- Email: [email protected]
Identification of pork in raw meat or cooked meatballs within 20 min using rapid PCR coupled with visual detection
Food Control 109 (2020) 106905
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Identification of pork in raw meat or cooked meatballs within 20 min using rapid PCR coupled with visual detection
T
Hui Wua, Cheng Qiana, Rui Wanga, Cui Wua, Zhen Wanga, Liu Wangc, Mengyao Zhanga, Zunzhong Yea,∗, Fang Zhangd, Jin-song Heb,∗∗, Jian Wua a
College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou, 310058, China College of Food Science and Technology, Yunnan Agricultural University, Kunming, 650201, China c Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, State Key Laboratory for Quality and Safety of Agro-products, Hangzhou, 310021, China d College of Biological Science and Engineering, Fuzhou University, Fuzhou, 350108, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Pork Meat adulteration Rapid PCR Visual detection Portable device
Meat adulteration is seriously damaging the interests of consumers. It is important to develop a rapid, simple, cost-effective and sensitive method to identify meat species. In this study, a pair of suitable pork-specific primers was determined by the comparison of three pairs of pork-specific primers and the annealing/extension temperature optimized here was set at 64 °C. Rapid polymerase chain reaction (PCR) with glass capillary as reaction vessel, which could complete 45 cycles in 5 min by using two ordinary water baths, was established to detect pork contents in raw beef meat or cooked beef meatballs. A SYTO 9-based visual detection method was used to evaluate the amplification results. The fluorescence signal of negative samples could be removed at 72 °C according to the results of original melt curves of positive and negative samples. Strong green fluorescence would be produced in positive samples while the color of negative samples still remained black under the blue light (470 nm). A simple and portable device was designed to prevent detection results disturbed by ambient light and make operation easier. As low as 0.01% pork contents in binary mixtures could be detected and the whole detection process could be finished in 20 min from sampling to results. The developed method would have great potential for rapid on-site detection of pork meat and identification of meat species.
1. Introduction With the development of social economy and the growth of population, the global consumption of meat is rising (Godfray et al., 2018). Due to the difference in prices, some unscrupulous traders try to make more profit by replacing high-priced meat with low-priced meat. For example, beef meat was substituted with pork meat or horse meat (Pavlidis, Mallouchos, Ercolini, Panagou, & Nychas, 2019; Ropodi, Panagou, & Nychas, 2017). When different kinds of meat are mixed or heated, the morphological characteristics of meat can not be distinguished by the naked eye. This adulteration of meat is very dangerous for allergic individuals and people with religious beliefs (Ballin, Vogensen, & Karlsson, 2009). Thus, to confirm the authenticity of food labels and ensure the safety of consumers, many food authorities have strengthened supervision of adulteration of commercial meat products since 2013 (Chuah et al., 2016; Kane & Hellberg, 2016; Naaum et al.,
∗
2018). Therefore, it is urgently necessary to develop a rapid, sensitive, cost-effective and simple analytical method for meat species identification (Abbas et al., 2018; Xu et al., 2018). So far, many detection methods have been developed to identify meat species based either on proteins or DNA sequences (Alikord, Momtaz, Keramat, Kadivar, & Rad, 2018; Bohme, Calo-Mata, BarrosVelazquez, & Ortea, 2019; Magiati, Myridaki, Christopoulos, & Kalogianni, 2019). Protein-based detection methods mainly include gel electrophoresis, chromatography, spectroscopy and enzyme-linked immunosorbent assay (ELISA). Among them, ELISA is the most commonly used method, which includes indirect ELISA and sandwich ELISA. But proteins are easily degradable during food processing and the quantities of proteins are susceptible to the expression of genes. Therefore, the sensitivity of these methods is generally lower than that of methods based on DNA analysis (Qian, Wang, Wu, Ping & Wu, 2018a,b,c; Rahmati, Julkapli, Yehye, & Basirun, 2016; Zhang, Wu, Wu, Ping, &
Corresponding author. Corresponding author. E-mail addresses: [email protected] (Z. Ye), [email protected] (J.-s. He).
∗∗
https://doi.org/10.1016/j.foodcont.2019.106905 Received 9 April 2019; Received in revised form 18 September 2019; Accepted 20 September 2019 Available online 20 September 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.
Food Control 109 (2020) 106905
H. Wu, et al.
preparation until DNA extraction. LightCycler® glass capillaries (20 μL) were purchased from Roche Diagnostics Corporation, USA.
Abbreviations used TE PCR NaCl SDS dNTP
Tris-EDTA Polymerase chain reaction Sodium chloride Sodium dodecyl sulfate Deoxyribonucleoside triphosphate
2.2. DNA extraction In order to construct a rapid, simple and cost-effective method to extract nucleic acids of meat, a new extraction method for meat was established and it was performed as followed: 100 mg of minced meat were put into a 1.5 mL centrifuge tube. 150 μL of lysate (0.5 M NaCl and 0.5% SDS (w/v)) was then transferred into the tube. The tube was shaken for 30 s and incubated at room temperature for 3 min. Then, the tube was centrifuged by a portable instrument at 10000 rpm for 1 min. The supernatant was 50-fold diluted with Tris-EDTA (TE) buffer. 4 μL of the rough lysate was used as a DNA template. The entire process of extraction would be finished in 12 min, including the time of weighing the samples. Three separate extractions for all samples or binary mixtures were prepared. DNA concentration was estimated by UV absorption spectrophotometry at 260 nm.
Wu, 2019; Murugaiah et al., 2009); DNA-based detection methods mainly include real-time PCR, isothermal amplification, digital PCR, biosensors, etc. The limits of detection (LODs) of these methods range from 0.01% to 0.1% of adulteration. But the detection time of these methods requires commonly more than 40 min from sampling to results (Alikord et al., 2018; Cao et al., 2018; Lo & Shaw, 2018; Magiati et al., 2019). With the understanding of the kinetics of PCR, the time of PCR is limited by device and not biochemistry. As long as the heat transfer rate and the concentration of critical reagents are increased, one cycle of PCR can be finished in less than 20 s (Farrar & Wittwer, 2015). Some researchers have used rapid PCR to conduct molecular diagnosis of bacteria, virus or genetically modified organisms (Houssin et al., 2016; M Trauba & Wittwer, 2017; Qian et al., 2018a,b,c; Wang et al., 2018). And there are many portable platforms being developed to carry out rapid PCR, like Q3 lab-on-chip (Marziliano et al., 2015), handheld Biomeme PCR thermocycler (Hole & Nfon, 2019), some convective PCR devices (Rajendran, Bakthavathsalam, Bergquist, & Sunna, 2019; Zhuo et al., 2018), etc. But the operation process is still relative sophisticated and time-consuming (~30 min) while the design of platforms is relative difficult. In addition, as we know, rapid PCR for identifying meat species has not been reported in the literature until now. In this study, rapid PCR coupled with visual detection method for detecting pork contents in raw beef meat or cooked beef meatball was established. Rapid PCR was performed by using only two ordinary water baths without needing other expensive instruments and 45-cycle of PCR could be finished in 5 min. A SYTO 9-based visual detection method of amplified products without uncapping operation was developed and the detection results were observed by using a simple and portable device designed by our group. Positive samples would produce green fluorescence while the color of negative samples remained black at 72 °C under the blue lights (470 nm). The whole process of detection could be finished in 20 min from sampling to results.
