- Email: [email protected]
Identification of Human Genes Related to Olfactory-Specific CYP2G1
JOBNAME: 218#2 PAGE: 1 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
218, 570–574 (1996)
Article No. 0101
Identification of Human Genes Related to Olfactory-Specific CYP2G1 Jiangjun Sheng and Xinxin Ding1 Wadsworth Center, New York State Department of Health, Albany, NY 12201 Received December 6, 1995 CYP2G1, which is uniquely expressed in the olfactory mucosa of rats and rabbits, may have functions important for the olfactory chemosensory system. The aim of the present study is to determine whether CYP2G genes are present in the human genome. Several gene fragments were obtained by PCR amplification of human genomic DNA. One fragment, termed E7, which contained an open reading frame for 44 amino acids, is highly homologous in deduced amino acid sequence to residues 322-375 in rabbit or rat CYP2G1. Three other gene fragments, termed E7-8, H2Gpl and H2Gp2, respectively, were also obtained and found to have structural homology with coding sequences in the rat CYP2G1 gene. RNA-PCR analysis of human nasal RNA indicated that at least one CYP2G gene is transcribed. Southern blot analysis of human genomic DNA with use of cloned E7 or E7-8 as the probe indicated that more than one CYP2G-related gene may be present in the human genome. These results provide a basis for further characterization of the structure and function of the human CYP2G genes. © 1996 Academic Press, Inc.
CYP2G1 is an abundant enzyme expressed specifically in the olfactory mucosa of mammalian species and is believed to have physiological functions important for the olfactory chemosensory system (2–13). The primary structures of rabbit and rat CYP2G1 have been determined by cDNA cloning (3,6), and the gene structure for rat CYP2G1 has also been determined (5). Recent immunohistochemical studies with an antibody to rabbit CYP2G1 did not detect immunoreactivity in human olfactory mucosa (14), raising the question of whether the CYP2G1 gene is present in the human genome. Should a comparable human gene exist, it is important to determine to what extent it resembles the animal orthologs in structure, activity, and regulation. In the present study, PCR primers were designed based on conserved sequences between rat and rabbit CYP2G1 cDNAs, and PCR was performed with human genomic DNA as the template. The PCR products with sequence homology to CYP2G1, as detected by Southern blot analysis with rabbit CYP2G1 cDNA, were subcloned and their sequences determined. Genomic Southern blot analysis with the cloned human DNA probes was carried out to estimate the copy number of the CYP2G-related genes in the human genome, and expression of the human CYP2G genes was studied by RNA-PCR analysis of human nasal RNA. METHODS PCR analysis of human genomic DNA. Genomic DNA from human placental tissue was obtained from Clontech and used for PCR amplification of CYP2G-related fragments. PCR was carried out in a Perkin Elmer thermal cycler 9600 instrument with the following temperature conditions: annealing, 58°C, 15 sec, extension, 72°C, 2 min, and denaturation, 94°C, 15 sec, for 35 cycles. The primers used, which were synthesized in the molecular genetics core of the Wadsworth Center, corresponded to nucleotides 49–72 and 283–305, respectively (for H2Gpl and H2Gp2), 974–993 and 1126–1149, respectively (for E7), and 1126–1149 and 1186–1215, respectively (for E7–8), in rat CYP2G1 cDNA (3). PCR products (10 ml each) were submitted to electrophoresis in a 1% agarose gel, transferred to nylon membrane by pressure blotting, fixed by UV irradiation, hybridized with fluorescein-labeled SmaI restriction fragments of rabbit CYP2G1 cDNA (6), and detected with the Illuminator Nonradioactive Detection System from Stratagene. Positive PCR products were subcloned into pCR-script vector (Stratagene) and sequenced with both M13 primer and the PCR primers with use of a PCR sequencing kit from Perkin Elmer or with an automated DNA sequencer from Applied Biosystems, Model 373A, at the molecular 1
To whom correspondence should be addressed. Fax: (518)486-1505. Abbreviations: CYP2G1, cytochrome P450 isoform 2G1 (see Ref. 1 for an updated list of P450 nomenclature); and PCR, polymerase chain reaction. 570 0006-291X/96 $12.00 Copyright © 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
