Therefore, there is an urge need to develop effective sweat gland regeneration strategies. Surprisingly, in large scale skin wound repair using skin grafting, sweat gland cells do not regenerate. In the opposite, some researchers claimed that sweat gland cells could develop into a functional stratified, interfollicular epidermis in vivo and eccrine sweat glands would reconstitute new epidermis after wounding in humans. The mechanism underlying the observed reprogram process might be responsible for dysfunctional interconversion between sweat gland cells and epidermal cells during wound healing. However, as the most promising animal mode for study of sweat gland behaviors, the specific biomarkers and morphology of sweat gland cells only could be detected in paw pads in mature mice, the position that are difficult to perform in vivo experiment and scanty for isolation [5]. In our study, we found that sweat gland specific
biomarkers showed in back epidermis in mice suggesting dorsal epidermal stem cells have differentiated into eccrine sweat gland progenitors at the early stage but failed to develop into sweat gland in the end. In order to validate this and pursue the developmental process, we investigated the changes of keratins expression in bud stage, neonatal and adult stage (E17.5, P5, P28) at telar, cellular and molecular level. Our results showed that K8 and K18 were mainly expressed in secretary portion of sweat gland and the expression of K8 and K18 has been reported upregulated from E17.5 to P28 at both gene and protein level. Compared to the foot pads, significantly decreased expression of K8 and K18 was observed in back epidermis during the skin appendages development, which is coincide with the epidermal cells examination in vitro. These results implicated that there may be another sweat gland progenitors population in back. K5 and K14 were expressed in both epidermis and sweat glands and showed the similar trends to present study, which suggested that the reliability and reality of our founding [11]. Secretary partial of sweat gland of paw pads accepted foreign cells showed GFP expression, further convincing the back epidermal cells was sweat gland progenitors and could form sweat gland in the right niche. Cell contact, molecular signals and mechanical force are crucial to initiate the sweat gland budding and continuous development through activating related gene expression of stem cells. Tissue morphogenesis is finally determined by the combination of external stimulus and intrinsic gene identity. These suggesting that niche might be the reason why sweat gland cells could not regenerate in large scale wounding healing by skin
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
6
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
grafting. We assumed the driver of sweat gland cells differentiation was lost in pathological skin niche. In summary, our founding revealed the characteristic of keratins expression during skin development at foot pads and back epidermis and we found a novel sweat gland progenitor population in back epidermis of mice which has never been reported and turned out that niche was indispensible for sweat gland development. Additionally, our findings would provide a novel resource of sweat gland progenitors and implied niche may be responsible for the deficiency of sweat gland cells in pathological skin such as scar. Competing interest statement The authors declare that they have no competing financial interests. Acknowledgments This paper was supported in part by the National Nature Science Foundation of China (81121004, 81230041, 81372066) and Science and Technology Innovation Nursery Foundation of General Hospital of PLA (16KMM41). Transparency document Transparency document related to this article can be found
online at http://dx.doi.org/10.1016/j.bbrc.2016.09.155.
References [1] W.P. Cheshire, R. Freeman, Disorders of sweating, Semin. Neurol. 23 (2003) 399e406. [2] K. Sato, T.B. Fitzpatrick, A.Z. Eisen, K. Wolff, I.M. Freedberg, K.F. Austen, Biology of the eccrine sweat gland, in: Dermatology in Medicine, McGraw-Hill, New York, 1993, pp. 221e241. , D.L. Sachs, J.S. Orringer, J.J. Voorhees, G.J. Fisher, Eccrine sweat glands [3] L. Rittie are major contributors to reepithelialization of human wounds, Am. J. Pathol. 182 (2013) 163e171. €ttcher-Haberzeth, S. Tharakan, E. Braziulis, [4] T. Biedermann, L. Pontiggia, S. Bo C. Schiestl, et al., Human eccrine sweat gland cells can reconstitute a stratified epidermis, J. Investig. Dermatol. 130 (2010) 1996e2009. [5] C.P. Lu, L. Polak, A.S. Rocha, H.A. Pasolli, S.-C. Chen, N. Sharma, et al., Identification of stem cell populations in sweat glands and ducts reveals roles in homeostasis and wound repair, Cell 150 (2012) 136e150. [6] D.T. Scadden, Nice neighborhood: emerging concepts of the stem cell niche, Cell 157 (2014) 41e50. [7] K.A. Moore, I.R. Lemischka, Science 311 (2006) 1880. [8] J. Xie, B. Yao, Y. Han, T. Shang, D. Gao, S. Yang, et al., Cytokeratin expression at different stages in sweat gland development of C57BL/6J mice, Int. J. Low. Extrem. Wounds 14 (2015) 365e371. [9] S. Huang, B. Yao, J.F. Xie, X.B. Fu, 3D bioprinted extracellular matrix mimics facilitate directed differentiation of epithelial progenitors for sweat gland regeneration, Acta Biomater. 33 (2016) 170e177. [10] C. Lu, E. Fuchs, Sweat gland progenitors in development, homeostasis, and wound repair, Cold Spring Harb. Perspect. Med. 4 (2014) pii: a015222. [11] D.K. Taylor, J.A. Bubier, K.A. Silva, J.P. Sundberg, Development, structure, and keratin expression in C57BL/6J mouse eccrine glands, Vet. Pathol. 49 (2011) 146e154.
