- Email: [email protected]
Identification of putative endogenous proviral templates for progenitor mink cell focus-forming (MCF) MuLV-Related RNAs
VIROLOGY
164, 556-561
(1988)
Identification
HIROSHI AMANUMA,”
of Putative Endogenous Proviral Templates for Progenitor Focus-Forming (MCF) MuLV-Related RNAs FREDERIC LAIGRET,+’
MASAHIRO
NISHI,***
Mink Cell
YOJI IKAWA,+ AND ARIFA
S. KHAr+3
*Laboratory of Gene Technology and Safety, and *Laboratory of Molecular Oncology, institute of Physical and Chemical Research, Yatabe, Tsukuba. Ibaraki, Japan 305, and fLaboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892 Received November
19, 1987; accepted
February 2.2, 1988
Murine leukemia virus (MuLV)-related RNAs exhibiting different env deletions are believed to participate in the generation of leukemogenic mink cell focus-forming (MCF) viruses. We have cloned an endogenous MuLV provirus from AKR/J mouse DNA, designated as A-2, which may serve as template for the env-deleted E2 MuLV RNA, expressed in Glx+ mice (D. E. Levy et a/-, 1. Viral. 56, 691-700 (1985)). We have also isolated an endogenous MCF-related DNA, A-l, which shared close sequence homology with the 7.2-kb RNA expressed in AKR mice (F. Laigret eta/., J. W-o/. 62, 376-386 (1988)) and sustained an identical env deletion. The data indicate that putative precursor o 198s MCF-related RNAs are transcribed from a heterogenous family of env-deleted endogenous MuLV DNAs. Academic
Press,
Inc.
also been described in GIx+ mouse (9). This species, however, exhibited an env deletion different from that of the AKR 7.2-kb RNA. In this paper, we show that deleted endogenous MCF-related proviruses may serve as templates for these env-deleted precursor MCF RNAs. The isolation of endogenous MCF-related MuLV sequences from AKR/J mouse DNA has previously been described (10). Primary characterization by restriction enzyme and heteroduplex mapping of the recombinant X DNAs indicated two deleted proviruses. AA-1 DNA had an insert of 13 kb containing a 6.0-kb MuLV provirus and adjacent 5’and 3’flanking cell sequences. In the case of w-2, the cloned MuLV-reactive DNA segment was 14 kb and contained about 5.0 kb of proviral sequence and adjacent cellular sequences. Both A-l and A-2 MuLV DNAs contained gag, pal, and env sequences bound by LTRs; however, large deletions (> 1 kb) were sustained in the pal and env regions of both proviruses. A-l DNA was digested with BarnHI and a resulting 1.3-kb fragment containing the 3’ end of pal, env, and 3’ LTR was isolated for nucleotide sequencing. A-2 DNA was digested with BarnHI, and a 1.2-kb fragment encompassing the 3’ terminus of PO/, env, and 3’ LTR was isolated and sequenced. Both strands of the 1.2- and 1.3-kb BarnHI segments of A-l and A-2 DNAs, respectively, were sequenced by the chemical cleavage method developed by Maxam and Gilbert (I 1). We have determined nucleotide sequences of the 3’ regions of endogenous A-l and A-2 proviruses and have mapped precisely the env deletion sites in these
The generation of leukemogenic mink cell focusforming (MCF) viruses is a complex, multistep process and seems to occur in mouse thymus tissue (1,2). The genome of lymphomagenic MCF MuLVs is chimeric and consists of sequences derived from at least three different murine leukemia virus (MuLV) classes: LTRs are xenotropic-like; gag, 5’ PO/, and 3’ env regions contain ecotropic MuLV sequences; and 3’pol and 5’ env regions are endogenous MCF-related (3-5). The recombinational junctions between these MuLV sequences seem to differ in all MCF viruses (6), thus indicating an independent origin for each MCF MuLV. We have recently described ecotropic-, xenotropic-, and MCF-related viral transcripts expressed in AKR mouse thymus tissue which might be involved in MCF virus formation (7, 8). Among the RNAs implicated as potential progenitors of MCF MuLVs were two endogenous MCF env-related transcripts, 7.2 and 3.0 kb in size. Our results indicated that the 7.2-kb RNAs could donate MCF pol sequences and only a portion of env sequences, due to a deletion in env; the remaining env sequences could be derived from the 3.0-kb env mRNA species. Thus, MCF virus formation would require both 7.2- and 3.0-kb MCF-related RNAs along with ecotropic and xenotropic MuLV sequences. A putative MCF progenitor RNA, designated as E2, has ’ Present address: Laboratoire de Biologie Cellulaire et Moleculaire, INRA. 33140, Pont De Lay Maye. France. 2 Present address: Wakayama Prefectural Medical College, Wakayama, Japan. 3 To whom requests for reprints should be addressed. 0042-6822188 Copyright All rights
$3.00
0 1988 by Academic Press, Inc. of reproduction in any form reserved.
556
3’ ss MCF247 A\-.
CTCTCTCCAA . . . . .
.
.
.
.
.
GCTCAC . . . .
.
.
‘TAC . . .
.
AGGCCCTCCA . . . . .
MCF247 A-, T.,2
GGCCGCTGCC . . ..a..... . . . . . .
.
.
.
.
TATCAGGACC . . . . . . . . . .
. .
. .
. .
. .
. .
AGCTGGACCA .*........ .A.AA.....
MCF247 A-. T-,2
CGACACCGTG . . . . ...*.. . . . . . .
.
.
.
.
TGGGTACGCC . . . . . . . . . .
. .
. .
. .
. .
. .
GGCACCAGAC . . . . . . . . . .
MCF247 A-l T ?2 IA-21 EZ
CTACACCGTC . . . . . . . . . .
. .
. .
. .
. .
CTGCTGACCA . . . . . . . . . .
. .
. .
. .
. .
. .
CACGTAAAAG . . . . . . . . . . . . . . . . . . . .
. . . .