JOBNAME: 218#2 PAGE: 2 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
genetics core of the Wadsworth Center. Each position was analyzed at least three times and the sequences of both strands were determined. Southern blot analysis of human genomic DNA. Geno-blot containing restriction-digested human placental genomic DNA (8 mg each lane) was obtained from Clontech. Genomic DNA from the autopsy liver samples of two male subjects (kindly provided by Dr. Robert Jansing of the Wadsworth Center) or from the placental tissue of a different donor (obtained from Clontech) were subjected to restriction digest with BamHI, BglI, EcoRI, HindIII, or Pst I and submitted to Southern blot analysis as described above, with [32P]-labeled E7 or E7–8 as the probe. PCR analysis of human nasal RNA. Total RNA from autopsy samples of human nasal turbinate (obtained from the International Institute for the Advancement of Medicine) was isolated with TRI Reagent from Molecular Research Center (Cincinnati). Contaminating genomic DNA was removed by treatment with RNase-free DNase (Boehringer Mannheim). RNA-PCR was carried out with use of a kit from Perkin Elmer. First strand cDNA was synthesized with an oligo d(T)16 primer. PCR primers (59ccaagtgattggaccacaccg39 and 59 gcaggggaaatacatctgtgc39), which amplify a 200-bp fragment from human CYP2G1 cDNA and a 300-bp fragment from the human CYP2G1 gene, were designed according to the sequence of E7 and E7–8. PCR products (5ml each) were submitted to electrophoresis in a 1.5% agarose gel, transferred to nylon membrane, and hybridized with a [32P]-labeled oligonucleotide probe (59caagggtggatgaccgggt39) complementary to E7 sequence.
RESULTS AND DISCUSSION To identify and characterize CYP2G1-related genes in the human genome, PCR primers were designed based on conserved sequences in rat and rabbit CYP2G1 cDNA and used to amplify orthologous sequences from human genomic DNA. Sequence analysis of the PCR products identified a DNA fragment, designated E7, which is 132 bp in length and aligned with the nucleic acid sequence of exon 7 of the rat CYP2G1 gene (5). As shown in Fig. 1, E7 contains an open reading frame for 44 amino acids and is highly homologous in deduced amino acid sequence to residues 332–375 in rabbit CYP2G1 (89% identity) or rat CYP2G1 (86% identity). Subsequent Southern blot analysis of restriction-digested genomic DNA from a female subject with radiolabeled E7 probe detected two fragments each in four of the five reaction mixtures (Fig. 2), even though none of the restriction sites are present in the E7 sequence. The same hybridization results were obtained with genomic DNA from a second female and two male subjects (not shown). Thus, there may be at least two unique CYP2G-related genes in the human genome. Since the same hybridization patterns were found in four different individuals, two male and two females, these two genes are probably not allelic variants, but represent different genetic loci. A second PCR fragment, designated E7–8, was identified, which apparently contains a short intron and adjoining coding sequences that aligned with the 7th and 8th exons, respectively, of the
FIG. 1. Nucleotide and deduced amino acid sequence of human genomic DNA fragment E7. Nucleotide sequence of E7 is shown on the top, and the deduced amino acid sequence is shown below. The amino acid residues of rat and rabbit CYP2G1 that are different from those of E7 are shown at the bottom. Numbers underneath amino acid sequences indicate positions relative to the amino terminus of the rat or rabbit CYP2G1 protein. 571
JOBNAME: 218#2 PAGE: 3 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Southern blot analysis of human genomic DNA. Restriction-digested human genomic DNA (8mg each lane) was submitted to Southern blot analysis as described in Methods. Hybridization was carried out for 2 hr at 58°C with [32P]-labeled human genomic DNA fragment E7 in Stratagene Quikhyb hybridization solution. The positions of selected fragments of the Lambda/Hind III DNA size marker and the restriction enzymes used are indicated.