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development Bin Yao a, b, c, Jiangfan Xie c, Nanbo Liu d, Tao Yan e, Zhao Li a, Yufan Liu d, Sha Huang a, c, *, Xiaobing Fu a, c, ** a
Wound Healing and Cell Biology Laboratory, Institute of Basic Medical Sciences, General Hospital of PLA, Beijing 100853, PR China School of Medicine, Nankai University, Tianjin 300052, PR China Key Laboratory of Tissue Repair and Regeneration of PLA, Beijing Key Research Laboratory of Skin Injury, Repair and Regeneration, First Hospital Affiliated to General Hospital of PLA, Beijing 100048, PR China d Southern Medical University, Guangzhou 510515, PR China e Chengdu Institute of Computer Applications, Chinese Academy of Sciences, Chengdu 610041, PR China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 September 2016 Accepted 28 September 2016 Available online xxx
Sweat gland cells are responsible for the regulation of body temperature and are critical for wound repair. Furthermore, they have the regenerative potential in response to injury, and show a substantial turnover during both wound healing and homeostasis. However, as a usual research model of sweat gland, mice have not too much glandular cells for experiments. In this study, we identify previously unreported sweat gland progenitor population in mice and characterize them. The progenitor characteristics of sweat gland were confirmed using cellular immunofluorescence assay and quantitative realtime PCR assay. K8 and K18 expression was barely detected in the early stage of skin development (Embryo 17.5d) and increased to a high level at P5d (postnatal 5d), then showed reduction at adult stage (P28d). Further investigation of K8 and K18 positive cells using tissue immunofluorescence revealed the presence of sweat gland progenitors in back epidermis of mice at early stage of sweat gland development and continuous reduction during the developmental process. In vivo transplantation assay with animal models elucidated that sweat gland specific niche in paw pads was critical for the development of sweat gland cells. Although the relationship between new sweat gland progenitors and their niche still needs to be further investigated, the presence of these cells implicates that there is more source ascribed to sweat glands in addition to serving as progenitors in mice. © 2016 Elsevier Inc. All rights reserved.
Keywords: Back epidermis Sweat gland progenitors Niche Sweat gland development Wound healing
1. Introduction Sweat glands are abundant in the body and essential for thermoregulation, failure to regulate body temperature in hot climates can lead to hyperthermia, stroke, and death [1]. Several studies assumed that ESGC (eccrine sweat gland cells) show a certain capacity to form a stratified epithelium in culture and in vivo [2e4],
* Corresponding author. Wound Healing and Cell Biology Laboratory, Institute of Basic Medical Sciences, General Hospital of PLA, Beijing 100853, PR China. ** Corresponding author. Key Laboratory of Tissue Repair and Regeneration of PLA, Beijing Key Research Laboratory of Skin Injury, Repair and Regeneration, First Hospital Affiliated to General Hospital of PLA, 51 Fu Cheng Road, Beijing 100048, PR China. E-mail addresses: [email protected] (S. Huang), [email protected] (X. Fu).