2.3. Oligonucleotide primers Three pork-specific primer sets targeted different fragments of genes of pork separately were used in this study. The F1/R1 primers targeted the beta-actin genes of pork (F1: 5′-GGAGTGTGTATCCCGTAGGTG-3′, R1: 5′-CTGGGGACATGCAGAGAGTG-3′, the amplicon length is 103 bp, GenBank accession no. DQ452569) (Koppel, Ruf, & Rentsch, 2011). The F2/R2 primers targeted the cytochrome b genes of pork (F2: 5′- CTGC CCTGAGGACAAATATCATTC-3′, R2: 5′- AAGCCCCCTCAGATTCATTCT ACG-3′, the amplicon length is 107 bp, GenBank accession no. AF034253) (Amaral, Santos, Oliveira, & Mafra, 2017). The F3/B3 primers targeted the mitochondrial D-loop region genes of pork (F3: 5′AGCTGGACTTCATGGAACTC-3′, R3: 5′- GCACGTTATGTCCTGTA ACC-3′, the amplicon length is 83 bp, GenBank accession no. AF276931.1) (Kim, Yoo, Lee, Hong, & Kim, 2016). The annealing/extension temperatures of three primer sets were optimized with pure pork meat and beef meat as targets. And the specificity of primers was evaluated by detecting several common meat species (duck, chicken, goose and sheep). 2.4. Real-time PCR assay The PCR mixtures contained 0.625 U of Takara Taq HS DNA polymerase (Takara Biotechnology Co., Ltd., Dalian, China), 2.5 μL of 10 x PCR Buffer (Mg2+ Plus), 0.8 mM of dNTPs, 0.4 μM of each primer, 4 μM of SYTO 9, and 4 μL of DNA template (~0.3 ng/μL), in a total volume of 25 μL. The amplification protocol was 94 °C for 5 min followed by 45 cycles at 94 °C for 10 s, 64 °C for 30 s. Fluorescence signal was collected on the BIO-RAD IQ™5 Real Time PCR instrument at the end of each cycle and the Cycle threshold value (Ct) reflects the initial number of the cycles at which a detectable fluorescence signal is generated. Realtime PCR trials were repeated in three independent assays with three separate samples or binary mixtures as targets.
2. Materials and methods 2.1. Materials Fresh raw pork meat (Sus scrofa domestica) and beef meat (Bos taurus) were purchased from local supermarket in Hangzhou, China. These meat samples were minced separately after purchase. Binary mixtures containing 100%, 10%, 1%, 0.1%, 0.01%, 0% (w/w) of raw pork meats in raw beef meats were prepared to a final weight of 100 g. The mixtures were minced by using a high speed blender (JOYOUNG blender JYL-C012, Jinan City, China) for 15 min to ensure they mixed evenly. Cooked beef meatballs containing 100%, 10%, 1%, 0.1%, 0.01%, 0% of pork meats were prepared in the laboratory according to Rahman et al. (Rohman, Sismindari, Erwanto, & Man, 2011). Raw meat mixtures were first mixed with starch in a ratio of 9 to 1, and then mixed with salt and certain spices, and finally shaped into balls. Finally, they were cooked in boiling water for 12 min. Each mixture was processed separately using different containers to avoid contaminations. To verify the specificity of primers, raw duck meat (Anas platyrhynchos), chicken meat (Gallus gallus), goose meat (Anser anser) and sheep (Ovis aries) meat were purchased from local supermarket in Hangzhou, China. All of the samples were immediately stored at −20 °C after
2.5. Rapid PCR assay The rapid PCR mixtures contained 6.25 U of Takara Taq HS DNA polymerase (Takara Biotechnology Co., Ltd., Dalian, China), 2.5 μL of 10 x PCR Buffer (Mg2+ Plus), 0.8 mM of dNTPs, 0.8 μM of each primer, 4 μM of SYTO 9, and 2 μL of DNA template (~0.3 ng/μL), in a total volume of 12.5 μL. The glass capillary which has great heat conductivity was used as our reaction vessel (Elenitoba-Johnson, David, Crews, & Wittwer, 2008). A designed device which included a servo motor and two ordinary water baths was employed to perform rapid PCR (the appearance of the device can be seen in Supporting Information, Fig. S1). The temperatures of two water baths, which controlled the reaction temperature, were set at 98 °C for DNA 2
Food Control 109 (2020) 106905
H. Wu, et al.
Information, Table S1), which illustrated the F2/R2 primers had high specificity of detection.
denaturation and 64 °C for primer annealing/extension, respectively. The detailed description about the device can be seen in our previously published work (Wang et al., 2018). The reaction mixtures were firstly stayed at 98 °C water bath for 20 s followed by 45 cycles at 98 °C water bath for 2 s, 64 °C water bath for 4 s. The reaction process would be completed in 5 min, which included the time of transferring between water baths.
3.2. Real-time PCR assay for binary meat mixtures To test the sensitivity of real-time PCR in the detection of raw binary meat mixtures, raw beef meats containing different amounts of pork meats (100%, 10%, 1%, 0.1%, 0.01% and 0%) were prepared as targets. Results indicated that as low as 0.01% of pork meats in raw binary meat mixtures could be detected by using real-time PCR (Fig. 2a). The standard deviations (SD) of Ct values were (from 100% to 0.01% of pork meats in raw beef meats): 0.165, 0.119, 0.047, 0.210 and 0.407. The linear relationship between averaged Ct values and the logarithm of pork contents in raw beef meat (100, 10, 1, 0.1 and 0.01%) was shown in the inset figure. The slope of the curve was −3.597 and the correlation coefficient (R2) was 0.9973 (Fig. 2a). It illustrated the real-time PCR had good repeatability and the amplification efficiency could achieve 90% in the detection of raw binary meat mixtures.
2.6. Visual detection of amplified products with a portable device SYTO 9 fluorescence dye, which can be excited at 470-nm wavelength region when binding with double-stranded DNA, was pre-added into the reaction solution before amplification. After the rapid PCR was finished, a portable and simple device which could adjust heating temperature was designed to observe the detection results. In the device, a small camera was employed to observe fluorescence signal, which could record results in real time. Two LED lights which could produce 470-nm blue light were used to illuminate the reaction solution from the bottom (the detailed introduction about the device is provided in Supporting Information, Fig. S2). After the glass capillary was put into the device, the heating temperature of the device was set at 72 °C. Then positive samples would produce green fluorescence (520 nm) while no fluorescence signal was generated in negative samples. The detection results could be clearly detected by the naked eye under natural environment. 3. Results and discussions 3.1. Comparison of three primer sets In this study, three pork-specific primer sets (F1/R1, F2/R2 and F3/ R3) were used to detect pork meat (Amaral et al., 2017; Kim et al., 2016; Koppel et al., 2011). We first used the annealing/extension temperature provided by the original study (62 °C for F1/R1, 66 °C for F2/R2 and 60 °C for F3/R3) for the three primer sets to conduct realtime PCR with pure pork meat and beef meat as targets. Results indicated both F1/R1 primers and F3/R3 primers produced non-specific signal in the detection of pure beef meat except the F2/R2 primers (the data are not shown). Therefore, all three primer sets were further investigated by using three annealing/extension temperatures (62 °C, 64 °C and 66 °C) in the experiments. As shown in Fig. 1. The Ct values of F1/R1 primers were 29.86 (62 °C), 30.45 (64 °C) and 30.02 (66 °C) in the detection of pure pork meat, respectively. Non-specific signal did not appear in the detection of pure beef meat when the annealing/extension temperature was set at 64 °C or 66 °C (Fig. 1a). And the Ct values of F2/R2 primers were 22.12 (62 °C), 22.75 (64 °C) and 24.70 (66 °C) in the detection of pure pork meat, respectively. Non-specific signal was produced in the detection of pure beef meat after 37-cycle PCR when the annealing/extension temperature was set at 62 °C (Fig. 1b). The Ct values of F3/B3 primers were 25.32 (62 °C), 26.33 (64 °C) and 31.02 (66 °C) in the detection of pure pork meat, respectively. Non-specific signal did not appear in the detection of pure beef meat when the annealing/extension temperature was set at 64 °C or 66 °C (Fig. 1c). To sum up the above results, non-specific signal would not be produced in the detection of pure beef meat by using the three primer sets when the annealing/extension temperature was set at 64 °C or 66 °C. The Ct values of F2/R2 primers were smaller than other two primer sets in the detection of pure pork meat when using the same annealing/ extension temperature. Therefore, in this study, the F2/R2 primers were chosen as our subsequent PCR primers and the annealing/extension temperature was set at 64 °C, which was 2 °C lower than that of original study. Afterwards, the specificity of F2/R2 primers was further evaluated by employing several common meat species (duck, chicken, goose and sheep) as targets. Results indicated no amplification signal was generated in these samples (the results can be seen in Supporting
Fig. 1. Comparison of three primer sets by real-time PCR. The amplification results of F1/R1 primers (a), F2/R2 primers (b) and F3/R3 primers (c) in the detection of raw pork meat and beef meat. The red (square and up triangle), violet (circular and diamond) and blue (right triangle and pentagon) line represented primer annealing/extension temperature of 62 °C, 64 °C and 66 °C, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.) 3
Food Control 109 (2020) 106905
H. Wu, et al.
Subsequently, the real-time PCR assay was used to further detect processed binary meat mixtures. Cooked beef meatballs containing different amounts of pork meats (100%, 10%, 1%, 0.1%, 0.01% and 0%) were chosen as our experimental samples. As shown in Fig. 2b, results indicated that as low as 0.01% of pork meats in cooked meatballs could also be detected. The stand deviations (SD) of Ct values were (from 100% to 0.01% of pork meats in cooked beef meatballs): 0.240, 0.164, 0.182, 0.075 and 0.096. The linear relationship between averaged Ct values and the logarithm of pork contents in cooked beef meatballs (100, 10, 1, 0.1 and 0.01%) was shown in the inset figure. The slope of the curve was −3.472 and R2 was 0.9845 (Fig. 2b). Similar to the results of detecting pork meat in raw beef meat, the real-time PCR also displayed good repeatability and the amplification efficiency could achieve 94% in the detection of cooked binary meat mixtures.