rat CYP2G1 gene, as shown in Fig. 3. Southern blot analysis of restriction-digested human genomic DNA with radiolabeled E7–8 probe revealed the same results as obtained with E7 probe (not shown), confirming that at least two genes are present in the human CYP2G subfamily. None of the restriction sites analyzed is present in E7–8 sequence either. Two other PCR fragments, designated H2Gp1 and H2Gp2, were obtained with a set of primers that correspond to sequences in the first and second exon, respectively, of the rat CYP2G1 gene. The two fragments, both about 850 bp in length, aligned with sequences flanking the intron between exons 1 and 2 in the rat CYP2G1 gene and are highly homologous in deduced amino acid sequence to residues 25–94 of rabbit and rat CYP2G1 (Fig. 4). However, H2Gp2 contains a termination codon near the 59-end of the coding region, as a result of a C→T change (Fig. 4). A termination codon is also present in the same region in the other two reading frames in H2Gp2 sequence (not shown). Similarly, a single nucleotide deletion in the predicted coding region of H2Gp1 results in a shift to a different reading frame with two adjacent termination codons. Thus, H2Gp1 and H2Gp2 may be derived from two pseudogenes in the human CYP2G subfamily. It
FIG. 3. Alignment of nucleotide and deduced amino acid sequences of the coding region of human genomic DNA fragment E7–8 with those of rat CYP2G1 gene. Nucleotide sequences in the coding region are shown in uppercase, whereas those in the intron are shown in lowercase. Numbers in parentheses indicate the length of the intron. Numbers underneath amino acid sequence indicate positions relative to the amino terminus of the CYP2G1 protein. 572
JOBNAME: 218#2 PAGE: 4 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Nucleotide and deduced amino acid sequences of the predicted coding region of human genomic DNA fragments H2Gp1 and H2Gp2. Nucleotide sequences in the coding region are shown in uppercase, whereas those in the intron are shown in lowercase Numbers in parentheses indicate the approximate length of the intron. Numbers underneath amino acid sequences indicate positions relative to the amino terminus of the rat or rabbit CYP2G1 protein. “***” represents termination codon and “-” represents deletion of a nucleotide. The nucleotide and deduced amino acid sequences of H2Gp1 are shown, with the different nucleotides (above) or amino acid residues (below) in H2Gp2 indicated. The amino acid residues of rat and rabbit CYP2G1 that are different from those of H2Gp1 are also shown.
remains to be determined whether H2Gp1 and H2Gp2 are contained in the gene fragments detected in the experiment shown in Fig. 2 by Southern blot analysis. To determine whether a CYP2G-related mRNA is expressed in the human nasal mucosa, RNAPCR experiments were performed with a set of primers designed according to the sequence of E7 and E7– 8, which amplify a 200-bp fragment from human CYP2G1 cDNA or a 300-bp fragment (containing the short intron between the putative exons 7 and 8) from human genomic DNA. The PCR products were detected by Southern blot analysis with an oligonucleotide probe that hybridizes internally to the PCR amplified cDNA sequence. As shown in Fig. 5, a fragment corresponding to genomic product was detected (lane 1) when total nasal RNA was used in the reverse transcription reaction. The presence of contaminating genomic DNA apparently inhibited reverse transcription from CYP2G1 mRNA since the cDNA product was not detected. However, when the RNA preparation was pretreated with RNase-free DNase to remove contaminating genomic DNA, the cDNA-derived product was detected (lane 2). The detection of CYP2G-related transcript was subsequently confirmed by sequence analysis of the PCR products (not shown). However, it remains to be determined whether the cDNA product was derived from a functional CYP2G mRNA or from one of the pseudogenes. In conclusion, at least two genes orthologous to the rabbit and rat CYP2G1 genes are present in the human genome. Furthermore, transcripts from one of the human CYP2G genes are detected in 573
JOBNAME: 218#2 PAGE: 5 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. Detection of CYP2G mRNA in human nasal mucosa. Total RNA from human nasal turbinates was prepared and used as template in RNA-PCR experiments with primers derived from the sequence of E7 (59) and E7-8(39), respectively, as described in Methods. The PCR products (5 ml per lane) were submitted to Southern blot analysis with an oligonucleotide probe that hybridizes to E7 downstream from the 59 primer. Lane1, PCR product from RNA preparation that was not treated with DNase, and lane 2, PCR product from nasal RNA treated with DNase. The positions of selected fragments of a 100-bp DNA ladder are indicated.
the nasal mucosa. These findings provide a basis for further studies currently underway in this laboratory on the characterization of the structure and function of the human CYP2G genes and their possible polymorphic expression. ACKNOWLEDGMENTS This study was supported in part by research grant numbers 1 R01 DC 02640-01 and 7 R03 DC 01990-03 from the National Institute on Deafness and other Communication Disorders, National Institutes of Health. The authors gratefully acknowledge the use of Wadsworth Center’s molecular genetics core facility and excellent technical assistance by Lu Chen. We would also like to thank Dr. Laurence Kaminsky for his critical review of the manuscript.