which contributes significantly to skin regeneration. Most domestic mammals lack eccrine glands over most of their body surface. Mouse is the usual research model of sweat gland due to the similarity of human glandular morphology and function. However, eccrine sweat glands were long thought to be exclusively presented in the pads of their paws which posed technical impracticalities and limited resources restricted sweat glands application for wound healing research [5]. Tissue morphogenesis and the specific position information are destined in embryonic development, which depends on signals received from neighboring complex interactions between stem cells and their microenvironment-so called ‘‘niche’’ [6]. The human and animal bodies provide a large range of different niches to maintain necessary and functional cell heterogeneity [7]. Footpad of mice contains abundant eccrine units (sweat glands and ducts), whereas there are enormous hair follicles and sebaceous glands in
http://dx.doi.org/10.1016/j.bbrc.2016.09.155 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
2
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
backskin, which demonstrated that niche in distinct body sites distinguished with each other. The overall keratins expression was changed in the process of sweat gland development and K8 and K18 that highly expressed in the eccrine sweat gland specifically could be seen as the functional marker [8]. The objective of our study was to verify the additional sweat gland progenitor population in epidermis of mice and to test the essence of niche in sweat gland development. To achieve this, we isolated epidermal cells from back epidermis throughout SG (sweat gland) developmental process and detected the sweat gland biomarkers in protein and gene level. We performed tissue section and immunofluorescence to see the location of K8 and K18 positive cells of which only in epidermis and reduced during the development. Furthermore, we showed that the K8 and K18 positive cells have the capability to form sweat gland tissues engrafting to paw pads. The expression profile of K5 and K14 at protein and gene level was coincident with previous studies, which reflect the reliability of our experiments. Our findings confirmed previously unreported sweat gland progenitor population exists in mice and further provide evidence that niche plays vital role during SG development.
2. Methods and materials All animal procedures were approved under the guidelines of the Institutional Animal Care and Use Committee of Chinese PLA General Hospital (Beijing, China).
2.1. Mice C57BL/6-Tg (ACTB-EGFP) 1Osb/J mice were purchased from Jackson lab. Male and female mice were put together at night and separated in the morning and the time point was counted as 0.5d. Embryonic 17.5d (E17.5), postpartum 5d (P5) and postpartum 28d (P28) mice were picked up for experiments.
2.3. Cell immunofluorescence staining All samples were fixed in 4% paraformaldehyde for 15 mins, then permeabilized with 0.1% Triton X-100 for 15min and blocked in goat serum working solution for 1 h at room temperature. Primary antibodies were incubated in PBS overnight at 4 C and washed with PBS for 5min twice. Secondary antibodies were incubated in PBS for 2 h at room temperature. The incubated sections of antibodies were mounted by DAPI fluoromount-G (Southern Biotech, USA) and were scanned with confocal microscope (Leica, TCSSP8, Germany). Antibodies and dilutions used are as follows: K8 (rabbit, 1:300, Abcam), K5 (rabbit, 1:300, Abcam), K14 (rabbit, 1:300, Abcam), K18 (mouse, 1:300, Abcam), Goat anti Rabbit Alexa Flour 488 (1:300, Beyotime, A0423), Goat anti Mouse Alexa Flour 488 (1:300, Beyotime, A0428). The incubated antibodies cells were mounted by DAPI (1:300, Beyotime, C1002) and scanned with confocal microscope. 2.4. Tissue immunofluorescence staining All tissue sections were fixed in 10% formalin. Then the left carried out as previously described as tissue immunofluorescence staining. The incubated sections of antibodies were mounted by DAPI fluoromount-G (Southern Biotech, USA) and were scanned with confocal microscope (Leica, TCSSP8, Germany). 2.5. Quantitative real-time polymerase chain reaction (PCR) Cells were lysed in TRIzol (Invitrogen) and RNA was isolated following the manufacturing protocol. Total RNA was reversetranscribed with TaKaRa PrimeScript™ RT-PCR Kit and amplified with SYBR Premix Ex Taq™ II (TaKaRa). All primers were listed on Table 1. The PCR was performed with a Eco (illumina) system under the following procedure: initiation for 30 s at 95 C, followed by 40 thermal cycles each at 95 C for 3 s, 55 C for 30 s and 72 C for 30s, then 95 C for 15s, 65 C for 60s and 95 C for 15s. All data were analyzed with the C(t) value comparison method.