3.3. Rapid PCR assay for binary meat mixtures Compared with the real-time PCR, rapid PCR could complete the process of amplification in a shorter time. In this study, a simple and cost-effective device which included a servo motor and two ordinary water baths was employed to conduct rapid PCR (the appearance of the device can be seen in Supporting Information, Fig. S1). According to our previous research, nucleic acids could be amplified in minutes by cycling the plastic capillary between the two water baths (Wang et al., 2018). In order to increase the heat transfer efficiency between water baths and reaction solution, the glass capillary was employed as our reaction vessel. In addition, the concentrations of polymerase and primers were respectively increased by 10 times and 2 times to match the kinetics of primer annealing and polymerase extension under faster temperature cycling. According to previous specificity analysis of F2/ R2 primers, the temperatures of two water baths were set at 98 °C and 64 °C, respectively. To determine the time spent in each water bath, a thermocouple (Omega type T precision fine wire thermocouple) was used to measure the temperature change of reaction solution. As a result, 98 °C for 2 s and 64 °C for 4 s or 98 °C for 3 s and 64 °C for 5 s were both enough to make the temperatures of reaction solution
Fig. 2. Amplification curves of real-time PCR in the detection of pork meat in (a) raw beef meat and (b) cooked beef meatballs. The red (square), violet (up triangle), green (circular), pink (diamond), cyan (right triangle) and blue (pentagon) line represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork contents in the mixtures, respectively. The inset figure displays the linear relationship between Ct values and the logarithm of pork contents. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Fig. 3. The melt curves of amplified raw beef meat containing different pork contents by using rapid PCR. (a), (b), (c), (d), (e) and (f) represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork meats in raw beef meats, respectively. 4
Food Control 109 (2020) 106905
H. Wu, et al.
room temperature. According to previous analysis, the fluorescence signal caused by the secondary structures can be removed at an appropriate heating temperature in some isothermal reactions, like loopmediated isothermal amplification and recombinase polymerase amplification (Qian et al., 2018a,b,c; Qian et al., 2017). Then, the original melt curves of amplified products were firstly analyzed after rapid PCR was finished. Pure raw pork meat and beef meat were employed as positive and negative samples, respectively. As shown in Fig. 5a, the fluorescence signal values of negative samples could reach zero while that of positive samples were still high when the temperature was set at between 72 °C and 76 °C. It meant the background fluorescence signal of negative samples could be removed at a suitable heating temperature in the detection of amplified products of PCR. However, the fluorescence signal can be easily disturbed by ambient light so that the results were generally observed in dark environment. In order to solve these problems, a simple and portable device was designed by us (the detailed introduction about the device is provided in Supporting Information, Fig. S2). The device was made of light-proof material which could prevent ambient light interference. And a small camera was employed to observe the amplification results, which could prevent ambient light forming interference in the observation area. The device had a heated aluminum block whose temperature could be changed between 0 °C and 99 °C according to the need. According to previous results, the heating temperature was set at 72 °C to maximize the difference of fluorescence signal between positive and negative samples while negative samples did not have fluorescence signal. The visual detection results of positive and negative samples can be seen in Fig. 5a with the heating temperature set at 40 °C and 72 °C, respectively. Subsequently, rapid PCR combined with the portable device was used to detect pork meat in binary mixtures. The detection results are shown in Fig. 5b and c. Strong green fluorescence (520 nm) was produced in the detection of raw beef meat or cooked beef meatball containing 100%, 10%, 1%, 0.1%, 0.01% of pork meat. And the color of negative samples remained black. The fluorescence signal was relatively weak in the detection of 0.01% of pork meats in beef meat, but
changed between 95 °C and 64 °C (The results can be seen in Supporting Information, Fig. S3). To reduce total reaction time, 98 °C for 2 s and 64 °C for 4 s were chosen as our amplification procedure of rapid PCR. Nucleic acids from raw beef meat and cooked beef meatball contained different pork contents (100%, 10%, 1%, 0.1%, 0.01% and 0%) were used as templates. To judge whether the targeted fragment was amplified, the reaction mixtures were centrifuged to PCR tube to conduct melt curve analysis on the BIO-RAD IQ™5 Real Time PCR instrument. The results are shown in Fig. 3 and Fig. 4. Their melt temperatures were all about 79.5 °C except the negative samples (pure raw beef meat and pure cooked beef meatball). It was the same with the results of real-time PCR assay in the original study (Amaral et al., 2017). It illustrated that the rapid PCR with the designed device could be used to detect pork meat. From the results of melt curves, the peak values of melt curves were much smaller than that of other positive samples when detecting 0.01% of pork meats in raw beef meats or cooked beef meatballs (Figs. 3e and 4e), which meant the amplification reaction still stayed in the exponential amplification stage so that the quantities of amplified products were not a lot in the reaction solution. The amplification reactions of other positive samples had reached or were about to reach the plateau stage. But all positive samples could reach the plateau stage within 45 cycles in the real-time PCR (Fig. 2a and b). It illustrated the amplification efficiency of rapid PCR had a little decline compared with real-time PCR in our experiments, but it did not affect the detection results.
3.4. Visual detection of amplified products with a portable device The amplified products of PCR were generally detected by agarose gel electrophoresis, which is complicated and time-consuming. SYTO 9 fluorescence dye, a kind of DNA intercalating dyes, can be added to reaction solution before amplification and has a little effect on the reaction itself. After the reaction was finished, the positive and negative samples could not be identified under the blue light (470 nm) by the naked eye at room temperature. High fluorescence signal would be produced by the primers which could form secondary structures at
Fig. 4. The melt curves of amplified cooked beef meatball containing different pork contents by using rapid PCR. (a), (b), (c), (d), (e) and (f) represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork meats in cooked beef meatballs, respectively. 5
Food Control 109 (2020) 106905
H. Wu, et al.
Fig. 5. (a) The original melt curves of positive and negative amplified samples. Visual detection of amplified products of (b) raw beef meat and (c) cooked beef meatballs containing different amounts of pork meat at 72 °C with the designed portable device. ‘N’ represented negative sample and ‘P’ represented positive sample. 100%, 10%, 1%, 0.1%, 0.01% and 0% represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork meats in the mixtures, respectively.
the detection results could still be discriminated by the naked eye compared with that of negative samples. The fluorescence intensity of amplified products corresponded well with the results of previous melt curves (Figs. 3 and 4), which illustrated the visual detection method was reliable. The process of visual detection could be finished in 30s and the risk of carryover contamination could be avoided due to no uncapping operation.
Technology Cooperation Project of Universities (Institutes)in Fuzhou City (2017-G-64).
4. Conclusions
Conflicts of interest
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.foodcont.2019.106905.
The authors declare that they have no conflict of interest.
In summary, a rapid, sensitive and cost-effective visual detection method for detecting pork contents in raw beef meat or cooked beef meatball is developed. Rapid PCR is employed to amplify DNA of pork meat, which can be accomplished in 5 min by using two water baths. In order to make it easier and more convenient to identify the amplification results, a SYTO 9-based visual detection method is developed. By analyzing the original melt curves of positive and negative samples, the fluorescence signal of negative samples can be removed at 72 °C. The positive samples can generate green fluorescence, while the color of negative samples remains black under the blue lights (470 nm). A portable device is designed to make detection results identified by the naked eye under natural environment. The sensitivity of this method is comparable with real-time PCR and as low as 0.01% of pork meats in raw beef meat or cooked beef meatball can be detected. The whole detection process from sampling to results can be accomplished in 20 min. And the contamination can be effectively avoided because the lid of reaction vessel did not open during the entire detection process. The developed detection method will be further used to detect pork meat in ternary mixtures and the results will be assessed. Besides, this method also has the potential to detect other species of meat by using different primers and it would contribute a lot to the detection of meat adulteration.