REFERENCES 1. Nelson, D. R., Kamataki, T., Waxman, D. J., Guengerich, F. P., Estabrook, R. W., Feyereisen, R., Gonzalez, F. J., Coon, M. J., Gunsalus, I. C., Gotoh, O., Okuda, K., and Nebert, D. (1993) DNA Cell Biol. 12, 1–51. 2. Ding, X., and Coon, M. J. (1988) Biochemistry 27, 8330–8337. 3. Nef, P., Heldman, J., Lazard, D., Margalit, T., Jaye, M., Hanukoglu, I., and Lancet, D. (1989) J. Biol. Chem. 264, 6780–6785. 4. Ding, X., and Coon, M. J. (1990) Mol. Pharmacol. 37, 489–496. 5. Nef, P., Larabee, T. M., Kagimoto, K., and Meyer, U. A. (1990) J. Biol. Chem. 265, 2903–2907. 6. Ding, X., Porter, T. D., Peng, H.-M., and Coon, M. J. (1991) Arch. Biochem. Biophys. 285, 120–125. 7. Zupko, K., Poria, Y., and Lancet, D. (1991) Eur. J. Biochem. 196, 51–5818. 8. Chen, Y., Getchell, M. L., Ding, X., and Getchell, T. V. (1992) NeuroReport 3, 749–752. 9. Ding, X., and Coon, M. J. (1992) in Handbook of Experimental Pharmacology (Schenkman, J. B., and Greim, H., Eds.), Vol. 105, pp. 351–361. Springer-Verlag, New York. 10. Ding, X., Peng, H.-M., and Coon, M. J. (1992) Mol. Pharmacol. 42, 1027–1032. 11. Laethem, R. M., Laethem, C. L., Ding, X., and Koop, D. R. (1992) J. Pharmacol. Exp. Ther. 262, 433–438. 12. Margalit, T., and Lancet, D. (1993) Dev. Brain Res. 73, 7–16. 13. Ding, X., and Coon, M. J. (1994) Arch. Biochem. Biophys. 315, 454–459. 14. Getchell, M. L., Chen, Y., Ding, X., Sparks, D. L., and Getchell, T. V. (1993) Ann. Otol. Rhinol. Laryngol. 102, 368–374.
574
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
218, 570–574 (1996)
Article No. 0101
Identification of Human Genes Related to Olfactory-Specific CYP2G1 Jiangjun Sheng and Xinxin Ding1 Wadsworth Center, New York State Department of Health, Albany, NY 12201 Received December 6, 1995 CYP2G1, which is uniquely expressed in the olfactory mucosa of rats and rabbits, may have functions important for the olfactory chemosensory system. The aim of the present study is to determine whether CYP2G genes are present in the human genome. Several gene fragments were obtained by PCR amplification of human genomic DNA. One fragment, termed E7, which contained an open reading frame for 44 amino acids, is highly homologous in deduced amino acid sequence to residues 322-375 in rabbit or rat CYP2G1. Three other gene fragments, termed E7-8, H2Gpl and H2Gp2, respectively, were also obtained and found to have structural homology with coding sequences in the rat CYP2G1 gene. RNA-PCR analysis of human nasal RNA indicated that at least one CYP2G gene is transcribed. Southern blot analysis of human genomic DNA with use of cloned E7 or E7-8 as the probe indicated that more than one CYP2G-related gene may be present in the human genome. These results provide a basis for further characterization of the structure and function of the human CYP2G genes. © 1996 Academic Press, Inc.
