- Email: [email protected]
Identification of MMP-18, a Putative Novel Human Matrix Metalloproteinase
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
228, 494–498 (1996)
1688
Identification of MMP-18, a Putative Novel Human Matrix Metalloproteinase J. Cossins,1 T. J. Dudgeon, G. Catlin, A. J. H. Gearing, and J. M. Clements British Biotech Pharmaceuticals, Watlington Road, Oxford OX4 5LY, United Kingdom Received October 4, 1996 A partial cDNA encoding the 3* end of a putative novel human matrix metalloproteinase (MMP) was identified by sequence similarity searching of databases containing expressed sequence tags. The remaining 5* end of the MMP cDNA was amplified by PCR from human mammary gland cDNA. The predicted protein product displays all the structural features characteristic of the MMP family and has closest identity with MMP-1, -3, -10, and 11. We have provisionally designated this novel MMP as MMP-18. MMP-18 mRNA is expressed in a wide variety of normal human tissues, including mammary gland, placenta, lung, pancreas, ovary, small intestine, spleen, thymus, prostate, testis, colon, and heart, but is not detected in brain, skeletal muscle, kidney, liver, or peripheral blood leucocytes. q 1996 Academic Press, Inc.
Matrix metalloproteinases (MMPs) are a family of at least 14 structurally related secreted or membrane-bound zinc-dependent endopeptidases that can degrade extracellular matrix proteins. All MMPs contain a pro-domain with a conserved ‘‘cysteine switch’’ region which is responsible for maintenance of enzyme latency, a catalytic domain with a highly conserved zinc binding site, and, with the exception of matrilysin, a C-terminal domain with similarity to hemopexin. MMPs are involved in organ morphogenesis and embryonic development (1– 4), but have also been implicated in various pathologies that involve matrix degradation (for review see 5). These include inflammatory diseases such as multiple sclerosis, rheumatoid arthritis and osteoarthritis, as well as wound healing, tumour invasion and metastasis. For example, elevated levels of membrane type 1-MMP (MT1-MMP) and 92kDa gelatinase are associated with lung carcinomas (6,7), matrilysin with colon and stomach cancers (8–10), collagenase-3, stromelysin-3 and 72kDa gelatinase with breast cancer (11–14), and stromelysin-1 with squamous cell carcinoma (15). Inhibitors of these enzymes are being developed as therapeutics for such diseases (16). The information within the databases of expressed sequence tags (ESTs) is such that a substantial majority of all human gene transcripts are now represented (17, 18). This may include novel MMPs which are involved in pathological processes. Using a MMP similarity search of the EST database we identified a partial cDNA clone that encodes the 3* end of a putative novel MMP. The 5* end was amplified by PCR and the full length cDNA was cloned and sequenced. The predicted amino acid sequence showed similarity to other known human MMPs, suggesting that it is a novel member of the family. The expression profile of MMP18 in normal human tissues was also analysed and it was shown to be widely distributed. MATERIALS AND METHODS Database search. The EST section of the EMBL nucleotide database (19) was searched for similarity to 13 known human MMPs using the programme tblastn (20). MMP-like ESTs were clustered into families and those sequences that were not identical to known MMPs were further analysed to determine whether they contained putative MMP-
1
Correspondence. Fax: (44) 1865 781115. E-mail: [email protected]. 494
0006-291X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
BBRC 5639
/
6910$$$581
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1 List of Human ESTs Which Encode MMP-18 cDNA
EST clone ID
Position of 5* end of EST within the MMP-18 sequence (bp)
Tissue source
154770 155145 155430 131006
201 1271 1271 962
Mammary gland Mammary gland Mammary gland Placenta