. . . . ..G. ..G.
. .
. .
.
.
.
.
.
AGCAGTACAA . . . . .
.
.
.
.
.
CGAGAGGTCT . . . . .
.
.
.
.
.
GGAAGCCACT . . . . .
.
.
.
.
-241
GCCAGTGATA . . . . . . ..T......
.
.
.
.
.
CCACACCCCT . . ...*.... . . . . .
.
.
.
.
.
TCCGTGTCGG-181 . . . . . . . . . . . . . .
. .
. .
. .
.
.
.
.
GGAAAGGACC-121 *‘...A.... . . . . . . .
.
.
.
.
..G. . .
.
TAAGAACTTG . . . . . . . . . .
. .
. .
. .
. .
. .
GAACCTCGCT . . . . . . . ...*....
.
.
CCCCCACCGC . . . . . . . . . . . .
. .
. .
. .
. .
TCTCAAAGTA . . . . . . . . . .
. .
. .
. .
. .
. .
GACGGCATCG . . . . . . . . . .
. .
. .
. .
. .
. .
CTGCGi$&&&-61 ..I....... . . . . . .
CGGCGACAAC . . . . . . . . . . . . . . . . . . . .
. . . .
. . . .
. . . .
. . . .
CCCTCCGGCC . . . . . . . . . . 7”““‘” ~..‘...‘..
. .
. .
. .
. .
. .
GGAACAGCAT . . . . . . . . . . . . . . . . . . . .
. . . .
. . . .
. . . .
. . . .
. . . .
CAGGACCGAC . . . . . . . . . . ‘“A.“... . ..A’“...
. .
Barn HI
MCF247 Al T-7 2 A-2 E2
&ACGCCGCT ..,....... ..,....... “C....... “C.....‘.
MU247 A-l T-7.2
r ATGGAAGGTC “AA” . . . . .
. .
. . . .
. .
8””
. , .
. . .
. . .
. . .
. .
. .
. .
. .
-1
PO’
61
.
. .
CAGCGTTCTC - 1 237 bP deletlm . . . . . . . .
AAAACCCCTT .
.
.
.
.
.
.
.
.
TTAACCCGTG
AAAGATAAGA .
.
.
..I
.
.
.
.
.
.
.
.
.
.
.
.
.
.
GGGCCCC
GITA
.
.
.
.
.
.
“C...
GTGTCGCACT . . . . .
.
.
.
.
.
CCCGGGGGAA292 ..*.......
GCA . .
CTGTA . . .
.
.
.
.
.
.
.
GCGAGGAAAC “A’A-.... . . . . . .
.
.
.
.
60
.
*
‘G
C CAACAGGG . . . . . .
.
.
.
GGACAGGCAT412 . . . . . . . . . . . .
. .
. .
. .
. .
ACCCCTCAGA472 . . . . . . ..,....G”
.
.
.
.
239
MCF247 Al IT -7.21 A-2 E2
A
TAAT
MCF247 pi-,
GAAAAAGGGC . . . . .
.
AGGGGACGAC ,A......
AAGAA . . .
..A.
.
.
TGGGATGAGA “A.......
CATT . . .
.
T .
GACT . . .
.
.
TACTGTGGCA ,........*
.
CTGGACTCGG “‘A..“..
TCTATG . . . .
.
.
TTTGC . . .
.
.
CCCGG . . .
.
.
.
TA . .
T
352
IT-?.21 A-2 E2 MU247 A-,
GTGGAGGGCC ...A......
GAGAGAGGGC . . . . . .
.
.
AATGGGGCTG ..*....... A...,.
IT -7.21 A-2 E2 MCF247 A., T.,2
ACTGGAAGCC . . . . . . . . . .
. .
. .
. .
. .
ATCATCATCA *......a*. . . ...*....
ATCAGGGCCC * ’ ’ ’ - A * . . . . . . .
. .
* .
* .
CTG ’ * - *
. .
TGGGACCTAA . . . . . . . . . .
. .
TTTCCCTTAA . . . . . . . . . .
. ..I ..T.
. .
TGAGACCACT . . . . . *..*......
. .
. .
. .
. .
A-2 E2
MCF247 A-l T-7.2
485
1758 GGGT
, ,281 I 1281
CCCCTGATAA )...... ).AG...
bpde,e,,on t+ mtion
TCCTCTTGTT .A.....A.. .A.....A”
AATTTTACTC1791 “‘CC....’ . ..cc.....
A- 2 E2 MU247 A, 772
TTTGGGCCTT ..C.AA..C.
GTATTCTCAA . . . . .
..C..A..C.
..T
.
.
.
.
.
.......
TCGCCTGGTC C...T..... C...T
CAGTTTGTAA . . . . . ; ,
A2 E2
MCF247 A, 772 A.2 E2
end p15E CAGGCCCTGG e......... .G..T..“. . . . . . . . . . . . . . . . . . .
MCF247 A 1
GAATCGCGTG A....A...A
T,2
.....A..A.
A-2 ,E2;
A....A.... pi. 1.
. .
TTCTGACCCA . . . . . . . . . . . . . . . .,........
. . .
. . .
. . .
. . .
. . .
ACAGTATCAC . . . . . .....G.... . . . . . . . . . .
AATAAAAGAT . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
. .
. .
. .
. .
.
.
.
.
e””
.A..
.
.
1
.
.
.
.
.
AAGACAGAAT . . . . .
.
.
.
.
.
TTCGGTGGTG1851 . . ..a.....
...................................
................. .................
......A ......A
..A ..A
. .
CAACTCAAAT . . . . . . . . . . . . . . . . . . . .
. . . .
. . . .
. . . .
. . . .
. . . .
CAATAGATCC “““G... . . . . ..G... . . . . . . . . . . . . . .
. .
.
.
TTCCAGAAAG . . . . .
.
.
.
.
.
AGGGGGGAAT . . . . . .
.
..a
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
. .
. .
. .
. .
TTTATTCAGT . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
. .