2.2. Epidermal cells and sweat gland cells isolation
2.6. Engraftment assay
Epidermal cells isolation Mice was killed and put in 75% ethanol (Beijing Chemical Works, Beijing, China) for 20 min, then cut back skin down and diced to pieces about 1 cm*1 cm. Digested the pieces in 2 mg/ml Dispase overnight at 4 C,then separated epidermis and dermis with tweezers and discard the dermis. Then epidermis was minced and placed in 0.05% Trypsin-EDTA for 20 min at 37 C. All the suspension passed the cell strainer (FALCON, 40 mm Nylon, 352340) and dropped in a 50 ml centrifuge tube to centrifuge at 1000 rpm for 5min. The pellet is epidermal cells and resuspend with Keratinocyte Serum Free Medium (GIBCO, 10724-011) and seeded on 100 mm culture plate. All operations were under sterile conditions. Sweat gland cells isolation Mice was killed and put in 75% ethanol (Beijing Chemical Works, Beijing, China) for 20 min, then foot pads were cut down and diced to pieces about 10 mm*10 mm. Digested the pieces in 2 mg/ml Collagenase I for 2 h, aspirated the sweat gland cells with micropipette (Eppendrof, Germany) and cultured in sweat gland cells specific medium at 37 C, 5%CO2. The specific medium contains 50% DMEM (Gibco, New York, NY) and 50% F12 (Gibco) supplemented with 5% fetal calf serum (Gibco), 1 mL/ 100 mL penicillin-streptomycin solution, 2 ng/mL liothyronine sodium (Gibco), 0.4 mg/mL hydrocortisone succinate (Gibco), 10 ng/ mL epidermal growth factor (Peprotech, Rocky Hill, NJ), and 1 mL/ 100 mL insulin-transferrin-selenium (Gibco). All operations were under sterile conditions.
Epidermal cells of P5-GFP-transgenic mice were isolated for transplantation as the above protocol. The GFP-labeled epidermal cells were collected when cell confluent grow up to 85e90% and injected into the paw pad of wild-type neonatal mice with Microliter™ Syringes (Hamilton, 7655-01). Then killed the wild-type mice in p28, cut their feet and fixed with 10% formalin overnight for frozen section. The section was observed with fluorescence microscope. 3. Results 3.1. Immunofluorescent staining of sweat gland specific keratins at molecular and cellular level of back epidermal cells Epidermal progenitors routinely maintain the main epidermal markers CK5 and CK14. Once the stratified epithelia differentiate into sweat gland cells, they should lose the basic epithelial markers (CK5, CK14) and gain luminal epithelial markers (CK8, CK18) [9]. According to previous research, epithelial progenitors were destined to differentiating into hair follicles and sebaceous gland in back, but grow into sweat gland in footpad [5]. In order to understand the sweat gland specific keratins at molecular and cellular level, we isolated epidermal cells or sweat gland cells at these three time points from back epidermis and foot pads for immunofluorescent staining. Expression of K5 of back epidermis cells was
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6 Table 1 Primer sequences. Primer
Sequences
b-actin-F b-actin-R
GTGGGCCGCTCTAGGCACCA TGGCCTTAGGGTTCAGGGGGG TCCAGTGTGTCCTTCCGAAGT TGCCTCCGCCAGAACTGTA TCTTGGCGGTGGTATTGGTGAT CAGGCTCTGCTCCGTCTCAAACT CTCACTAGCCCTGGCTTCAG ACAGCTGTCTCCCCGTGA TGTGACATCTTCCCTCTTCTCC TTCAACATGGGCACCAATAAAG
Cytokeratin-5(F) Cytokeratin-5(R) Cytokeratin-14(F) Cytokeratin-14(R) Cytokeratin-8 (F) Cytokeratin-8(R) Cytokeratin-18(F) Cytokeratin-18(R)
3
extracted the total RNAs of epidermal cells and sweat gland cells at different stages and performed quantitative real-time PCR. As shown in Fig. 2, K5 and K14 expression of back epidermis cells was higher than sweat gland cells, while expression of K8 and K18 of sweat gland cells was stronger across the development. K5 and K14 were increasingly expressed but K8 and K18 expression was decreased following the development process of back epidermal cells. The expression of K8 and K18 of sweat gland cells was increased from E17.5 to P28. However, K5 and K14 expression decreased to the minimum at P5 and show minor rise at P28. 3.3. Sweat gland specific keratins are present in back epithelium
completely different with K14. K5 expressed increasingly from E17.5 to P28 while K14 expression was decreased. Otherwise, K5 and K14 expression of sweat gland cells was increased following the sweat gland development (Fig. 1A and B). Compared with the rising tendency and strong expression of sweat gland cells, K8 and K18 expression showed a decrease during the development process but still weakly expressed at P28 of epidermal cells (Fig. 1C and D). Cell immunofluorescent studies of epidermal cells and sweat gland cells at E17.5, P5, and P28 revealed that keratin 8 (K8) and keratin18 (K18) expressed at the similar level during the embryonic and fetal stage, while at the adult mice, K8 and K18 expressed in sweat gland cells are higher than epidermal cells.