specific sequences. One clone I.M.A.G.E. Consortium ID 154770 containing the 3* end of a putative MMP, which we have designated MMP-18, was obtained from Research Genetics, Inc., USA (21). PCR amplification of the 5* end of the cDNA. Standard molecular biology techniques were used in the study and are described in Sambrook et al. (22). The 5* end of MMP-18 cDNA was obtained by nested PCR amplification of human mammary gland cDNA (Marathon ReadyTM from Clontech). PCR primers were designed so that the PCR product would overlap with the EST sequence and an EcoRV site within the region of overlap would then facilitate assembly of the full length cDNA. Amplification was performed in 50ml using a Hybaid thermal cycler with 40 cycles of {957C for 90 secs, 557C for 90 secs, 727C for 150 secs}. Oligonucleotides were purchased from R&D Systems Europe. The first reaction contained MMP-18 primer 5*GATCCTCTAGGCCACAACG along with the Marathon Ready adaptor primer. 1ml from this reaction was transferred to a second amplification containing MMP-18 primer 5*TCATCCAGCTGACCTGAGACTG and the Marathon Ready adaptor primer. The amplified 300bp 5* end was cloned into pTAG using LigATor, excised using HindIII and EcoRI, and cloned into HindIII/EcoRI digested pGEM9Z. This was then digested with EcoRI, blunt-ended with DNA polymerase I and digested with EcoRV. Clone 154770 was digested with HindIII, blunt-ended with DNA polymerase I, and then digested with EcoRV to give a 2000bp fragment containing the 3* end of MMP-18. This was blunt-end ligated into pGEM-9Z containing the 5* end of MMP18. A 2300bp SalI fragment containing full length MMP-18 cDNA was excised and cloned into SalI-digested and dephosphorylated pGW1HG, a eukaryotic expression vector (23), to make pGW1HG-MMP-18. The sequence of both strands of the full length cDNA were determined, and will be submitted to EMBL. Northern blot analysis. Human Multiple Tissue Blots I and II were obtained from Clontech, and hybridisation was carried out according to the manufacturer’s instructions. The actin hybridization probe was supplied with the tissue blots, and a EcoRI/NotI restriction fragment from clone 154770 was used as the MMP-18 probe. Probes were labelled with 32P-a-dCTP using Rediprime (Amersham).
RESULTS AND DISCUSSION
The EST section of the EMBL nucleotide database was searched for similarity to novel human MMP cDNAs as described in materials and methods. This initially identified 126 sequences which were clustered into families. One clone I.M.A.G.E. Consortium ID 154770 showed significant homology with, but was not identical to, known human MMPs. Clone 154770 was obtained and the full DNA sequence determined. The cDNA contained an open reading frame whose predicted amino acid sequence aligned most closely with human MMP10 but started within the predicted MMP pro-domain. The remaining 5* end of the novel MMP cDNA was obtained by PCR amplification of human mammary gland Marathon Ready cDNA
TABLE 2 Comparison of Catalytic Domains of 13 Human MMPs with MMP-18 MMP No.:
1
2
3
7
8
9
10
11
12
13
MT1
MT2
MT3
% Identity with MMP-18:
44
41
44
40
37
39
44
44
42
40
34
41
37
Note. The catalytic domains of the MMPs were aligned using Clustal-W (24) to obtain values for the identity between MMP-18 and each human MMP. 495
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. MMP-18 aligned with MMP-1 (fibroblast collagenase), MMP-3 (stromelysin-1), MMP-10 (stromelysin-2), and MMP-11 (stromelysin-3). The protein sequences were aligned using Clustal-w (24) and were then manually edited. The arrows denote two possible sites of cleavage of the propeptide to the mature form. The cysteine switch region, the zinc binding site and the acid-rich region are underlined. Potential N-linked glycosylation sites in MMP-18 are indicated by plus signs. Residues highlighted in black are 100% conserved, and residues highlighted in grey are 80% conserved.
and was ligated with the EST cDNA to generate full length cDNA. Three other clones encoding partial cDNA with the same sequence were identified by searching the EST section of the EMBL nucleotide database for similarity to the novel protein sequence (Table 1). 496
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Expression of MMP-18 in human tissues. Northern tissue blots were probed with 32P-dCTP-labelled MMP18 probe and with 32P-dCTP-labelled human actin. mRNA was derived from 1) heart; 2) brain; 3) placenta; 4) lung; 5) liver; 6) skeletal muscle; 7) kidney; 8) pancreas; 9) spleen; 10) thymus; 11) prostate; 12) testis; 13) ovary; 14) small intestine; 15) colon (mucosal lining); 16) peripheral blood leucocytes.