AGAAGAAGTA1911 .‘..A..... “.......G .A..A.. ....A.....
3’ LTR GAAAGACC . . . . .
r
”
.
1971
FIG. 1. Comparative nucleotide sequence analysis in 3’pol and env regions of A-l and A-2 MuLV DNAs. Sequences of AKR MCF247 provirus (3, 12) and cDNA clones of endogenous 7.2-kb MCF-related RNA [designated as T-7.2 (S)] and 6.0-kb MuLV RNA [designated as E2 (73)] are also included for comparison. SS indicates splice site (25); t, identical nucleotide; and parentheses, deleted sequences. Some of the sequences are presented incompletely (indicated by brackets around the clone designations at the left) due to unavailability of these sequences. The numbers at the right indicate nucleotides from the start of env.
557
558
SHORT COMMUNICATIONS
DNAs by comparison with MCF247 MuLV DNA (3, 72). Nucleotide sequence relatedness was established between the A-l and A-2 deleted proviruses, and the 7.2-kb (8) and E2 (9, 13) putative precursor MCF RNAs, respectively. Nucleotide sequences in the 3’pol and env regions of A-l and A-2 proviruses are presented in Fig. 1. Comparative sequence analysis between these DNAs and known MuLV sequences indicated that A-l and A-2 DNAs contained features characteristic of MCF viruses and endogenous MCF-related sequences (3). These included (i) a BarnHI site in pal (nucleotides -64 to -59) and (ii) a highly conserved 12-bp nucleotide stretch, TCAGGACCGACA (nucleotides -1 1 to l), adjacent to the env initiation codon (nucleotides 1 to 3). A high degree of nucleotide sequence homology was seen in env between MCF 247 provirus and the endogenous MuLV DNAs: 94% in case of A-i, and 93% for A-2. A notable difference was the deletion of env sequences in A-l and A-2 proviruses. A-l DNA had two deletions in its env gene. One deletion was located at the 5’ terminus of env (nucleotide position 9) and encompassed 237 bp. The other deletion was located 239 bp downstream of the first deletion and extended for 1281 bp. This large deletion encompassed the C-terminal half of gp70 and N-terminal two-thirds of pl5E. The A-2 proviral DNA had a single large env deletion encompassing 181 1 bp. The 5’ boundary of this deletion was close to the 5’ boundary of the smaller A-l deletion and was located 13 bp downstream of the env initiation site. The deletion in A-2 included the entire gp70 region and N-terminal 84% of Prl5E, leaving only 112 nucleotides at the 3’ env terminus. It is interesting to note that the deletion in A-l DNA was in-frame. The env sequences of A-l DNA, however, could not be translated due to a single third base substitution (A for G) in the env initiation codon (ATG). Deletions occurring in murine retroviral sequences are often characterized by the presence, in the presumed parental genome, of direct repeats at the beginning and end of the sequences involved in the deletion (8, 9, 14-16). For the single deletion in env of A-2, and the two env deletions in A-l, direct repeats were found in AKR MCF247 sequence (Fig. 2): in the case of A-2, a 7-bp perfect direct repeat was seen; imperfect direct repeats were present in the case of both deletions in A-l. Nucleotide sequence comparison between A-l and A-2 MuLV DNAs and cDNAs clones of 7.2-kb RNA [designated as T-7.2 (8)] and E2 RNA (13) is also shown in Fig. 1. A-2 MuLV DNA was virtually identical to E2 cDNA except for 3 bp (positions 3, 4, and 1903): the size and site of the env deletion in both was the
..**.** * qf..*** en”
A-l
A-l
de,-,
d&2
MCF247
-9
r AGGACCGACATGGAAGGTCCAGCGTTCT ..*.**I*.** ****
A-l
-9
AGGACCGACATAAAAGGAGACGACTGAG
MCF247
229
TTGTGCGATTTAATAGGGGACGACTGGG
MCF247
468
TCAGAATCAGGG-CCCCT-GTTATGATT *******.*. * .*.**
*
A-l
231
TCAGAATCAGAG-CCCCTTGATAATACT . . .
t.*.*.
MCF247
,749
A-2
dsl
A-2 MCF247
-4
f.
CACCATCATGGGTCCCCT-GATAATCCT I B””
MCF247
..I.
.f*.**..l.* q
r CGACATGGAAGGTCCAGCGTTCTCAAAA *l**** *.*****.*
-4
CGACATAAAAGGTCCAGTTTGTAAAAGA
1808
TCAATCGCCTGGTCCAGTTTGTAAAAGA
FIG. 2. Direct repeats are involved in deletions of A-l and A-2 MuLV sequences. The envdeletions in A-l and A-2 proviruses were located by nucleotide sequence comparison with AKR MCF247 MuLV DNA (3, 12). Direct repeat sequences are boxed. Nucleotide identity is indicated (*). The small deletion in A-i is designated as A-l del-1; larger deletion, A-l del-2. Numbers on the left of each sequence indicate the position of the first nucleotide in that sequence from the env initiation codon.
same. In case of A-l DNA, the large env deletion was identical to that present in T-7.2 cDNA; however, the rest of env, although closely related, could be distinguished. T-7.2 cDNA contained sequences in the region of the A-l small env deletion; several scattered single-base differences were also present between these two sequences. A noteworthy difference between the endogenous A-l and A-2 MuLV proviruses and the cDNAs of endogenous 7.2-kb and E2 MuLV RNAs was that the env initiation codon (ATG) was intact in the case of the RNA sequences. The entire 3’ LTR sequences of A-l and A-2 MuLV proviruses are presented in Fig. 3. A-l LTR consisted of 697 nucleotides and A-2 LTR, 742 nucleotides. Both LTRs contained the salient features of retroviral LTRs (17, 18) indicated in Fig. 3. In addition to these, both A-l and A-2 LTRs had sequences which are landmarks of endogenous MCF-related LTRs (4): a cellular 190-bp insert (nucleotide positions 278 to 471) was present in the U3 region bound by direct repeats; and a 14-bp sequence (nucleotide positions 104 to 117) was directly repeated near the 5’ end of the U3 region (positions 1 18 to 131). The major difference between the A-l and A-2 LTR sequences was the absence of sequences in A-l : 5 bp at nucleotide positions 162 to 166, and 39 bp at nucleotide positions 226 to 267. Otherwise, they were closely related (96% homology). Nucleotide sequence comparison of LTR regions of A-l, A-2, and cDNA clones T-7.2 (8) and E2 (9) indicated a high degree of homology between A-2 and E2
SHORT COMMUNICATIONS A-l T-7,2 A-2
TGAAAGACCCTACCATAAGG .......... .“.G.. ............................................................