CYP2G1 is an abundant enzyme expressed specifically in the olfactory mucosa of mammalian species and is believed to have physiological functions important for the olfactory chemosensory system (2–13). The primary structures of rabbit and rat CYP2G1 have been determined by cDNA cloning (3,6), and the gene structure for rat CYP2G1 has also been determined (5). Recent immunohistochemical studies with an antibody to rabbit CYP2G1 did not detect immunoreactivity in human olfactory mucosa (14), raising the question of whether the CYP2G1 gene is present in the human genome. Should a comparable human gene exist, it is important to determine to what extent it resembles the animal orthologs in structure, activity, and regulation. In the present study, PCR primers were designed based on conserved sequences between rat and rabbit CYP2G1 cDNAs, and PCR was performed with human genomic DNA as the template. The PCR products with sequence homology to CYP2G1, as detected by Southern blot analysis with rabbit CYP2G1 cDNA, were subcloned and their sequences determined. Genomic Southern blot analysis with the cloned human DNA probes was carried out to estimate the copy number of the CYP2G-related genes in the human genome, and expression of the human CYP2G genes was studied by RNA-PCR analysis of human nasal RNA. METHODS PCR analysis of human genomic DNA. Genomic DNA from human placental tissue was obtained from Clontech and used for PCR amplification of CYP2G-related fragments. PCR was carried out in a Perkin Elmer thermal cycler 9600 instrument with the following temperature conditions: annealing, 58°C, 15 sec, extension, 72°C, 2 min, and denaturation, 94°C, 15 sec, for 35 cycles. The primers used, which were synthesized in the molecular genetics core of the Wadsworth Center, corresponded to nucleotides 49–72 and 283–305, respectively (for H2Gpl and H2Gp2), 974–993 and 1126–1149, respectively (for E7), and 1126–1149 and 1186–1215, respectively (for E7–8), in rat CYP2G1 cDNA (3). PCR products (10 ml each) were submitted to electrophoresis in a 1% agarose gel, transferred to nylon membrane by pressure blotting, fixed by UV irradiation, hybridized with fluorescein-labeled SmaI restriction fragments of rabbit CYP2G1 cDNA (6), and detected with the Illuminator Nonradioactive Detection System from Stratagene. Positive PCR products were subcloned into pCR-script vector (Stratagene) and sequenced with both M13 primer and the PCR primers with use of a PCR sequencing kit from Perkin Elmer or with an automated DNA sequencer from Applied Biosystems, Model 373A, at the molecular 1
To whom correspondence should be addressed. Fax: (518)486-1505. Abbreviations: CYP2G1, cytochrome P450 isoform 2G1 (see Ref. 1 for an updated list of P450 nomenclature); and PCR, polymerase chain reaction. 570 0006-291X/96 $12.00 Copyright © 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
JOBNAME: 218#2 PAGE: 2 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
genetics core of the Wadsworth Center. Each position was analyzed at least three times and the sequences of both strands were determined. Southern blot analysis of human genomic DNA. Geno-blot containing restriction-digested human placental genomic DNA (8 mg each lane) was obtained from Clontech. Genomic DNA from the autopsy liver samples of two male subjects (kindly provided by Dr. Robert Jansing of the Wadsworth Center) or from the placental tissue of a different donor (obtained from Clontech) were subjected to restriction digest with BamHI, BglI, EcoRI, HindIII, or Pst I and submitted to Southern blot analysis as described above, with [32P]-labeled E7 or E7–8 as the probe. PCR analysis of human nasal RNA. Total RNA from autopsy samples of human nasal turbinate (obtained from the International Institute for the Advancement of Medicine) was isolated with TRI Reagent from Molecular Research Center (Cincinnati). Contaminating genomic DNA was removed by treatment with RNase-free DNase (Boehringer Mannheim). RNA-PCR was carried out with use of a kit from Perkin Elmer. First strand cDNA was synthesized with an oligo d(T)16 primer. PCR primers (59ccaagtgattggaccacaccg39 and 59 gcaggggaaatacatctgtgc39), which amplify a 200-bp fragment from human CYP2G1 cDNA and a 300-bp fragment from the human CYP2G1 gene, were designed according to the sequence of E7 and E7–8. PCR products (5ml each) were submitted to electrophoresis in a 1.5% agarose gel, transferred to nylon membrane, and hybridized with a [32P]-labeled oligonucleotide probe (59caagggtggatgaccgggt39) complementary to E7 sequence.