Fig. 3 shows the representative tissue immunofluorescence images of mice. In the back epidermis, K8 and K18 were hardly detected at E17.5, then increased sharply and expressed highly at P5, as mice developed to P28, the expression of K8 and K19 decreased to a low level. K5 and K14 expressed weakly at E17.5 and reached the peak at P5. Though decreasing at P28 but still is stronger than E17.5. Remarkably, in back epidermis, expression of K5, K14, K8 and K18 was observed in dermis and epidermis at E17.5 and P5, but only showed in epidermis at P28. In the foot pads, during the whole developmental process, the expression of K5, K14, K8 and K18 increased slowly and expressed highly at P28. Not like in back epidermis, K8 and K18 expression were observed in dermis only at P28 (see Fig. 4).
3.2. Analyses of the expression of sweat gland specific keratins by qRT-PCR
3.4. Dorsal epidermal cells transplantation to footpad involves sweat gland formation
To examine the expression of keratins of back epidermis and foot pad in gene level during the development process, we
We next asked whether sweat gland specific niche could recall the capability of adult back epidermis cells with K8 positive
Fig. 1. Expression profile of K5, K14, K8 and K18 in epidermal cells and sweat gland cells during sweat gland development. Immunofluorescent staining revealed the cellular expression of cytokeratins at different stages: (A) K5 (B) K14 (C) K8 (D) K18. All nuclei were counterstained with DAPI (DAPI: blue; K5, K14, K8, K18: red) (all bars ¼ 200 mm). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
4
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
Fig. 2. Quantitative PCR analyses of K5, K14, K8 and K18 in epidermal cells and sweat gland cells. MRNA levels of cytokeratins expression during the developmental process of eccrine sweat gland cells: (A) K5 (B) K14 (C) K8 (D) K18. The histograms show K5, K14, K8, K18 expression at differential stages by statistical analysis. (All data are consistent with statistical significance, n ¼ 3, *P < 0.05).
Fig. 3. Expression profile and location of K5, K14, K8 and K18 in back epidermis and foot pads during sweat gland development. Immunofluorescent staining revealed the location and expression of cytokeratins at different stages: (A) K5 (B) K14 (C) K8 (D) K18. All nuclei were counterstained with DAPI (DAPI: blue; K5, K14, K8, K18: red) (all bars ¼ 200 mm). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
expression, which might be sweat gland progenitors, differentiating to and forming sweat gland tissues. To examine our
hypothesis, we challenged the back epidermis cells that extracted from GFP-transgenic mice to make tissue de novo by transplanting
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
5
Fig. 4. Schematic elucidating the transplantation assay with GFP-labeled cells. Immunofluorescent staining showed the engrafting GFP-labeled epidermal cells differentiated into sweat glands 28 d later. All nuclei were counterstained with DAPI (DAPI: blue) (all bars ¼ 200 mm). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
them into foot pads of nascent wild mice. The paw pads were examined immunohistologically after 28 days the time sweat gland mature. Histology revealed that the secretory partial of sweat gland tissues were GFP labeled. This suggested that dorsal epidermal cells were sweat gland progenitors and they couldn't develop into sweat glands tissue because of niche deficiency.