........
CTTAGCAAGC
GG.
TAGCTGCAGT
E2
A-l T-7.2
A-2 i2 A-l T-7.2 A-2 E2
AACGCCATTT ..................
TGCAAGGCAT
80
...........................
E2
A-l T-7,2 A-2
559
GAAAAAGTAC
CAGAGCTGAG
..................
G...........TTCTCAAAAG
.............................. ..............................
TTAAAGATTA “c. ...... ........c. ..c. ......
GCACCTGGGC .......................... .................... ........................
TTACAAGAAA .......G .......G .“....G
..
GGCTGAATA .......... .......... ..........
ATACTGGGAC GC .......... GC ........ GC ........
AGGGAACAAG ..GC.G ....GC.G ....GC.G
.. ...
CCCGGCTCAG
GGCCAA-GAA
CAGATGGCTC ““‘“T.’ .......T .......T
....... ..
4
......A
. ... ... .._ ...
GTT
.. ..
120
-GGTCGTCAA T.......G.
180
G
---------CGGAAcCA(.C
240
G
CGGAACCAGC CGGAACCAGC
A-----TATC ‘CAGGA .CAGGA .CAGGA
.... .............. ..............
TCAGA----.....TAAA .....TAAA
TAAAG
300
A-l T-7.2 A-2 E2
360
420
A-l T-7.2 A-2 E2
A-l T-72 A-2
TCAGTTT C . . . f 1 . . . . . . ..I.. *. * . . . . . . . . c I
CCAAATGACC . . . . . . . . . . ..........
GGGAAGTACC . . . . . . ...* .....A
CCAAACCTTA . . . . . . . . . .
..............
TTCGAACTAA . . . . . . . . . .
CCAACCAGCT m.....
480
CGCTTCTCGC . . . . . . . . . .
540
AAAACCCCAC C”“T”” . . ..I..... . . . . . . . . . .
600
...A .............................
E2
..........
.....A
........................
x
A-l T-7 2 A-2 E?
TTCTGTAACC <““AT...
A-l T-7,2 A-2 E2
ACTCGGCGCG . . . . . . . . . . . ..*....*. . . ...*....
CCAGTCCTCC . ...*..... . . . . . . . . . . . . . . . . . . . .
A-l T-7,2 A-2
CCTCTTGCTG . . . T . * . . . . . . . . ...*..
TTTGCATCCG * ’ ‘AA ...A......
TGATTGACTA
CCCACGTCGG-GGGTCTTTCA
““““‘G
.....C.G..
.......... ....................
...............
GCGCTTTTTG . . . . ...*..
..........
U31R GAT-GACTGC ...A.*...A ...A..“*A ...A....‘A
GTCGCCCGGG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
TACCCGTGTT .........A “...*.A.. .*..
CTCAATAAAG TC”.... . .c . . . . . . e .
660
AATCGTGGTC
TCGCTGGTCC
TTGAGAGGGT
CTCCTCAGAT
720
.....*.,A.
“...‘A...
...G......
..*.......
RkJ5
E2
A-l T-7.2 A-2 E2
. . . . . . . . . .
MuLV cDNAs T-7.2 FIG. 3. Nucleotide sequence analysis of the 3’ LTRs of A-l and A-2 MuLV DNAs. 3’ LTR sequences of cloned endogenous (8) and E2 (9) are also shown for comparison. +, identical nucleotide; -, gap; +, Inverted repeat; shaded sequences, 190-bp cellular insert (4); underline, regulatory signal; brackets, direct repeats; blank space, undetermined base.