RESULTS AND DISCUSSION To identify and characterize CYP2G1-related genes in the human genome, PCR primers were designed based on conserved sequences in rat and rabbit CYP2G1 cDNA and used to amplify orthologous sequences from human genomic DNA. Sequence analysis of the PCR products identified a DNA fragment, designated E7, which is 132 bp in length and aligned with the nucleic acid sequence of exon 7 of the rat CYP2G1 gene (5). As shown in Fig. 1, E7 contains an open reading frame for 44 amino acids and is highly homologous in deduced amino acid sequence to residues 332–375 in rabbit CYP2G1 (89% identity) or rat CYP2G1 (86% identity). Subsequent Southern blot analysis of restriction-digested genomic DNA from a female subject with radiolabeled E7 probe detected two fragments each in four of the five reaction mixtures (Fig. 2), even though none of the restriction sites are present in the E7 sequence. The same hybridization results were obtained with genomic DNA from a second female and two male subjects (not shown). Thus, there may be at least two unique CYP2G-related genes in the human genome. Since the same hybridization patterns were found in four different individuals, two male and two females, these two genes are probably not allelic variants, but represent different genetic loci. A second PCR fragment, designated E7–8, was identified, which apparently contains a short intron and adjoining coding sequences that aligned with the 7th and 8th exons, respectively, of the
FIG. 1. Nucleotide and deduced amino acid sequence of human genomic DNA fragment E7. Nucleotide sequence of E7 is shown on the top, and the deduced amino acid sequence is shown below. The amino acid residues of rat and rabbit CYP2G1 that are different from those of E7 are shown at the bottom. Numbers underneath amino acid sequences indicate positions relative to the amino terminus of the rat or rabbit CYP2G1 protein. 571
JOBNAME: 218#2 PAGE: 3 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Southern blot analysis of human genomic DNA. Restriction-digested human genomic DNA (8mg each lane) was submitted to Southern blot analysis as described in Methods. Hybridization was carried out for 2 hr at 58°C with [32P]-labeled human genomic DNA fragment E7 in Stratagene Quikhyb hybridization solution. The positions of selected fragments of the Lambda/Hind III DNA size marker and the restriction enzymes used are indicated.
rat CYP2G1 gene, as shown in Fig. 3. Southern blot analysis of restriction-digested human genomic DNA with radiolabeled E7–8 probe revealed the same results as obtained with E7 probe (not shown), confirming that at least two genes are present in the human CYP2G subfamily. None of the restriction sites analyzed is present in E7–8 sequence either. Two other PCR fragments, designated H2Gp1 and H2Gp2, were obtained with a set of primers that correspond to sequences in the first and second exon, respectively, of the rat CYP2G1 gene. The two fragments, both about 850 bp in length, aligned with sequences flanking the intron between exons 1 and 2 in the rat CYP2G1 gene and are highly homologous in deduced amino acid sequence to residues 25–94 of rabbit and rat CYP2G1 (Fig. 4). However, H2Gp2 contains a termination codon near the 59-end of the coding region, as a result of a C→T change (Fig. 4). A termination codon is also present in the same region in the other two reading frames in H2Gp2 sequence (not shown). Similarly, a single nucleotide deletion in the predicted coding region of H2Gp1 results in a shift to a different reading frame with two adjacent termination codons. Thus, H2Gp1 and H2Gp2 may be derived from two pseudogenes in the human CYP2G subfamily. It
FIG. 3. Alignment of nucleotide and deduced amino acid sequences of the coding region of human genomic DNA fragment E7–8 with those of rat CYP2G1 gene. Nucleotide sequences in the coding region are shown in uppercase, whereas those in the intron are shown in lowercase. Numbers in parentheses indicate the length of the intron. Numbers underneath amino acid sequence indicate positions relative to the amino terminus of the CYP2G1 protein. 572
JOBNAME: 218#2 PAGE: 4 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Nucleotide and deduced amino acid sequences of the predicted coding region of human genomic DNA fragments H2Gp1 and H2Gp2. Nucleotide sequences in the coding region are shown in uppercase, whereas those in the intron are shown in lowercase Numbers in parentheses indicate the approximate length of the intron. Numbers underneath amino acid sequences indicate positions relative to the amino terminus of the rat or rabbit CYP2G1 protein. “***” represents termination codon and “-” represents deletion of a nucleotide. The nucleotide and deduced amino acid sequences of H2Gp1 are shown, with the different nucleotides (above) or amino acid residues (below) in H2Gp2 indicated. The amino acid residues of rat and rabbit CYP2G1 that are different from those of H2Gp1 are also shown.