The full-length cDNA contained an open reading frame of 508 amino acids with a predicted molecular weight of 57,238 and had all the characteristic features of the MMP family. The catalytic domains of the novel MMP and 13 other human MMPs were aligned. The novel MMP had most similarity with MMP-1, -3, -10 and -11 (44% identity) (Table 2). It showed a similar level of homology with several other MMPs (Table 2), and thus cannot readily be assigned to a particular subclass. We have therefore provisionally designated our novel MMP as MMP-18. An alignment of the predicted amino acid sequence of MMP-18 with MMP-1, -3, -10 and -11 is shown in Fig. 1. MMP-18 contains a putative signal sequence, followed by a pro-domain with a conserved ‘‘cysteine switch’’ region. In comparison with all other MMPs, however, a glutamic acid has replaced the proline at position 6 in the motif PRCGXPD. There are two potential cleavage sites that would activate the protein to the mature form. Unlike stromelysin-3 and the MT-MMPs, MMP-18 does not contain the short amino acid insert between the pro-domain and catalytic domain encoding a furin-like cleavage site. The catalytic and hemopexin-like domain are well conserved, maintaining the key structural features of these domains. There are two unique features of the protein sequence which differ from all other MMPs and which might be involved in substrate binding or tissue localization. First, an acid-rich sequence (residues 164-171) is present within the linker region joining the catalytic and hemopexin domains. Second, the final conserved cysteine at the C-terminus of the hemopexin domain is followed by a threonine-rich region of 36 residues. In all MMPs except for MT-MMPs the final cysteine is normally followed by only a few further residues. MMP-18 also contains two potential N-linked glycosylation sites within the hemopexin-like domain. To determine the expression profile of MMP-18 in normal tissue northern blots of RNA samples from various tissues were hybridized using a MMP-18 probe. Expression of a single transcript of 2.7kb was detected in placenta, lung, pancreas, ovary, small intestine, spleen, thymus and prostate, and at much lower levels in testis, colon and heart (Fig. 2). No MMP-18 mRNA was detected in brain, skeletal muscle, liver, kidney or peripheral blood leucocytes. In addition MMP-18 ESTs can be identified in a cDNA library obtained from breast (Table 1). In conclusion, we have identified a novel putative MMP from sequence similarity searching of EST databases which is expressed in a wide variety of normal tissues. Studies are now underway to determine the activity of the enzyme and its role in normal and pathological conditions. REFERENCES 1. 2. 3. 4. 5. 6.
Matrisian, L. M. (1990) Trends Genet. 6, 121–125. Matrisian, L. M. (1992) BioEssays 14, 455–463. Birkedal-Hansen, H. (1995) Curr. Op. Biol. 7, 728–735. Wilson, C. L., Heppner, K. J., Rudolph, L. A., and Matrisian, L. M. (1995) Mol. Biol. Cell. 6, 851–869. Ries, C., and Petrides, P. E. (1995) Biol. Chem. Hoppe-Seyler 376, 345–355. Canete-Soler, R., Litzky, L., Lubensky, I., and Muschel, R. J. (1994) Am. J. Pathol. 144, 518–527. 497
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