560
SHORT COMMUNICATIONS
LTR sequences. A-l DNA was closely related to T-7.2 in the LTR region; however, these two sequences could be distinguished due to deletions of 5 and 39 bp in the A-l proviral LTR. The presence or absence of these 5- and 39-bp sequences can be used to categorize the majority of endogenous MuLV LTRs into two classes: A-l related LTRs which lack these two nucleotide stretches include AL1 0 (19), 36.1 (20), B-56, and B-73 (4); and A-2-related LTRs which contain both the 5- and 39-bp sequences include B-14 and B-34 proviral LTRs (4). The generation of leukemogenic MCF viruses is a complex, multistep process involving recombination between endogenous ecotropic, xenotropic-like, and MCF-related MuLV sequences (3, 5). We have recently described transcripts of these three MuLV classes which might participate in generation of recombinant MCF viruses in AKR mice (8). Among these potential MCF progenitor RNAs was an endogenous MCF-related 7.2-kb species in which a portion of env was deleted. Levy et al. (9) have also described an env-deleted 6.0-kb MuLV species (designated as E2) in Glx+ mouse which might be involved in MCF virus generation in that mouse strain. In this study, we have identified putative DNA templates for the 7.2-kb and E2 precursor MCF RNAs. Comparative sequence analysis in 3’po/, env, and LTR regions of endogenous MuLV DNAs A-l and A-2 and T-7.2 and E2 cDNAs indicated a high degree of homology between A-2 and E2 sequences and close relatedness between A-l DNA and T-7.2. Both A-2 and E2 sequences sustained an identical env deletion of 181 1 bp; adjacent regions of env, PO/, and LTR also showed a high degree of sequence conservation. This homology between A-2 and E2 sequences suggested that A-2 could be the template for E2 RNA species. Since A-2 was cloned from AKR/J mouse DNA, whereas E2 cDNA was derived from RNAs expressed in 129 GIx+ mouse, it remains to be determined, however, whether the chromosomal location of A-2 provirus is the same as the genomic template for the E2 RNA. The nucleotide sequences of A-l DNA and T-7.2 were closely related and exhibited the same large 1281 -bp env deletion. Adjacent sequences in env, PO/, and LTR regions of A-l DNA and T-7.2, however, could be distinguished: (i) the env region of A-l DNA sustained two deletions of 237 and 1281 bp; only the large deletion was seen in T-7.2; (ii) the LTR of A-l exhibited 5- and 39-bp deletions; T-7.2 contained sequences corresponding to these regions in its LTR region; (iii) a large deletion in pal in A-l DNA was previously mapped (10); thepol region in the 7.2-kb RNAs appeared to be intact based upon extensive hybridization analysis (8). These results indicate that A-l DNA cannot be the direct
template for the 7.2-kb RNAs; however, another DNA related to A-l in which the env deletion is preserved could serve as template for this RNA species (discussed below). The presence of an identical deletion in both provirus and RNA does not establish a template-transcript relationship. We have shown that A-l endogenous MuLV DNA and the 7.2-kb RNA sustained the same env deletion; however, adjacent regions in env, PO/, and LTR were distinct. The removal of sequences in env seems to have occurred via homologous recombination between direct repeats resulting in a single copy of the repeated sequence at the site of deletion. Short direct repeats have also been implicated in causing deletions in other retroviral sequences (14-16, 21, 22). Since this recombination event appears to occur randomly, it is unlikely that identical deletions were sustained independently in the A-l provirus and the DNA template for the 7.2-kb RNA. Thus, both sequences could share a common progenitor, which sustained an env deletion and subsequently amplified and diverged while retaining the deletion. These results suggest that, like other defective retroviral sequences such as VL30 (23) and A-particle (24), endogenous MuLV proviruses containing large structural deletions can also proliferate in the mouse genome. The mechanism for dispersion of defective proviruses is unclear. The distribution of such genes could occur in several ways, including amplification of large cellular DNA segments containing the deleted provirus or via a transposon-like mechanism. ACKNOWLEDGMENTS We thank Dr. Masanori Obata for technical advice, and Mrs. Brenda Marshall for excellent editorial assistance. This work was supported in part by the U.S.-Japan Cooperative Cancer Research Program.
REFERENCES 1. CLOYD, M. W., Cell 32, 217-225 (1983). 2. CLOYO, M. W., HARTLEY, J. W., and ROWE, W. P., J. Exp. Med. 151, 542-552 (1980). 3. KHAN, A. S., f. Viral. 50, 864-871 (1984). 4. KHAN, A. S., and MARTIN, M. A., Proc. Nat% Acad. Sci. USA 80, 2699-2703 (1983). 5. THOMAS, C. Y., and COFFIN, J. M., J. Viral. 43, 416-426 (1982). 6. CHATTOPADHYAY,S. K., LANDER, M. R., GUPTA, S., RAND% E., and Lowv, D. R., virology 113, 465-483 (1981). 7. KHAN, A. S., LAIGRET, F., and RODI, C. P., J. Wrol. 61, 876-882 (1987). 8. LAIGRET,F., REPASKE,R., BOULUKOS,K., RABSON,A. B., and KHAN, A. S., 1. viral. 62, 376-386 (1988). 9. LEVY, D. E., LERNER,R. A., and WILSON, M. C., Ce//41,289-299 (1985).
SHORT COMMUNICATIONS 70. KHAN, A. S., ROWE, W. P., and MARTIN, M. A., J. Viral. 44, 625-636 (1982). 11. MAXAM, A. M., and GILBERT, W., in “Methods in Enzymology” (L. Grossman and K. Moldave, Eds.), Vol. 65, pp. 499-560. Academic Press, New York, 1980. 12. KELLY, M., HOLLAND, C. A., LUNG, M. L., CHATTOPADHYAY,S. K., Lowv, D. R., and HOPKINS, N. H., J. Viral. 45, 291-298 (1983). 73. LEVY, D. E., LERNER, R. A., and WILSON, M. C., J, L&o/. 56, 691-700 (1985). 14. AMANUMA, H., KATORI,A., OBATA, M., SAGATA, N., and IKAWA,Y., Proc. Nat/, Acad. Sci. USA 80, 3913-3917 (1983). 75. MARK, G. E., and RAPP, U. R.. J. Wrol. 49, 530-539 (1984). 76. VAN BEVEREN, C., VAN STRAATEN, F., GALLESHAW, J. A., and VERMA, I. M., Cell 27, 97-108 (1981). 17. TEMIN, H. M., Ceil27, l-3 (1981).
561
18. VARMUS, H. E., Science 216, 812-820 (t982). 19. Ou, C. Y., BOONE, L. R., and YANG, W. K., Nucleic Acids Res. II? 5603-5620 (1983). 20. SCHMIDT, M., GL~GGLER, K., WIRTH, T., and HORAK, I., Proc. #at/. Acad. Sci. USA 81, 6696-6700 (1984). 21. OMER, C. A., POGUE-GEILE,K., GUNTAKA, R., STASKIJS,K. A., and FARAS, A. J., J. viral. 47, 380-382 (1983). 22. SHIMOTOHNO, K., andTEMIN, H. M.,/. Hrol. 41, 163-171 23. KESHET, E., and ITIN, A., I. Viroi. 43, 50-56 (1982).
(1982).
24. KUFF, E. L., FEENSTRA,A., LUEDERS, K.. SMITH, L., HAWLEY, R., HOZUMI, N., and SHULMAN, R., Proc. r&t!. Acad. Sci. USA 80, 1992-1996 (1983). 25. LAZO, P. A., PRASAD, V., and TSICI-ILIS, P. N., /. Viral. 61, 2038-204 1 (1987).