4. Discussion Eccrine sweat gland cells are the most abundant appendages in the human skin and sweating plays important role in regulating body temperature. Patients who loss of sweating function suffer danger of heat stroke, potentially death [10]. Therefore, there is an urge need to develop effective sweat gland regeneration strategies. Surprisingly, in large scale skin wound repair using skin grafting, sweat gland cells do not regenerate. In the opposite, some researchers claimed that sweat gland cells could develop into a functional stratified, interfollicular epidermis in vivo and eccrine sweat glands would reconstitute new epidermis after wounding in humans. The mechanism underlying the observed reprogram process might be responsible for dysfunctional interconversion between sweat gland cells and epidermal cells during wound healing. However, as the most promising animal mode for study of sweat gland behaviors, the specific biomarkers and morphology of sweat gland cells only could be detected in paw pads in mature mice, the position that are difficult to perform in vivo experiment and scanty for isolation [5]. In our study, we found that sweat gland specific
biomarkers showed in back epidermis in mice suggesting dorsal epidermal stem cells have differentiated into eccrine sweat gland progenitors at the early stage but failed to develop into sweat gland in the end. In order to validate this and pursue the developmental process, we investigated the changes of keratins expression in bud stage, neonatal and adult stage (E17.5, P5, P28) at telar, cellular and molecular level. Our results showed that K8 and K18 were mainly expressed in secretary portion of sweat gland and the expression of K8 and K18 has been reported upregulated from E17.5 to P28 at both gene and protein level. Compared to the foot pads, significantly decreased expression of K8 and K18 was observed in back epidermis during the skin appendages development, which is coincide with the epidermal cells examination in vitro. These results implicated that there may be another sweat gland progenitors population in back. K5 and K14 were expressed in both epidermis and sweat glands and showed the similar trends to present study, which suggested that the reliability and reality of our founding [11]. Secretary partial of sweat gland of paw pads accepted foreign cells showed GFP expression, further convincing the back epidermal cells was sweat gland progenitors and could form sweat gland in the right niche. Cell contact, molecular signals and mechanical force are crucial to initiate the sweat gland budding and continuous development through activating related gene expression of stem cells. Tissue morphogenesis is finally determined by the combination of external stimulus and intrinsic gene identity. These suggesting that niche might be the reason why sweat gland cells could not regenerate in large scale wounding healing by skin
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155
6
B. Yao et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e6
grafting. We assumed the driver of sweat gland cells differentiation was lost in pathological skin niche. In summary, our founding revealed the characteristic of keratins expression during skin development at foot pads and back epidermis and we found a novel sweat gland progenitor population in back epidermis of mice which has never been reported and turned out that niche was indispensible for sweat gland development. Additionally, our findings would provide a novel resource of sweat gland progenitors and implied niche may be responsible for the deficiency of sweat gland cells in pathological skin such as scar. Competing interest statement The authors declare that they have no competing financial interests. Acknowledgments This paper was supported in part by the National Nature Science Foundation of China (81121004, 81230041, 81372066) and Science and Technology Innovation Nursery Foundation of General Hospital of PLA (16KMM41). Transparency document Transparency document related to this article can be found
online at http://dx.doi.org/10.1016/j.bbrc.2016.09.155.
References [1] W.P. Cheshire, R. Freeman, Disorders of sweating, Semin. Neurol. 23 (2003) 399e406. [2] K. Sato, T.B. Fitzpatrick, A.Z. Eisen, K. Wolff, I.M. Freedberg, K.F. Austen, Biology of the eccrine sweat gland, in: Dermatology in Medicine, McGraw-Hill, New York, 1993, pp. 221e241. , D.L. Sachs, J.S. Orringer, J.J. Voorhees, G.J. Fisher, Eccrine sweat glands [3] L. Rittie are major contributors to reepithelialization of human wounds, Am. J. Pathol. 182 (2013) 163e171. €ttcher-Haberzeth, S. Tharakan, E. Braziulis, [4] T. Biedermann, L. Pontiggia, S. Bo C. Schiestl, et al., Human eccrine sweat gland cells can reconstitute a stratified epidermis, J. Investig. Dermatol. 130 (2010) 1996e2009. [5] C.P. Lu, L. Polak, A.S. Rocha, H.A. Pasolli, S.-C. Chen, N. Sharma, et al., Identification of stem cell populations in sweat glands and ducts reveals roles in homeostasis and wound repair, Cell 150 (2012) 136e150. [6] D.T. Scadden, Nice neighborhood: emerging concepts of the stem cell niche, Cell 157 (2014) 41e50. [7] K.A. Moore, I.R. Lemischka, Science 311 (2006) 1880. [8] J. Xie, B. Yao, Y. Han, T. Shang, D. Gao, S. Yang, et al., Cytokeratin expression at different stages in sweat gland development of C57BL/6J mice, Int. J. Low. Extrem. Wounds 14 (2015) 365e371. [9] S. Huang, B. Yao, J.F. Xie, X.B. Fu, 3D bioprinted extracellular matrix mimics facilitate directed differentiation of epithelial progenitors for sweat gland regeneration, Acta Biomater. 33 (2016) 170e177. [10] C. Lu, E. Fuchs, Sweat gland progenitors in development, homeostasis, and wound repair, Cold Spring Harb. Perspect. Med. 4 (2014) pii: a015222. [11] D.K. Taylor, J.A. Bubier, K.A. Silva, J.P. Sundberg, Development, structure, and keratin expression in C57BL/6J mouse eccrine glands, Vet. Pathol. 49 (2011) 146e154.
Please cite this article in press as: B. Yao, et al., Identification of a new sweat gland progenitor population in mice and the role of their niche in tissue development, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.155