7. Sato, H., Takino, T., Okado, Y., Cao, J., Shinagwa, A., Yamamoto, E., and Seiki, M. (1994) Nature 370, 61– 65. 8. McDonnell, S., Navre, M., Coffey, R. J. Jr., and Matrisian, L. M. (1991) Mol. Carcinogenesis 4, 527–533. 9. Witty, J. P., McDonnell, S., Newell, K. J., Cannon, P., Navre, M., Tressler, R. J., and Matrisian, L. M. (1994) Cancer Res. 54, 4805–4812. 10. Yamamoto, E., Itoh, F., Hinoda, Y., Senato, A., Yoshimoyo, M., Nakamura, H., Imai, K., and Yachi, A. (1994) Biochem. Biophys. Res. Commun. 201, 657–664. 11. Basset, P., Bellocq, J. P., Wolf, C., Stoll, I., Hutin, P., Limacher, J. M., Podhajcer, O. L., Chenard, M. P., Rio, M. C., and Chambon, P. (1990) Nature 348, 699–704. 12. Basset, P., Wolf, C., and Chambon, P. (1993) Breast Cancer Research & Treatment 24, 185–193. 13. Freije, J. M. P., DıB ez-Itza, I., BalbıB n, M., Sa´nchez, L. M., Blasco, R., Toliva, J., and LoB pez-OtıB n, C. (1994) J. Biol. Chem. 269, 16766–16773. 14. Polett, M., Clavel, C., Cockett, M., Girod de Bentzmann, S., Murphy, G., and Birembaut, P. (1993) Invasion Metastasis 13, 31–37. 15. Matrisian, L. M., McDonnell, S., Miller, D. B., Navre, M., Seftor, E. A., and Hendrix, M. J. (1991) Am. J. Med. Sciences 302, 157–162. 16. Beckett, R. P., Davidson, A. H., Drummond, A. H., Huxley, P., and Whittaker, M. (1996) Drug Discovery Today 1, 16–26. 17. Adams, M. D., Kelley, J. M., Gocayne, J. D., Dubnick, M., Polymeropoulos, M. H., Xiao, H., Merril, C. R., Wu, A., Olde, B., Moreno, R. F. et al. (1991) Science 252, 1651–1656. 18. Anonymous, Nature (1995) 377 (Supplement). 19. Rice, C. M., Fuchs, R., Higgins, D. G., Stoehr, P. J., and Cameron, G. N. (1994) Nucleic Acids Res. 21, 2967– 2971. 20. Altshul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) Basic local alignment search tools. J. Mol. Biol. 215, 403–410. 21. Lennon, G. G., Auffray, C., Polymeropoulos, M., and Soares, M. B. (1996) Genomics 33, 151–152. 22. Sambrook, J., Fritch, E. F., and Maniatis. T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 23. Green, D. R., Banuls, M. P., Gearing, A. J. H., Needham, L. A., White, M. R. H., and Clements, J. M. (1994) Endothelium 2, 191–121. 24. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673–4680.
498
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC
228, 494–498 (1996)
1688
Identification of MMP-18, a Putative Novel Human Matrix Metalloproteinase J. Cossins,1 T. J. Dudgeon, G. Catlin, A. J. H. Gearing, and J. M. Clements British Biotech Pharmaceuticals, Watlington Road, Oxford OX4 5LY, United Kingdom Received October 4, 1996 A partial cDNA encoding the 3* end of a putative novel human matrix metalloproteinase (MMP) was identified by sequence similarity searching of databases containing expressed sequence tags. The remaining 5* end of the MMP cDNA was amplified by PCR from human mammary gland cDNA. The predicted protein product displays all the structural features characteristic of the MMP family and has closest identity with MMP-1, -3, -10, and 11. We have provisionally designated this novel MMP as MMP-18. MMP-18 mRNA is expressed in a wide variety of normal human tissues, including mammary gland, placenta, lung, pancreas, ovary, small intestine, spleen, thymus, prostate, testis, colon, and heart, but is not detected in brain, skeletal muscle, kidney, liver, or peripheral blood leucocytes. q 1996 Academic Press, Inc.