References Abbas, O., Zadravec, M., Baeten, V., Mikus, T., Lesic, T., Vulic, A., et al. (2018). Analytical methods used for the authentication of food of animal origin. Food Chemistry, 246, 6–17. Alikord, M., Momtaz, H., Keramat, J., Kadivar, M., & Rad, A. H. (2018). Species identification and animal authentication in meat products: A review. Journal of Food Measurement and Characterization, 12, 145–155. Amaral, J. S., Santos, G., Oliveira, M. B. P. P., & Mafra, I. (2017). Quantitative detection of pork meat by evagreen real-time PCR to assess the authenticity of processed meat products. Food Control, 72, 53–61. Ballin, N. Z., Vogensen, F. K., & Karlsson, A. H. (2009). Species determination - can we detect and quantify meat adulteration? Meat Science, 83, 165–174. Bohme, K., Calo-Mata, P., Barros-Velazquez, J., & Ortea, I. (2019). Review of recent DNAbased methods for main food-authentication topics. Journal of Agricultural and Food Chemistry, 67, 3854–3864. Cao, Y. H., Zheng, K. Z., Jiang, J. F., Wu, J. L., Shi, F. X., Song, X. M., et al. (2018). A novel method to detect meat adulteration by recombinase polymerase amplification and SYBR green I. Food Chemistry, 266, 73–78. Chuah, L. O., He, X. B., Effarizah, M. E., Syahariza, Z. A., Shamila-Syuhada, A. K., & Rusul, G. (2016). Mislabelling of beef and poultry products sold in Malaysia. Food Control, 62, 157–164. Elenitoba-Johnson, O., David, D., Crews, N., & Wittwer, C. T. (2008). Plastic versus glass capillaries for rapid-cycle PCR. Biotechniques, 44, 487–490. Farrar, J. S., & Wittwer, C. T. (2015). Extreme PCR: Efficient and specific DNA amplification in 15-60 seconds. Clinical Chemistry, 61, 145–153. Godfray, H. C. J., Aveyard, P., Garnett, T., Hall, J. W., Key, T. J., Lorimer, J., et al. (2018). Meat consumption, health, and the environment. Science, 361, 1–8. Hole, K., & Nfon, C. (2019). Foot-and-mouth disease virus detection on a handheld realtime polymerase chain reaction platform. Transboundary and Emerging Diseases, 66, 1789–1795. Houssin, T., Cramer, J., Grojsman, R., Bellahsene, L., Colas, G., Moulet, H., et al. (2016). Ultrafast, sensitive and large-volume on-chip real-time PCR for the molecular diagnosis of bacterial and viral infections. Lab on a Chip, 16, 1401–1411. Kane, D. E., & Hellberg, R. S. (2016). Identification of species in ground meat products sold on the us commercial market using DNA-based methods. Food Control, 59, 158–163. Kim, M., Yoo, I., Lee, S. Y., Hong, Y., & Kim, H. Y. (2016). Quantitative detection of pork in commercial meat products by TaqMan (R) real-time PCR assay targeting the mitochondrial d-loop region. Food Chemistry, 210, 102–106. Koppel, R., Ruf, J., & Rentsch, J. (2011). Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, horse and sheep. European Food Research and Technology, 232, 151–155.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the article entitled “Identification of pork in raw meat or cooked meatballs within 20 min using rapid PCR coupled with visual detection”. Acknowledgement This work was supported by the National Natural Science Foundation of China (31571918); Key Research & Development Programs in Yunnan province (2018BCE005); and Science and 6
Food Control 109 (2020) 106905
H. Wu, et al.
method for duplex shrimp pathogens detection with high specificity using rapid PCR and molecular beacon. Analytica Chimica Acta, 1040, 105–111. Rahmati, S., Julkapli, N. M., Yehye, W. A., & Basirun, W. J. (2016). Identification of meat origin in food products-a review. Food Control, 68, 379–390. Rajendran, V. K., Bakthavathsalam, P., Bergquist, P. L., & Sunna, A. (2019). A portable nucleic acid detection system using natural convection combined with a smartphone. Biosensors and Bioelectronics, 134, 68–75. Rohman, A., Sismindari, Erwanto, Y., & Man, Y. B. C. (2011). Analysis of pork adulteration in beef meatball using fourier transform infrared (FTIR) spectroscopy. Meat Science, 88, 91–95. Ropodi, A. I., Panagou, E. Z., & Nychas, G.-J. E. (2017). Multispectral imaging (msi): A promising method for the detection of minced beef adulteration with horsemeat. Food Control, 73, 57–63. Trauba, J. M., & Wittwer, C. (2017). Microfluidic extreme PCR: < 1 minute DNA amplification in a thin film disposable. Journal of Biomedical Science and Engineering, 10, 219–231. Wang, R., Zhang, F., Qian, C., Wu, C., Ye, Z. Z., Wang, L., et al. (2018). Counting DNA molecules with visual segment-based readouts in minutes. Chemical Communications, 54, 1105–1108. Xu, R. S., Wei, S., Zhou, G. B., Ren, J., Liu, Z. Y., Tang, S. Z., et al. (2018). Multiplex taqman locked nucleic acid real-time PCR for the differential identification of various meat and meat products. Meat Science, 137, 41–46. Zhang, M. Y., Wu, P., Wu, J., Ping, J. F., & Wu, J. (2019). Advanced DNA-based methods for the detection of peanut allergens in processed food. TRAC Trends in Analytical Chemistry, 114, 278–292. Zhuo, Z., Wang, J., Chen, W. D., Su, X. S., Chen, M. Y., Fang, M. J., et al. (2018). A rapid on-site assay for the detection of influenza a by capillary convective PCR. Molecular Diagnosis and Therapy, 22, 225–234.
Lo, Y. T., & Shaw, P. C. (2018). DNA-based techniques for authentication of processed food and food supplements. Food Chemistry, 240, 767–774. Magiati, M., Myridaki, V. M., Christopoulos, T. K., & Kalogianni, D. P. (2019). Lateral flow test for meat authentication with visual detection. Food Chemistry, 274, 803–807. Marziliano, N., Notarangelo, M. F., Cereda, M., Caporale, V., Coppini, L., Demola, M. A., et al. (2015). Rapid and portable, lab-on-chip, point-of-care genotyping for evaluating clopidogrel metabolism. Clinica Chimica Acta, 451, 240–246. Murugaiah, C., Noor, Z. M., Mastakim, M., Bilung, L. M., Selamat, J., & Radu, S. (2009). Meat species identification and halal authentication analysis using mitochondrial DNA. Meat Science, 83, 57–61. Naaum, A. M., Shehata, H. R., Chen, S., Li, J., Tabujara, N., Awmack, D., et al. (2018). Complementary molecular methods detect undeclared species in sausage products at retail markets in Canada. Food Control, 84, 339–344. Pavlidis, D. E., Mallouchos, A., Ercolini, D., Panagou, E. Z., & Nychas, G. J. E. (2019). A volatilomics approach for off-line discrimination of minced beef and pork meat and their admixture using hs-spme gc/ms in tandem with multivariate data analysis. Meat Science, 151, 43–53. Qian, W. J., Lu, Y., Meng, Y. Q., Ye, Z. Z., Wang, L., Wang, R., et al. (2018c). Field detection of citrus huanglongbing associated with 'candidatus liberibacter asiaticus' by recombinese polymerase amplification within 15 min. Journal of Agricultural and Food Chemistry, 66, 5473–5480. Qian, W. J., Meng, Y. Q., Lu, Y., Wu, C., Wang, R., Wang, L., et al. (2017). Rapid, sensitive, and carryover contamination-free loop-mediated isothermal amplificationcoupled visual detection method for 'candidatus liberibacter asiaticus'. Journal of Agricultural and Food Chemistry, 65, 8302–8310. Qian, C., Wang, R., Wu, H., Ping, J., & Wu, J. (2018b). Recent advances in emerging DNAbased methods for genetically modified organisms (gmos) rapid detection. TRAC Trends in Analytical Chemistry, 109, 19–31. Qian, C., Wang, R., Wu, C., Wang, L., Ye, Z. Z., Wu, J., et al. (2018a). A fast and visual
7
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Identification of pork in raw meat or cooked meatballs within 20 min using rapid PCR coupled with visual detection
T
Hui Wua, Cheng Qiana, Rui Wanga, Cui Wua, Zhen Wanga, Liu Wangc, Mengyao Zhanga, Zunzhong Yea,∗, Fang Zhangd, Jin-song Heb,∗∗, Jian Wua a
College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou, 310058, China College of Food Science and Technology, Yunnan Agricultural University, Kunming, 650201, China c Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, State Key Laboratory for Quality and Safety of Agro-products, Hangzhou, 310021, China d College of Biological Science and Engineering, Fuzhou University, Fuzhou, 350108, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Pork Meat adulteration Rapid PCR Visual detection Portable device
Meat adulteration is seriously damaging the interests of consumers. It is important to develop a rapid, simple, cost-effective and sensitive method to identify meat species. In this study, a pair of suitable pork-specific primers was determined by the comparison of three pairs of pork-specific primers and the annealing/extension temperature optimized here was set at 64 °C. Rapid polymerase chain reaction (PCR) with glass capillary as reaction vessel, which could complete 45 cycles in 5 min by using two ordinary water baths, was established to detect pork contents in raw beef meat or cooked beef meatballs. A SYTO 9-based visual detection method was used to evaluate the amplification results. The fluorescence signal of negative samples could be removed at 72 °C according to the results of original melt curves of positive and negative samples. Strong green fluorescence would be produced in positive samples while the color of negative samples still remained black under the blue light (470 nm). A simple and portable device was designed to prevent detection results disturbed by ambient light and make operation easier. As low as 0.01% pork contents in binary mixtures could be detected and the whole detection process could be finished in 20 min from sampling to results. The developed method would have great potential for rapid on-site detection of pork meat and identification of meat species.