164, 556-561
(1988)
Identification
HIROSHI AMANUMA,”
of Putative Endogenous Proviral Templates for Progenitor Focus-Forming (MCF) MuLV-Related RNAs FREDERIC LAIGRET,+’
MASAHIRO
NISHI,***
Mink Cell
YOJI IKAWA,+ AND ARIFA
S. KHAr+3
*Laboratory of Gene Technology and Safety, and *Laboratory of Molecular Oncology, institute of Physical and Chemical Research, Yatabe, Tsukuba. Ibaraki, Japan 305, and fLaboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892 Received November
19, 1987; accepted
February 2.2, 1988
Murine leukemia virus (MuLV)-related RNAs exhibiting different env deletions are believed to participate in the generation of leukemogenic mink cell focus-forming (MCF) viruses. We have cloned an endogenous MuLV provirus from AKR/J mouse DNA, designated as A-2, which may serve as template for the env-deleted E2 MuLV RNA, expressed in Glx+ mice (D. E. Levy et a/-, 1. Viral. 56, 691-700 (1985)). We have also isolated an endogenous MCF-related DNA, A-l, which shared close sequence homology with the 7.2-kb RNA expressed in AKR mice (F. Laigret eta/., J. W-o/. 62, 376-386 (1988)) and sustained an identical env deletion. The data indicate that putative precursor o 198s MCF-related RNAs are transcribed from a heterogenous family of env-deleted endogenous MuLV DNAs. Academic
Press,
Inc.
also been described in GIx+ mouse (9). This species, however, exhibited an env deletion different from that of the AKR 7.2-kb RNA. In this paper, we show that deleted endogenous MCF-related proviruses may serve as templates for these env-deleted precursor MCF RNAs. The isolation of endogenous MCF-related MuLV sequences from AKR/J mouse DNA has previously been described (10). Primary characterization by restriction enzyme and heteroduplex mapping of the recombinant X DNAs indicated two deleted proviruses. AA-1 DNA had an insert of 13 kb containing a 6.0-kb MuLV provirus and adjacent 5’and 3’flanking cell sequences. In the case of w-2, the cloned MuLV-reactive DNA segment was 14 kb and contained about 5.0 kb of proviral sequence and adjacent cellular sequences. Both A-l and A-2 MuLV DNAs contained gag, pal, and env sequences bound by LTRs; however, large deletions (> 1 kb) were sustained in the pal and env regions of both proviruses. A-l DNA was digested with BarnHI and a resulting 1.3-kb fragment containing the 3’ end of pal, env, and 3’ LTR was isolated for nucleotide sequencing. A-2 DNA was digested with BarnHI, and a 1.2-kb fragment encompassing the 3’ terminus of PO/, env, and 3’ LTR was isolated and sequenced. Both strands of the 1.2- and 1.3-kb BarnHI segments of A-l and A-2 DNAs, respectively, were sequenced by the chemical cleavage method developed by Maxam and Gilbert (I 1). We have determined nucleotide sequences of the 3’ regions of endogenous A-l and A-2 proviruses and have mapped precisely the env deletion sites in these
The generation of leukemogenic mink cell focusforming (MCF) viruses is a complex, multistep process and seems to occur in mouse thymus tissue (1,2). The genome of lymphomagenic MCF MuLVs is chimeric and consists of sequences derived from at least three different murine leukemia virus (MuLV) classes: LTRs are xenotropic-like; gag, 5’ PO/, and 3’ env regions contain ecotropic MuLV sequences; and 3’pol and 5’ env regions are endogenous MCF-related (3-5). The recombinational junctions between these MuLV sequences seem to differ in all MCF viruses (6), thus indicating an independent origin for each MCF MuLV. We have recently described ecotropic-, xenotropic-, and MCF-related viral transcripts expressed in AKR mouse thymus tissue which might be involved in MCF virus formation (7, 8). Among the RNAs implicated as potential progenitors of MCF MuLVs were two endogenous MCF env-related transcripts, 7.2 and 3.0 kb in size. Our results indicated that the 7.2-kb RNAs could donate MCF pol sequences and only a portion of env sequences, due to a deletion in env; the remaining env sequences could be derived from the 3.0-kb env mRNA species. Thus, MCF virus formation would require both 7.2- and 3.0-kb MCF-related RNAs along with ecotropic and xenotropic MuLV sequences. A putative MCF progenitor RNA, designated as E2, has ’ Present address: Laboratoire de Biologie Cellulaire et Moleculaire, INRA. 33140, Pont De Lay Maye. France. 2 Present address: Wakayama Prefectural Medical College, Wakayama, Japan. 3 To whom requests for reprints should be addressed. 0042-6822188 Copyright All rights
$3.00
0 1988 by Academic Press, Inc. of reproduction in any form reserved.
556
3’ ss MCF247 A\-.
CTCTCTCCAA . . . . .
.
.
.
.
.
GCTCAC . . . .
.
.
‘TAC . . .
.
AGGCCCTCCA . . . . .
MCF247 A-, T.,2
GGCCGCTGCC . . ..a..... . . . . . .
.
.
.
.
TATCAGGACC . . . . . . . . . .
. .
. .
. .
. .
. .
AGCTGGACCA .*........ .A.AA.....
MCF247 A-. T-,2
CGACACCGTG . . . . ...*.. . . . . . .
.
.
.
.
TGGGTACGCC . . . . . . . . . .
. .
. .
. .
. .
. .
GGCACCAGAC . . . . . . . . . .
MCF247 A-l T ?2 IA-21 EZ
CTACACCGTC . . . . . . . . . .
. .
. .
. .
. .
CTGCTGACCA . . . . . . . . . .
. .
. .
. .
. .
. .
CACGTAAAAG . . . . . . . . . . . . . . . . . . . .
. . . .
. . . . ..G. ..G.
. .
. .
.
.
.
.
.
AGCAGTACAA . . . . .