Matrix metalloproteinases (MMPs) are a family of at least 14 structurally related secreted or membrane-bound zinc-dependent endopeptidases that can degrade extracellular matrix proteins. All MMPs contain a pro-domain with a conserved ‘‘cysteine switch’’ region which is responsible for maintenance of enzyme latency, a catalytic domain with a highly conserved zinc binding site, and, with the exception of matrilysin, a C-terminal domain with similarity to hemopexin. MMPs are involved in organ morphogenesis and embryonic development (1– 4), but have also been implicated in various pathologies that involve matrix degradation (for review see 5). These include inflammatory diseases such as multiple sclerosis, rheumatoid arthritis and osteoarthritis, as well as wound healing, tumour invasion and metastasis. For example, elevated levels of membrane type 1-MMP (MT1-MMP) and 92kDa gelatinase are associated with lung carcinomas (6,7), matrilysin with colon and stomach cancers (8–10), collagenase-3, stromelysin-3 and 72kDa gelatinase with breast cancer (11–14), and stromelysin-1 with squamous cell carcinoma (15). Inhibitors of these enzymes are being developed as therapeutics for such diseases (16). The information within the databases of expressed sequence tags (ESTs) is such that a substantial majority of all human gene transcripts are now represented (17, 18). This may include novel MMPs which are involved in pathological processes. Using a MMP similarity search of the EST database we identified a partial cDNA clone that encodes the 3* end of a putative novel MMP. The 5* end was amplified by PCR and the full length cDNA was cloned and sequenced. The predicted amino acid sequence showed similarity to other known human MMPs, suggesting that it is a novel member of the family. The expression profile of MMP18 in normal human tissues was also analysed and it was shown to be widely distributed. MATERIALS AND METHODS Database search. The EST section of the EMBL nucleotide database (19) was searched for similarity to 13 known human MMPs using the programme tblastn (20). MMP-like ESTs were clustered into families and those sequences that were not identical to known MMPs were further analysed to determine whether they contained putative MMP-
1
Correspondence. Fax: (44) 1865 781115. E-mail: [email protected]. 494
0006-291X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
BBRC 5639
/
6910$$$581
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1 List of Human ESTs Which Encode MMP-18 cDNA
EST clone ID
Position of 5* end of EST within the MMP-18 sequence (bp)
Tissue source
154770 155145 155430 131006
201 1271 1271 962
Mammary gland Mammary gland Mammary gland Placenta
specific sequences. One clone I.M.A.G.E. Consortium ID 154770 containing the 3* end of a putative MMP, which we have designated MMP-18, was obtained from Research Genetics, Inc., USA (21). PCR amplification of the 5* end of the cDNA. Standard molecular biology techniques were used in the study and are described in Sambrook et al. (22). The 5* end of MMP-18 cDNA was obtained by nested PCR amplification of human mammary gland cDNA (Marathon ReadyTM from Clontech). PCR primers were designed so that the PCR product would overlap with the EST sequence and an EcoRV site within the region of overlap would then facilitate assembly of the full length cDNA. Amplification was performed in 50ml using a Hybaid thermal cycler with 40 cycles of {957C for 90 secs, 557C for 90 secs, 727C for 150 secs}. Oligonucleotides were purchased from R&D Systems Europe. The first reaction contained MMP-18 primer 5*GATCCTCTAGGCCACAACG along with the Marathon Ready adaptor primer. 1ml from this reaction was transferred to a second amplification containing MMP-18 primer 5*TCATCCAGCTGACCTGAGACTG and the Marathon Ready adaptor primer. The amplified 300bp 5* end was cloned into pTAG using LigATor, excised using HindIII and EcoRI, and cloned into HindIII/EcoRI digested pGEM9Z. This was then digested with EcoRI, blunt-ended with DNA polymerase I and digested with EcoRV. Clone 154770 was digested with HindIII, blunt-ended with DNA polymerase I, and then digested with EcoRV to give a 2000bp fragment containing the 3* end of MMP-18. This was blunt-end ligated into pGEM-9Z containing the 5* end of MMP18. A 2300bp SalI fragment containing full length MMP-18 cDNA was excised and cloned into SalI-digested and dephosphorylated pGW1HG, a eukaryotic expression vector (23), to make pGW1HG-MMP-18. The sequence of both strands of the full length cDNA were determined, and will be submitted to EMBL. Northern blot analysis. Human Multiple Tissue Blots I and II were obtained from Clontech, and hybridisation was carried out according to the manufacturer’s instructions. The actin hybridization probe was supplied with the tissue blots, and a EcoRI/NotI restriction fragment from clone 154770 was used as the MMP-18 probe. Probes were labelled with 32P-a-dCTP using Rediprime (Amersham).