1. Introduction With the development of social economy and the growth of population, the global consumption of meat is rising (Godfray et al., 2018). Due to the difference in prices, some unscrupulous traders try to make more profit by replacing high-priced meat with low-priced meat. For example, beef meat was substituted with pork meat or horse meat (Pavlidis, Mallouchos, Ercolini, Panagou, & Nychas, 2019; Ropodi, Panagou, & Nychas, 2017). When different kinds of meat are mixed or heated, the morphological characteristics of meat can not be distinguished by the naked eye. This adulteration of meat is very dangerous for allergic individuals and people with religious beliefs (Ballin, Vogensen, & Karlsson, 2009). Thus, to confirm the authenticity of food labels and ensure the safety of consumers, many food authorities have strengthened supervision of adulteration of commercial meat products since 2013 (Chuah et al., 2016; Kane & Hellberg, 2016; Naaum et al.,
∗
2018). Therefore, it is urgently necessary to develop a rapid, sensitive, cost-effective and simple analytical method for meat species identification (Abbas et al., 2018; Xu et al., 2018). So far, many detection methods have been developed to identify meat species based either on proteins or DNA sequences (Alikord, Momtaz, Keramat, Kadivar, & Rad, 2018; Bohme, Calo-Mata, BarrosVelazquez, & Ortea, 2019; Magiati, Myridaki, Christopoulos, & Kalogianni, 2019). Protein-based detection methods mainly include gel electrophoresis, chromatography, spectroscopy and enzyme-linked immunosorbent assay (ELISA). Among them, ELISA is the most commonly used method, which includes indirect ELISA and sandwich ELISA. But proteins are easily degradable during food processing and the quantities of proteins are susceptible to the expression of genes. Therefore, the sensitivity of these methods is generally lower than that of methods based on DNA analysis (Qian, Wang, Wu, Ping & Wu, 2018a,b,c; Rahmati, Julkapli, Yehye, & Basirun, 2016; Zhang, Wu, Wu, Ping, &
Corresponding author. Corresponding author. E-mail addresses: [email protected] (Z. Ye), [email protected] (J.-s. He).
∗∗
https://doi.org/10.1016/j.foodcont.2019.106905 Received 9 April 2019; Received in revised form 18 September 2019; Accepted 20 September 2019 Available online 20 September 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.
Food Control 109 (2020) 106905
H. Wu, et al.
preparation until DNA extraction. LightCycler® glass capillaries (20 μL) were purchased from Roche Diagnostics Corporation, USA.
Abbreviations used TE PCR NaCl SDS dNTP
Tris-EDTA Polymerase chain reaction Sodium chloride Sodium dodecyl sulfate Deoxyribonucleoside triphosphate
2.2. DNA extraction In order to construct a rapid, simple and cost-effective method to extract nucleic acids of meat, a new extraction method for meat was established and it was performed as followed: 100 mg of minced meat were put into a 1.5 mL centrifuge tube. 150 μL of lysate (0.5 M NaCl and 0.5% SDS (w/v)) was then transferred into the tube. The tube was shaken for 30 s and incubated at room temperature for 3 min. Then, the tube was centrifuged by a portable instrument at 10000 rpm for 1 min. The supernatant was 50-fold diluted with Tris-EDTA (TE) buffer. 4 μL of the rough lysate was used as a DNA template. The entire process of extraction would be finished in 12 min, including the time of weighing the samples. Three separate extractions for all samples or binary mixtures were prepared. DNA concentration was estimated by UV absorption spectrophotometry at 260 nm.
Wu, 2019; Murugaiah et al., 2009); DNA-based detection methods mainly include real-time PCR, isothermal amplification, digital PCR, biosensors, etc. The limits of detection (LODs) of these methods range from 0.01% to 0.1% of adulteration. But the detection time of these methods requires commonly more than 40 min from sampling to results (Alikord et al., 2018; Cao et al., 2018; Lo & Shaw, 2018; Magiati et al., 2019). With the understanding of the kinetics of PCR, the time of PCR is limited by device and not biochemistry. As long as the heat transfer rate and the concentration of critical reagents are increased, one cycle of PCR can be finished in less than 20 s (Farrar & Wittwer, 2015). Some researchers have used rapid PCR to conduct molecular diagnosis of bacteria, virus or genetically modified organisms (Houssin et al., 2016; M Trauba & Wittwer, 2017; Qian et al., 2018a,b,c; Wang et al., 2018). And there are many portable platforms being developed to carry out rapid PCR, like Q3 lab-on-chip (Marziliano et al., 2015), handheld Biomeme PCR thermocycler (Hole & Nfon, 2019), some convective PCR devices (Rajendran, Bakthavathsalam, Bergquist, & Sunna, 2019; Zhuo et al., 2018), etc. But the operation process is still relative sophisticated and time-consuming (~30 min) while the design of platforms is relative difficult. In addition, as we know, rapid PCR for identifying meat species has not been reported in the literature until now. In this study, rapid PCR coupled with visual detection method for detecting pork contents in raw beef meat or cooked beef meatball was established. Rapid PCR was performed by using only two ordinary water baths without needing other expensive instruments and 45-cycle of PCR could be finished in 5 min. A SYTO 9-based visual detection method of amplified products without uncapping operation was developed and the detection results were observed by using a simple and portable device designed by our group. Positive samples would produce green fluorescence while the color of negative samples remained black at 72 °C under the blue lights (470 nm). The whole process of detection could be finished in 20 min from sampling to results.
2.3. Oligonucleotide primers Three pork-specific primer sets targeted different fragments of genes of pork separately were used in this study. The F1/R1 primers targeted the beta-actin genes of pork (F1: 5′-GGAGTGTGTATCCCGTAGGTG-3′, R1: 5′-CTGGGGACATGCAGAGAGTG-3′, the amplicon length is 103 bp, GenBank accession no. DQ452569) (Koppel, Ruf, & Rentsch, 2011). The F2/R2 primers targeted the cytochrome b genes of pork (F2: 5′- CTGC CCTGAGGACAAATATCATTC-3′, R2: 5′- AAGCCCCCTCAGATTCATTCT ACG-3′, the amplicon length is 107 bp, GenBank accession no. AF034253) (Amaral, Santos, Oliveira, & Mafra, 2017). The F3/B3 primers targeted the mitochondrial D-loop region genes of pork (F3: 5′AGCTGGACTTCATGGAACTC-3′, R3: 5′- GCACGTTATGTCCTGTA ACC-3′, the amplicon length is 83 bp, GenBank accession no. AF276931.1) (Kim, Yoo, Lee, Hong, & Kim, 2016). The annealing/extension temperatures of three primer sets were optimized with pure pork meat and beef meat as targets. And the specificity of primers was evaluated by detecting several common meat species (duck, chicken, goose and sheep). 2.4. Real-time PCR assay The PCR mixtures contained 0.625 U of Takara Taq HS DNA polymerase (Takara Biotechnology Co., Ltd., Dalian, China), 2.5 μL of 10 x PCR Buffer (Mg2+ Plus), 0.8 mM of dNTPs, 0.4 μM of each primer, 4 μM of SYTO 9, and 4 μL of DNA template (~0.3 ng/μL), in a total volume of 25 μL. The amplification protocol was 94 °C for 5 min followed by 45 cycles at 94 °C for 10 s, 64 °C for 30 s. Fluorescence signal was collected on the BIO-RAD IQ™5 Real Time PCR instrument at the end of each cycle and the Cycle threshold value (Ct) reflects the initial number of the cycles at which a detectable fluorescence signal is generated. Realtime PCR trials were repeated in three independent assays with three separate samples or binary mixtures as targets.