.
.
.
.
.
CGAGAGGTCT . . . . .
.
.
.
.
.
GGAAGCCACT . . . . .
.
.
.
.
-241
GCCAGTGATA . . . . . . ..T......
.
.
.
.
.
CCACACCCCT . . ...*.... . . . . .
.
.
.
.
.
TCCGTGTCGG-181 . . . . . . . . . . . . . .
. .
. .
. .
.
.
.
.
GGAAAGGACC-121 *‘...A.... . . . . . . .
.
.
.
.
..G. . .
.
TAAGAACTTG . . . . . . . . . .
. .
. .
. .
. .
. .
GAACCTCGCT . . . . . . . ...*....
.
.
CCCCCACCGC . . . . . . . . . . . .
. .
. .
. .
. .
TCTCAAAGTA . . . . . . . . . .
. .
. .
. .
. .
. .
GACGGCATCG . . . . . . . . . .
. .
. .
. .
. .
. .
CTGCGi$&&&-61 ..I....... . . . . . .
CGGCGACAAC . . . . . . . . . . . . . . . . . . . .
. . . .
. . . .
. . . .
. . . .
CCCTCCGGCC . . . . . . . . . . 7”““‘” ~..‘...‘..
. .
. .
. .
. .
. .
GGAACAGCAT . . . . . . . . . . . . . . . . . . . .
. . . .
. . . .
. . . .
. . . .
. . . .
CAGGACCGAC . . . . . . . . . . ‘“A.“... . ..A’“...
. .
Barn HI
MCF247 Al T-7 2 A-2 E2
&ACGCCGCT ..,....... ..,....... “C....... “C.....‘.
MU247 A-l T-7.2
r ATGGAAGGTC “AA” . . . . .
. .
. . . .
. .
8””
. , .
. . .
. . .
. . .
. .
. .
. .
. .
-1
PO’
61
.
. .
CAGCGTTCTC - 1 237 bP deletlm . . . . . . . .
AAAACCCCTT .
.
.
.
.
.
.
.
.
TTAACCCGTG
AAAGATAAGA .
.
.
..I
.
.
.
.
.
.
.
.
.
.
.
.
.
.
GGGCCCC
GITA
.
.
.
.
.
.
“C...
GTGTCGCACT . . . . .
.
.
.
.
.
CCCGGGGGAA292 ..*.......
GCA . .
CTGTA . . .
.
.
.
.
.
.
.
GCGAGGAAAC “A’A-.... . . . . . .
.
.
.
.
60
.
*
‘G
C CAACAGGG . . . . . .
.
.
.
GGACAGGCAT412 . . . . . . . . . . . .
. .
. .
. .
. .
ACCCCTCAGA472 . . . . . . ..,....G”
.
.
.
.
239
MCF247 Al IT -7.21 A-2 E2
A
TAAT
MCF247 pi-,
GAAAAAGGGC . . . . .
.
AGGGGACGAC ,A......
AAGAA . . .
..A.
.
.
TGGGATGAGA “A.......
CATT . . .
.
T .
GACT . . .
.
.
TACTGTGGCA ,........*
.
CTGGACTCGG “‘A..“..
TCTATG . . . .
.
.
TTTGC . . .
.
.
CCCGG . . .
.
.
.
TA . .
T
352
IT-?.21 A-2 E2 MU247 A-,
GTGGAGGGCC ...A......
GAGAGAGGGC . . . . . .
.
.
AATGGGGCTG ..*....... A...,.
IT -7.21 A-2 E2 MCF247 A., T.,2
ACTGGAAGCC . . . . . . . . . .
. .
. .
. .
. .
ATCATCATCA *......a*. . . ...*....
ATCAGGGCCC * ’ ’ ’ - A * . . . . . . .
. .
* .
* .
CTG ’ * - *
. .
TGGGACCTAA . . . . . . . . . .
. .
TTTCCCTTAA . . . . . . . . . .
. ..I ..T.
. .
TGAGACCACT . . . . . *..*......
. .
. .
. .
. .
A-2 E2
MCF247 A-l T-7.2
485
1758 GGGT
, ,281 I 1281
CCCCTGATAA )...... ).AG...
bpde,e,,on t+ mtion
TCCTCTTGTT .A.....A.. .A.....A”
AATTTTACTC1791 “‘CC....’ . ..cc.....
A- 2 E2 MU247 A, 772
TTTGGGCCTT ..C.AA..C.
GTATTCTCAA . . . . .
..C..A..C.
..T
.
.
.
.
.
.......
TCGCCTGGTC C...T..... C...T
CAGTTTGTAA . . . . . ; ,
A2 E2
MCF247 A, 772 A.2 E2
end p15E CAGGCCCTGG e......... .G..T..“. . . . . . . . . . . . . . . . . . .
MCF247 A 1
GAATCGCGTG A....A...A
T,2
.....A..A.
A-2 ,E2;
A....A.... pi. 1.
. .
TTCTGACCCA . . . . . . . . . . . . . . . .,........
. . .
. . .
. . .
. . .
. . .
ACAGTATCAC . . . . . .....G.... . . . . . . . . . .
AATAAAAGAT . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
. .
. .
. .
. .
.
.
.
.
e””
.A..
.
.
1
.
.
.
.
.
AAGACAGAAT . . . . .
.
.
.
.
.
TTCGGTGGTG1851 . . ..a.....
...................................
................. .................
......A ......A
..A ..A
. .
CAACTCAAAT . . . . . . . . . . . . . . . . . . . .
. . . .
. . . .
. . . .
. . . .
. . . .
CAATAGATCC “““G... . . . . ..G... . . . . . . . . . . . . . .
. .
.
.
TTCCAGAAAG . . . . .
.
.
.
.
.
AGGGGGGAAT . . . . . .
.
..a
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
. .
. .
. .
. .
TTTATTCAGT . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
. .
AGAAGAAGTA1911 .‘..A..... “.......G .A..A.. ....A.....