RESULTS AND DISCUSSION
The EST section of the EMBL nucleotide database was searched for similarity to novel human MMP cDNAs as described in materials and methods. This initially identified 126 sequences which were clustered into families. One clone I.M.A.G.E. Consortium ID 154770 showed significant homology with, but was not identical to, known human MMPs. Clone 154770 was obtained and the full DNA sequence determined. The cDNA contained an open reading frame whose predicted amino acid sequence aligned most closely with human MMP10 but started within the predicted MMP pro-domain. The remaining 5* end of the novel MMP cDNA was obtained by PCR amplification of human mammary gland Marathon Ready cDNA
TABLE 2 Comparison of Catalytic Domains of 13 Human MMPs with MMP-18 MMP No.:
1
2
3
7
8
9
10
11
12
13
MT1
MT2
MT3
% Identity with MMP-18:
44
41
44
40
37
39
44
44
42
40
34
41
37
Note. The catalytic domains of the MMPs were aligned using Clustal-W (24) to obtain values for the identity between MMP-18 and each human MMP. 495
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. MMP-18 aligned with MMP-1 (fibroblast collagenase), MMP-3 (stromelysin-1), MMP-10 (stromelysin-2), and MMP-11 (stromelysin-3). The protein sequences were aligned using Clustal-w (24) and were then manually edited. The arrows denote two possible sites of cleavage of the propeptide to the mature form. The cysteine switch region, the zinc binding site and the acid-rich region are underlined. Potential N-linked glycosylation sites in MMP-18 are indicated by plus signs. Residues highlighted in black are 100% conserved, and residues highlighted in grey are 80% conserved.
and was ligated with the EST cDNA to generate full length cDNA. Three other clones encoding partial cDNA with the same sequence were identified by searching the EST section of the EMBL nucleotide database for similarity to the novel protein sequence (Table 1). 496
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Expression of MMP-18 in human tissues. Northern tissue blots were probed with 32P-dCTP-labelled MMP18 probe and with 32P-dCTP-labelled human actin. mRNA was derived from 1) heart; 2) brain; 3) placenta; 4) lung; 5) liver; 6) skeletal muscle; 7) kidney; 8) pancreas; 9) spleen; 10) thymus; 11) prostate; 12) testis; 13) ovary; 14) small intestine; 15) colon (mucosal lining); 16) peripheral blood leucocytes.
The full-length cDNA contained an open reading frame of 508 amino acids with a predicted molecular weight of 57,238 and had all the characteristic features of the MMP family. The catalytic domains of the novel MMP and 13 other human MMPs were aligned. The novel MMP had most similarity with MMP-1, -3, -10 and -11 (44% identity) (Table 2). It showed a similar level of homology with several other MMPs (Table 2), and thus cannot readily be assigned to a particular subclass. We have therefore provisionally designated our novel MMP as MMP-18. An alignment of the predicted amino acid sequence of MMP-18 with MMP-1, -3, -10 and -11 is shown in Fig. 1. MMP-18 contains a putative signal sequence, followed by a pro-domain with a conserved ‘‘cysteine switch’’ region. In comparison with all other MMPs, however, a glutamic acid has replaced the proline at position 6 in the motif PRCGXPD. There are two potential cleavage sites that would activate the protein to the mature form. Unlike stromelysin-3 and the MT-MMPs, MMP-18 does not contain the short amino acid insert between the pro-domain and catalytic domain encoding a furin-like cleavage site. The catalytic and hemopexin-like domain are well conserved, maintaining the key structural features of these domains. There are two unique features of the protein sequence which differ from all other MMPs and which might be involved in substrate binding or tissue localization. First, an acid-rich sequence (residues 164-171) is present within the linker region joining the catalytic and hemopexin domains. Second, the final conserved cysteine at the C-terminus of the hemopexin domain is followed by a threonine-rich region of 36 residues. In all MMPs except for MT-MMPs the final cysteine is normally followed by only a few further residues. MMP-18 also contains two potential N-linked glycosylation sites within the hemopexin-like domain. To determine the expression profile of MMP-18 in normal tissue northern blots of RNA samples from various tissues were hybridized using a MMP-18 probe. Expression of a single transcript of 2.7kb was detected in placenta, lung, pancreas, ovary, small intestine, spleen, thymus and prostate, and at much lower levels in testis, colon and heart (Fig. 2). No MMP-18 mRNA was detected in brain, skeletal muscle, liver, kidney or peripheral blood leucocytes. In addition MMP-18 ESTs can be identified in a cDNA library obtained from breast (Table 1). In conclusion, we have identified a novel putative MMP from sequence similarity searching of EST databases which is expressed in a wide variety of normal tissues. Studies are now underway to determine the activity of the enzyme and its role in normal and pathological conditions. REFERENCES 1. 2. 3. 4. 5. 6.