2. Materials and methods 2.1. Materials Fresh raw pork meat (Sus scrofa domestica) and beef meat (Bos taurus) were purchased from local supermarket in Hangzhou, China. These meat samples were minced separately after purchase. Binary mixtures containing 100%, 10%, 1%, 0.1%, 0.01%, 0% (w/w) of raw pork meats in raw beef meats were prepared to a final weight of 100 g. The mixtures were minced by using a high speed blender (JOYOUNG blender JYL-C012, Jinan City, China) for 15 min to ensure they mixed evenly. Cooked beef meatballs containing 100%, 10%, 1%, 0.1%, 0.01%, 0% of pork meats were prepared in the laboratory according to Rahman et al. (Rohman, Sismindari, Erwanto, & Man, 2011). Raw meat mixtures were first mixed with starch in a ratio of 9 to 1, and then mixed with salt and certain spices, and finally shaped into balls. Finally, they were cooked in boiling water for 12 min. Each mixture was processed separately using different containers to avoid contaminations. To verify the specificity of primers, raw duck meat (Anas platyrhynchos), chicken meat (Gallus gallus), goose meat (Anser anser) and sheep (Ovis aries) meat were purchased from local supermarket in Hangzhou, China. All of the samples were immediately stored at −20 °C after
2.5. Rapid PCR assay The rapid PCR mixtures contained 6.25 U of Takara Taq HS DNA polymerase (Takara Biotechnology Co., Ltd., Dalian, China), 2.5 μL of 10 x PCR Buffer (Mg2+ Plus), 0.8 mM of dNTPs, 0.8 μM of each primer, 4 μM of SYTO 9, and 2 μL of DNA template (~0.3 ng/μL), in a total volume of 12.5 μL. The glass capillary which has great heat conductivity was used as our reaction vessel (Elenitoba-Johnson, David, Crews, & Wittwer, 2008). A designed device which included a servo motor and two ordinary water baths was employed to perform rapid PCR (the appearance of the device can be seen in Supporting Information, Fig. S1). The temperatures of two water baths, which controlled the reaction temperature, were set at 98 °C for DNA 2
Food Control 109 (2020) 106905
H. Wu, et al.
Information, Table S1), which illustrated the F2/R2 primers had high specificity of detection.
denaturation and 64 °C for primer annealing/extension, respectively. The detailed description about the device can be seen in our previously published work (Wang et al., 2018). The reaction mixtures were firstly stayed at 98 °C water bath for 20 s followed by 45 cycles at 98 °C water bath for 2 s, 64 °C water bath for 4 s. The reaction process would be completed in 5 min, which included the time of transferring between water baths.
3.2. Real-time PCR assay for binary meat mixtures To test the sensitivity of real-time PCR in the detection of raw binary meat mixtures, raw beef meats containing different amounts of pork meats (100%, 10%, 1%, 0.1%, 0.01% and 0%) were prepared as targets. Results indicated that as low as 0.01% of pork meats in raw binary meat mixtures could be detected by using real-time PCR (Fig. 2a). The standard deviations (SD) of Ct values were (from 100% to 0.01% of pork meats in raw beef meats): 0.165, 0.119, 0.047, 0.210 and 0.407. The linear relationship between averaged Ct values and the logarithm of pork contents in raw beef meat (100, 10, 1, 0.1 and 0.01%) was shown in the inset figure. The slope of the curve was −3.597 and the correlation coefficient (R2) was 0.9973 (Fig. 2a). It illustrated the real-time PCR had good repeatability and the amplification efficiency could achieve 90% in the detection of raw binary meat mixtures.
2.6. Visual detection of amplified products with a portable device SYTO 9 fluorescence dye, which can be excited at 470-nm wavelength region when binding with double-stranded DNA, was pre-added into the reaction solution before amplification. After the rapid PCR was finished, a portable and simple device which could adjust heating temperature was designed to observe the detection results. In the device, a small camera was employed to observe fluorescence signal, which could record results in real time. Two LED lights which could produce 470-nm blue light were used to illuminate the reaction solution from the bottom (the detailed introduction about the device is provided in Supporting Information, Fig. S2). After the glass capillary was put into the device, the heating temperature of the device was set at 72 °C. Then positive samples would produce green fluorescence (520 nm) while no fluorescence signal was generated in negative samples. The detection results could be clearly detected by the naked eye under natural environment. 3. Results and discussions 3.1. Comparison of three primer sets In this study, three pork-specific primer sets (F1/R1, F2/R2 and F3/ R3) were used to detect pork meat (Amaral et al., 2017; Kim et al., 2016; Koppel et al., 2011). We first used the annealing/extension temperature provided by the original study (62 °C for F1/R1, 66 °C for F2/R2 and 60 °C for F3/R3) for the three primer sets to conduct realtime PCR with pure pork meat and beef meat as targets. Results indicated both F1/R1 primers and F3/R3 primers produced non-specific signal in the detection of pure beef meat except the F2/R2 primers (the data are not shown). Therefore, all three primer sets were further investigated by using three annealing/extension temperatures (62 °C, 64 °C and 66 °C) in the experiments. As shown in Fig. 1. The Ct values of F1/R1 primers were 29.86 (62 °C), 30.45 (64 °C) and 30.02 (66 °C) in the detection of pure pork meat, respectively. Non-specific signal did not appear in the detection of pure beef meat when the annealing/extension temperature was set at 64 °C or 66 °C (Fig. 1a). And the Ct values of F2/R2 primers were 22.12 (62 °C), 22.75 (64 °C) and 24.70 (66 °C) in the detection of pure pork meat, respectively. Non-specific signal was produced in the detection of pure beef meat after 37-cycle PCR when the annealing/extension temperature was set at 62 °C (Fig. 1b). The Ct values of F3/B3 primers were 25.32 (62 °C), 26.33 (64 °C) and 31.02 (66 °C) in the detection of pure pork meat, respectively. Non-specific signal did not appear in the detection of pure beef meat when the annealing/extension temperature was set at 64 °C or 66 °C (Fig. 1c). To sum up the above results, non-specific signal would not be produced in the detection of pure beef meat by using the three primer sets when the annealing/extension temperature was set at 64 °C or 66 °C. The Ct values of F2/R2 primers were smaller than other two primer sets in the detection of pure pork meat when using the same annealing/ extension temperature. Therefore, in this study, the F2/R2 primers were chosen as our subsequent PCR primers and the annealing/extension temperature was set at 64 °C, which was 2 °C lower than that of original study. Afterwards, the specificity of F2/R2 primers was further evaluated by employing several common meat species (duck, chicken, goose and sheep) as targets. Results indicated no amplification signal was generated in these samples (the results can be seen in Supporting
Fig. 1. Comparison of three primer sets by real-time PCR. The amplification results of F1/R1 primers (a), F2/R2 primers (b) and F3/R3 primers (c) in the detection of raw pork meat and beef meat. The red (square and up triangle), violet (circular and diamond) and blue (right triangle and pentagon) line represented primer annealing/extension temperature of 62 °C, 64 °C and 66 °C, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.) 3
Food Control 109 (2020) 106905
H. Wu, et al.
Subsequently, the real-time PCR assay was used to further detect processed binary meat mixtures. Cooked beef meatballs containing different amounts of pork meats (100%, 10%, 1%, 0.1%, 0.01% and 0%) were chosen as our experimental samples. As shown in Fig. 2b, results indicated that as low as 0.01% of pork meats in cooked meatballs could also be detected. The stand deviations (SD) of Ct values were (from 100% to 0.01% of pork meats in cooked beef meatballs): 0.240, 0.164, 0.182, 0.075 and 0.096. The linear relationship between averaged Ct values and the logarithm of pork contents in cooked beef meatballs (100, 10, 1, 0.1 and 0.01%) was shown in the inset figure. The slope of the curve was −3.472 and R2 was 0.9845 (Fig. 2b). Similar to the results of detecting pork meat in raw beef meat, the real-time PCR also displayed good repeatability and the amplification efficiency could achieve 94% in the detection of cooked binary meat mixtures.