remains to be determined whether H2Gp1 and H2Gp2 are contained in the gene fragments detected in the experiment shown in Fig. 2 by Southern blot analysis. To determine whether a CYP2G-related mRNA is expressed in the human nasal mucosa, RNAPCR experiments were performed with a set of primers designed according to the sequence of E7 and E7– 8, which amplify a 200-bp fragment from human CYP2G1 cDNA or a 300-bp fragment (containing the short intron between the putative exons 7 and 8) from human genomic DNA. The PCR products were detected by Southern blot analysis with an oligonucleotide probe that hybridizes internally to the PCR amplified cDNA sequence. As shown in Fig. 5, a fragment corresponding to genomic product was detected (lane 1) when total nasal RNA was used in the reverse transcription reaction. The presence of contaminating genomic DNA apparently inhibited reverse transcription from CYP2G1 mRNA since the cDNA product was not detected. However, when the RNA preparation was pretreated with RNase-free DNase to remove contaminating genomic DNA, the cDNA-derived product was detected (lane 2). The detection of CYP2G-related transcript was subsequently confirmed by sequence analysis of the PCR products (not shown). However, it remains to be determined whether the cDNA product was derived from a functional CYP2G mRNA or from one of the pseudogenes. In conclusion, at least two genes orthologous to the rabbit and rat CYP2G1 genes are present in the human genome. Furthermore, transcripts from one of the human CYP2G genes are detected in 573
JOBNAME: 218#2 PAGE: 5 SESS: 5 OUTPUT: Sun Apr 14 09:56:42 1996 /xypage/worksmart/tsp000/0øüû/34
Vol. 218, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. Detection of CYP2G mRNA in human nasal mucosa. Total RNA from human nasal turbinates was prepared and used as template in RNA-PCR experiments with primers derived from the sequence of E7 (59) and E7-8(39), respectively, as described in Methods. The PCR products (5 ml per lane) were submitted to Southern blot analysis with an oligonucleotide probe that hybridizes to E7 downstream from the 59 primer. Lane1, PCR product from RNA preparation that was not treated with DNase, and lane 2, PCR product from nasal RNA treated with DNase. The positions of selected fragments of a 100-bp DNA ladder are indicated.
the nasal mucosa. These findings provide a basis for further studies currently underway in this laboratory on the characterization of the structure and function of the human CYP2G genes and their possible polymorphic expression. ACKNOWLEDGMENTS This study was supported in part by research grant numbers 1 R01 DC 02640-01 and 7 R03 DC 01990-03 from the National Institute on Deafness and other Communication Disorders, National Institutes of Health. The authors gratefully acknowledge the use of Wadsworth Center’s molecular genetics core facility and excellent technical assistance by Lu Chen. We would also like to thank Dr. Laurence Kaminsky for his critical review of the manuscript.
REFERENCES 1. Nelson, D. R., Kamataki, T., Waxman, D. J., Guengerich, F. P., Estabrook, R. W., Feyereisen, R., Gonzalez, F. J., Coon, M. J., Gunsalus, I. C., Gotoh, O., Okuda, K., and Nebert, D. (1993) DNA Cell Biol. 12, 1–51. 2. Ding, X., and Coon, M. J. (1988) Biochemistry 27, 8330–8337. 3. Nef, P., Heldman, J., Lazard, D., Margalit, T., Jaye, M., Hanukoglu, I., and Lancet, D. (1989) J. Biol. Chem. 264, 6780–6785. 4. Ding, X., and Coon, M. J. (1990) Mol. Pharmacol. 37, 489–496. 5. Nef, P., Larabee, T. M., Kagimoto, K., and Meyer, U. A. (1990) J. Biol. Chem. 265, 2903–2907. 6. Ding, X., Porter, T. D., Peng, H.-M., and Coon, M. J. (1991) Arch. Biochem. Biophys. 285, 120–125. 7. Zupko, K., Poria, Y., and Lancet, D. (1991) Eur. J. Biochem. 196, 51–5818. 8. Chen, Y., Getchell, M. L., Ding, X., and Getchell, T. V. (1992) NeuroReport 3, 749–752. 9. Ding, X., and Coon, M. J. (1992) in Handbook of Experimental Pharmacology (Schenkman, J. B., and Greim, H., Eds.), Vol. 105, pp. 351–361. Springer-Verlag, New York. 10. Ding, X., Peng, H.-M., and Coon, M. J. (1992) Mol. Pharmacol. 42, 1027–1032. 11. Laethem, R. M., Laethem, C. L., Ding, X., and Koop, D. R. (1992) J. Pharmacol. Exp. Ther. 262, 433–438. 12. Margalit, T., and Lancet, D. (1993) Dev. Brain Res. 73, 7–16. 13. Ding, X., and Coon, M. J. (1994) Arch. Biochem. Biophys. 315, 454–459. 14. Getchell, M. L., Chen, Y., Ding, X., Sparks, D. L., and Getchell, T. V. (1993) Ann. Otol. Rhinol. Laryngol. 102, 368–374.
574