Matrisian, L. M. (1990) Trends Genet. 6, 121–125. Matrisian, L. M. (1992) BioEssays 14, 455–463. Birkedal-Hansen, H. (1995) Curr. Op. Biol. 7, 728–735. Wilson, C. L., Heppner, K. J., Rudolph, L. A., and Matrisian, L. M. (1995) Mol. Biol. Cell. 6, 851–869. Ries, C., and Petrides, P. E. (1995) Biol. Chem. Hoppe-Seyler 376, 345–355. Canete-Soler, R., Litzky, L., Lubensky, I., and Muschel, R. J. (1994) Am. J. Pathol. 144, 518–527. 497
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC
Vol. 228, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
7. Sato, H., Takino, T., Okado, Y., Cao, J., Shinagwa, A., Yamamoto, E., and Seiki, M. (1994) Nature 370, 61– 65. 8. McDonnell, S., Navre, M., Coffey, R. J. Jr., and Matrisian, L. M. (1991) Mol. Carcinogenesis 4, 527–533. 9. Witty, J. P., McDonnell, S., Newell, K. J., Cannon, P., Navre, M., Tressler, R. J., and Matrisian, L. M. (1994) Cancer Res. 54, 4805–4812. 10. Yamamoto, E., Itoh, F., Hinoda, Y., Senato, A., Yoshimoyo, M., Nakamura, H., Imai, K., and Yachi, A. (1994) Biochem. Biophys. Res. Commun. 201, 657–664. 11. Basset, P., Bellocq, J. P., Wolf, C., Stoll, I., Hutin, P., Limacher, J. M., Podhajcer, O. L., Chenard, M. P., Rio, M. C., and Chambon, P. (1990) Nature 348, 699–704. 12. Basset, P., Wolf, C., and Chambon, P. (1993) Breast Cancer Research & Treatment 24, 185–193. 13. Freije, J. M. P., DıB ez-Itza, I., BalbıB n, M., Sa´nchez, L. M., Blasco, R., Toliva, J., and LoB pez-OtıB n, C. (1994) J. Biol. Chem. 269, 16766–16773. 14. Polett, M., Clavel, C., Cockett, M., Girod de Bentzmann, S., Murphy, G., and Birembaut, P. (1993) Invasion Metastasis 13, 31–37. 15. Matrisian, L. M., McDonnell, S., Miller, D. B., Navre, M., Seftor, E. A., and Hendrix, M. J. (1991) Am. J. Med. Sciences 302, 157–162. 16. Beckett, R. P., Davidson, A. H., Drummond, A. H., Huxley, P., and Whittaker, M. (1996) Drug Discovery Today 1, 16–26. 17. Adams, M. D., Kelley, J. M., Gocayne, J. D., Dubnick, M., Polymeropoulos, M. H., Xiao, H., Merril, C. R., Wu, A., Olde, B., Moreno, R. F. et al. (1991) Science 252, 1651–1656. 18. Anonymous, Nature (1995) 377 (Supplement). 19. Rice, C. M., Fuchs, R., Higgins, D. G., Stoehr, P. J., and Cameron, G. N. (1994) Nucleic Acids Res. 21, 2967– 2971. 20. Altshul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) Basic local alignment search tools. J. Mol. Biol. 215, 403–410. 21. Lennon, G. G., Auffray, C., Polymeropoulos, M., and Soares, M. B. (1996) Genomics 33, 151–152. 22. Sambrook, J., Fritch, E. F., and Maniatis. T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 23. Green, D. R., Banuls, M. P., Gearing, A. J. H., Needham, L. A., White, M. R. H., and Clements, J. M. (1994) Endothelium 2, 191–121. 24. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673–4680.
498
AID
BBRC 5639
/
6910$$$582
10-25-96 07:43:42
bbrca
AP: BBRC