3.3. Rapid PCR assay for binary meat mixtures Compared with the real-time PCR, rapid PCR could complete the process of amplification in a shorter time. In this study, a simple and cost-effective device which included a servo motor and two ordinary water baths was employed to conduct rapid PCR (the appearance of the device can be seen in Supporting Information, Fig. S1). According to our previous research, nucleic acids could be amplified in minutes by cycling the plastic capillary between the two water baths (Wang et al., 2018). In order to increase the heat transfer efficiency between water baths and reaction solution, the glass capillary was employed as our reaction vessel. In addition, the concentrations of polymerase and primers were respectively increased by 10 times and 2 times to match the kinetics of primer annealing and polymerase extension under faster temperature cycling. According to previous specificity analysis of F2/ R2 primers, the temperatures of two water baths were set at 98 °C and 64 °C, respectively. To determine the time spent in each water bath, a thermocouple (Omega type T precision fine wire thermocouple) was used to measure the temperature change of reaction solution. As a result, 98 °C for 2 s and 64 °C for 4 s or 98 °C for 3 s and 64 °C for 5 s were both enough to make the temperatures of reaction solution
Fig. 2. Amplification curves of real-time PCR in the detection of pork meat in (a) raw beef meat and (b) cooked beef meatballs. The red (square), violet (up triangle), green (circular), pink (diamond), cyan (right triangle) and blue (pentagon) line represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork contents in the mixtures, respectively. The inset figure displays the linear relationship between Ct values and the logarithm of pork contents. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
Fig. 3. The melt curves of amplified raw beef meat containing different pork contents by using rapid PCR. (a), (b), (c), (d), (e) and (f) represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork meats in raw beef meats, respectively. 4
Food Control 109 (2020) 106905
H. Wu, et al.
room temperature. According to previous analysis, the fluorescence signal caused by the secondary structures can be removed at an appropriate heating temperature in some isothermal reactions, like loopmediated isothermal amplification and recombinase polymerase amplification (Qian et al., 2018a,b,c; Qian et al., 2017). Then, the original melt curves of amplified products were firstly analyzed after rapid PCR was finished. Pure raw pork meat and beef meat were employed as positive and negative samples, respectively. As shown in Fig. 5a, the fluorescence signal values of negative samples could reach zero while that of positive samples were still high when the temperature was set at between 72 °C and 76 °C. It meant the background fluorescence signal of negative samples could be removed at a suitable heating temperature in the detection of amplified products of PCR. However, the fluorescence signal can be easily disturbed by ambient light so that the results were generally observed in dark environment. In order to solve these problems, a simple and portable device was designed by us (the detailed introduction about the device is provided in Supporting Information, Fig. S2). The device was made of light-proof material which could prevent ambient light interference. And a small camera was employed to observe the amplification results, which could prevent ambient light forming interference in the observation area. The device had a heated aluminum block whose temperature could be changed between 0 °C and 99 °C according to the need. According to previous results, the heating temperature was set at 72 °C to maximize the difference of fluorescence signal between positive and negative samples while negative samples did not have fluorescence signal. The visual detection results of positive and negative samples can be seen in Fig. 5a with the heating temperature set at 40 °C and 72 °C, respectively. Subsequently, rapid PCR combined with the portable device was used to detect pork meat in binary mixtures. The detection results are shown in Fig. 5b and c. Strong green fluorescence (520 nm) was produced in the detection of raw beef meat or cooked beef meatball containing 100%, 10%, 1%, 0.1%, 0.01% of pork meat. And the color of negative samples remained black. The fluorescence signal was relatively weak in the detection of 0.01% of pork meats in beef meat, but
changed between 95 °C and 64 °C (The results can be seen in Supporting Information, Fig. S3). To reduce total reaction time, 98 °C for 2 s and 64 °C for 4 s were chosen as our amplification procedure of rapid PCR. Nucleic acids from raw beef meat and cooked beef meatball contained different pork contents (100%, 10%, 1%, 0.1%, 0.01% and 0%) were used as templates. To judge whether the targeted fragment was amplified, the reaction mixtures were centrifuged to PCR tube to conduct melt curve analysis on the BIO-RAD IQ™5 Real Time PCR instrument. The results are shown in Fig. 3 and Fig. 4. Their melt temperatures were all about 79.5 °C except the negative samples (pure raw beef meat and pure cooked beef meatball). It was the same with the results of real-time PCR assay in the original study (Amaral et al., 2017). It illustrated that the rapid PCR with the designed device could be used to detect pork meat. From the results of melt curves, the peak values of melt curves were much smaller than that of other positive samples when detecting 0.01% of pork meats in raw beef meats or cooked beef meatballs (Figs. 3e and 4e), which meant the amplification reaction still stayed in the exponential amplification stage so that the quantities of amplified products were not a lot in the reaction solution. The amplification reactions of other positive samples had reached or were about to reach the plateau stage. But all positive samples could reach the plateau stage within 45 cycles in the real-time PCR (Fig. 2a and b). It illustrated the amplification efficiency of rapid PCR had a little decline compared with real-time PCR in our experiments, but it did not affect the detection results.
3.4. Visual detection of amplified products with a portable device The amplified products of PCR were generally detected by agarose gel electrophoresis, which is complicated and time-consuming. SYTO 9 fluorescence dye, a kind of DNA intercalating dyes, can be added to reaction solution before amplification and has a little effect on the reaction itself. After the reaction was finished, the positive and negative samples could not be identified under the blue light (470 nm) by the naked eye at room temperature. High fluorescence signal would be produced by the primers which could form secondary structures at
Fig. 4. The melt curves of amplified cooked beef meatball containing different pork contents by using rapid PCR. (a), (b), (c), (d), (e) and (f) represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork meats in cooked beef meatballs, respectively. 5
Food Control 109 (2020) 106905
H. Wu, et al.
Fig. 5. (a) The original melt curves of positive and negative amplified samples. Visual detection of amplified products of (b) raw beef meat and (c) cooked beef meatballs containing different amounts of pork meat at 72 °C with the designed portable device. ‘N’ represented negative sample and ‘P’ represented positive sample. 100%, 10%, 1%, 0.1%, 0.01% and 0% represented 100%, 10%, 1%, 0.1%, 0.01% and 0% of pork meats in the mixtures, respectively.
the detection results could still be discriminated by the naked eye compared with that of negative samples. The fluorescence intensity of amplified products corresponded well with the results of previous melt curves (Figs. 3 and 4), which illustrated the visual detection method was reliable. The process of visual detection could be finished in 30s and the risk of carryover contamination could be avoided due to no uncapping operation.
Technology Cooperation Project of Universities (Institutes)in Fuzhou City (2017-G-64).
4. Conclusions
Conflicts of interest
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.foodcont.2019.106905.
The authors declare that they have no conflict of interest.
In summary, a rapid, sensitive and cost-effective visual detection method for detecting pork contents in raw beef meat or cooked beef meatball is developed. Rapid PCR is employed to amplify DNA of pork meat, which can be accomplished in 5 min by using two water baths. In order to make it easier and more convenient to identify the amplification results, a SYTO 9-based visual detection method is developed. By analyzing the original melt curves of positive and negative samples, the fluorescence signal of negative samples can be removed at 72 °C. The positive samples can generate green fluorescence, while the color of negative samples remains black under the blue lights (470 nm). A portable device is designed to make detection results identified by the naked eye under natural environment. The sensitivity of this method is comparable with real-time PCR and as low as 0.01% of pork meats in raw beef meat or cooked beef meatball can be detected. The whole detection process from sampling to results can be accomplished in 20 min. And the contamination can be effectively avoided because the lid of reaction vessel did not open during the entire detection process. The developed detection method will be further used to detect pork meat in ternary mixtures and the results will be assessed. Besides, this method also has the potential to detect other species of meat by using different primers and it would contribute a lot to the detection of meat adulteration.
References Abbas, O., Zadravec, M., Baeten, V., Mikus, T., Lesic, T., Vulic, A., et al. (2018). Analytical methods used for the authentication of food of animal origin. Food Chemistry, 246, 6–17. Alikord, M., Momtaz, H., Keramat, J., Kadivar, M., & Rad, A. H. (2018). Species identification and animal authentication in meat products: A review. Journal of Food Measurement and Characterization, 12, 145–155. Amaral, J. S., Santos, G., Oliveira, M. B. P. P., & Mafra, I. (2017). Quantitative detection of pork meat by evagreen real-time PCR to assess the authenticity of processed meat products. Food Control, 72, 53–61. Ballin, N. Z., Vogensen, F. K., & Karlsson, A. H. (2009). Species determination - can we detect and quantify meat adulteration? Meat Science, 83, 165–174. Bohme, K., Calo-Mata, P., Barros-Velazquez, J., & Ortea, I. (2019). Review of recent DNAbased methods for main food-authentication topics. Journal of Agricultural and Food Chemistry, 67, 3854–3864. Cao, Y. H., Zheng, K. Z., Jiang, J. F., Wu, J. L., Shi, F. X., Song, X. M., et al. (2018). A novel method to detect meat adulteration by recombinase polymerase amplification and SYBR green I. Food Chemistry, 266, 73–78. Chuah, L. O., He, X. B., Effarizah, M. E., Syahariza, Z. A., Shamila-Syuhada, A. K., & Rusul, G. (2016). Mislabelling of beef and poultry products sold in Malaysia. Food Control, 62, 157–164. Elenitoba-Johnson, O., David, D., Crews, N., & Wittwer, C. T. (2008). Plastic versus glass capillaries for rapid-cycle PCR. Biotechniques, 44, 487–490. Farrar, J. S., & Wittwer, C. T. (2015). Extreme PCR: Efficient and specific DNA amplification in 15-60 seconds. Clinical Chemistry, 61, 145–153. Godfray, H. C. J., Aveyard, P., Garnett, T., Hall, J. W., Key, T. J., Lorimer, J., et al. (2018). Meat consumption, health, and the environment. Science, 361, 1–8. Hole, K., & Nfon, C. (2019). Foot-and-mouth disease virus detection on a handheld realtime polymerase chain reaction platform. Transboundary and Emerging Diseases, 66, 1789–1795. Houssin, T., Cramer, J., Grojsman, R., Bellahsene, L., Colas, G., Moulet, H., et al. (2016). Ultrafast, sensitive and large-volume on-chip real-time PCR for the molecular diagnosis of bacterial and viral infections. Lab on a Chip, 16, 1401–1411. Kane, D. E., & Hellberg, R. S. (2016). Identification of species in ground meat products sold on the us commercial market using DNA-based methods. Food Control, 59, 158–163. Kim, M., Yoo, I., Lee, S. Y., Hong, Y., & Kim, H. Y. (2016). Quantitative detection of pork in commercial meat products by TaqMan (R) real-time PCR assay targeting the mitochondrial d-loop region. Food Chemistry, 210, 102–106. Koppel, R., Ruf, J., & Rentsch, J. (2011). Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, horse and sheep. European Food Research and Technology, 232, 151–155.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the article entitled “Identification of pork in raw meat or cooked meatballs within 20 min using rapid PCR coupled with visual detection”. Acknowledgement This work was supported by the National Natural Science Foundation of China (31571918); Key Research & Development Programs in Yunnan province (2018BCE005); and Science and 6
Food Control 109 (2020) 106905
H. Wu, et al.
method for duplex shrimp pathogens detection with high specificity using rapid PCR and molecular beacon. Analytica Chimica Acta, 1040, 105–111. Rahmati, S., Julkapli, N. M., Yehye, W. A., & Basirun, W. J. (2016). Identification of meat origin in food products-a review. Food Control, 68, 379–390. Rajendran, V. K., Bakthavathsalam, P., Bergquist, P. L., & Sunna, A. (2019). A portable nucleic acid detection system using natural convection combined with a smartphone. Biosensors and Bioelectronics, 134, 68–75. Rohman, A., Sismindari, Erwanto, Y., & Man, Y. B. C. (2011). Analysis of pork adulteration in beef meatball using fourier transform infrared (FTIR) spectroscopy. Meat Science, 88, 91–95. Ropodi, A. I., Panagou, E. Z., & Nychas, G.-J. E. (2017). Multispectral imaging (msi): A promising method for the detection of minced beef adulteration with horsemeat. Food Control, 73, 57–63. Trauba, J. M., & Wittwer, C. (2017). Microfluidic extreme PCR: < 1 minute DNA amplification in a thin film disposable. Journal of Biomedical Science and Engineering, 10, 219–231. Wang, R., Zhang, F., Qian, C., Wu, C., Ye, Z. Z., Wang, L., et al. (2018). Counting DNA molecules with visual segment-based readouts in minutes. Chemical Communications, 54, 1105–1108. Xu, R. S., Wei, S., Zhou, G. B., Ren, J., Liu, Z. Y., Tang, S. Z., et al. (2018). Multiplex taqman locked nucleic acid real-time PCR for the differential identification of various meat and meat products. Meat Science, 137, 41–46. Zhang, M. Y., Wu, P., Wu, J., Ping, J. F., & Wu, J. (2019). Advanced DNA-based methods for the detection of peanut allergens in processed food. TRAC Trends in Analytical Chemistry, 114, 278–292. Zhuo, Z., Wang, J., Chen, W. D., Su, X. S., Chen, M. Y., Fang, M. J., et al. (2018). A rapid on-site assay for the detection of influenza a by capillary convective PCR. Molecular Diagnosis and Therapy, 22, 225–234.
Lo, Y. T., & Shaw, P. C. (2018). DNA-based techniques for authentication of processed food and food supplements. Food Chemistry, 240, 767–774. Magiati, M., Myridaki, V. M., Christopoulos, T. K., & Kalogianni, D. P. (2019). Lateral flow test for meat authentication with visual detection. Food Chemistry, 274, 803–807. Marziliano, N., Notarangelo, M. F., Cereda, M., Caporale, V., Coppini, L., Demola, M. A., et al. (2015). Rapid and portable, lab-on-chip, point-of-care genotyping for evaluating clopidogrel metabolism. Clinica Chimica Acta, 451, 240–246. Murugaiah, C., Noor, Z. M., Mastakim, M., Bilung, L. M., Selamat, J., & Radu, S. (2009). Meat species identification and halal authentication analysis using mitochondrial DNA. Meat Science, 83, 57–61. Naaum, A. M., Shehata, H. R., Chen, S., Li, J., Tabujara, N., Awmack, D., et al. (2018). Complementary molecular methods detect undeclared species in sausage products at retail markets in Canada. Food Control, 84, 339–344. Pavlidis, D. E., Mallouchos, A., Ercolini, D., Panagou, E. Z., & Nychas, G. J. E. (2019). A volatilomics approach for off-line discrimination of minced beef and pork meat and their admixture using hs-spme gc/ms in tandem with multivariate data analysis. Meat Science, 151, 43–53. Qian, W. J., Lu, Y., Meng, Y. Q., Ye, Z. Z., Wang, L., Wang, R., et al. (2018c). Field detection of citrus huanglongbing associated with 'candidatus liberibacter asiaticus' by recombinese polymerase amplification within 15 min. Journal of Agricultural and Food Chemistry, 66, 5473–5480. Qian, W. J., Meng, Y. Q., Lu, Y., Wu, C., Wang, R., Wang, L., et al. (2017). Rapid, sensitive, and carryover contamination-free loop-mediated isothermal amplificationcoupled visual detection method for 'candidatus liberibacter asiaticus'. Journal of Agricultural and Food Chemistry, 65, 8302–8310. Qian, C., Wang, R., Wu, H., Ping, J., & Wu, J. (2018b). Recent advances in emerging DNAbased methods for genetically modified organisms (gmos) rapid detection. TRAC Trends in Analytical Chemistry, 109, 19–31. Qian, C., Wang, R., Wu, C., Wang, L., Ye, Z. Z., Wu, J., et al. (2018a). A fast and visual
7