3’ LTR GAAAGACC . . . . .
r
”
.
1971
FIG. 1. Comparative nucleotide sequence analysis in 3’pol and env regions of A-l and A-2 MuLV DNAs. Sequences of AKR MCF247 provirus (3, 12) and cDNA clones of endogenous 7.2-kb MCF-related RNA [designated as T-7.2 (S)] and 6.0-kb MuLV RNA [designated as E2 (73)] are also included for comparison. SS indicates splice site (25); t, identical nucleotide; and parentheses, deleted sequences. Some of the sequences are presented incompletely (indicated by brackets around the clone designations at the left) due to unavailability of these sequences. The numbers at the right indicate nucleotides from the start of env.
557
558
SHORT COMMUNICATIONS
DNAs by comparison with MCF247 MuLV DNA (3, 72). Nucleotide sequence relatedness was established between the A-l and A-2 deleted proviruses, and the 7.2-kb (8) and E2 (9, 13) putative precursor MCF RNAs, respectively. Nucleotide sequences in the 3’pol and env regions of A-l and A-2 proviruses are presented in Fig. 1. Comparative sequence analysis between these DNAs and known MuLV sequences indicated that A-l and A-2 DNAs contained features characteristic of MCF viruses and endogenous MCF-related sequences (3). These included (i) a BarnHI site in pal (nucleotides -64 to -59) and (ii) a highly conserved 12-bp nucleotide stretch, TCAGGACCGACA (nucleotides -1 1 to l), adjacent to the env initiation codon (nucleotides 1 to 3). A high degree of nucleotide sequence homology was seen in env between MCF 247 provirus and the endogenous MuLV DNAs: 94% in case of A-i, and 93% for A-2. A notable difference was the deletion of env sequences in A-l and A-2 proviruses. A-l DNA had two deletions in its env gene. One deletion was located at the 5’ terminus of env (nucleotide position 9) and encompassed 237 bp. The other deletion was located 239 bp downstream of the first deletion and extended for 1281 bp. This large deletion encompassed the C-terminal half of gp70 and N-terminal two-thirds of pl5E. The A-2 proviral DNA had a single large env deletion encompassing 181 1 bp. The 5’ boundary of this deletion was close to the 5’ boundary of the smaller A-l deletion and was located 13 bp downstream of the env initiation site. The deletion in A-2 included the entire gp70 region and N-terminal 84% of Prl5E, leaving only 112 nucleotides at the 3’ env terminus. It is interesting to note that the deletion in A-l DNA was in-frame. The env sequences of A-l DNA, however, could not be translated due to a single third base substitution (A for G) in the env initiation codon (ATG). Deletions occurring in murine retroviral sequences are often characterized by the presence, in the presumed parental genome, of direct repeats at the beginning and end of the sequences involved in the deletion (8, 9, 14-16). For the single deletion in env of A-2, and the two env deletions in A-l, direct repeats were found in AKR MCF247 sequence (Fig. 2): in the case of A-2, a 7-bp perfect direct repeat was seen; imperfect direct repeats were present in the case of both deletions in A-l. Nucleotide sequence comparison between A-l and A-2 MuLV DNAs and cDNAs clones of 7.2-kb RNA [designated as T-7.2 (8)] and E2 RNA (13) is also shown in Fig. 1. A-2 MuLV DNA was virtually identical to E2 cDNA except for 3 bp (positions 3, 4, and 1903): the size and site of the env deletion in both was the
..**.** * qf..*** en”
A-l
A-l
de,-,
d&2
MCF247
-9
r AGGACCGACATGGAAGGTCCAGCGTTCT ..*.**I*.** ****
A-l
-9
AGGACCGACATAAAAGGAGACGACTGAG
MCF247
229
TTGTGCGATTTAATAGGGGACGACTGGG
MCF247
468
TCAGAATCAGGG-CCCCT-GTTATGATT *******.*. * .*.**
*
A-l
231
TCAGAATCAGAG-CCCCTTGATAATACT . . .
t.*.*.
MCF247
,749
A-2
dsl
A-2 MCF247
-4
f.
CACCATCATGGGTCCCCT-GATAATCCT I B””
MCF247
..I.
.f*.**..l.* q
r CGACATGGAAGGTCCAGCGTTCTCAAAA *l**** *.*****.*
-4
CGACATAAAAGGTCCAGTTTGTAAAAGA
1808
TCAATCGCCTGGTCCAGTTTGTAAAAGA
FIG. 2. Direct repeats are involved in deletions of A-l and A-2 MuLV sequences. The envdeletions in A-l and A-2 proviruses were located by nucleotide sequence comparison with AKR MCF247 MuLV DNA (3, 12). Direct repeat sequences are boxed. Nucleotide identity is indicated (*). The small deletion in A-i is designated as A-l del-1; larger deletion, A-l del-2. Numbers on the left of each sequence indicate the position of the first nucleotide in that sequence from the env initiation codon.
same. In case of A-l DNA, the large env deletion was identical to that present in T-7.2 cDNA; however, the rest of env, although closely related, could be distinguished. T-7.2 cDNA contained sequences in the region of the A-l small env deletion; several scattered single-base differences were also present between these two sequences. A noteworthy difference between the endogenous A-l and A-2 MuLV proviruses and the cDNAs of endogenous 7.2-kb and E2 MuLV RNAs was that the env initiation codon (ATG) was intact in the case of the RNA sequences. The entire 3’ LTR sequences of A-l and A-2 MuLV proviruses are presented in Fig. 3. A-l LTR consisted of 697 nucleotides and A-2 LTR, 742 nucleotides. Both LTRs contained the salient features of retroviral LTRs (17, 18) indicated in Fig. 3. In addition to these, both A-l and A-2 LTRs had sequences which are landmarks of endogenous MCF-related LTRs (4): a cellular 190-bp insert (nucleotide positions 278 to 471) was present in the U3 region bound by direct repeats; and a 14-bp sequence (nucleotide positions 104 to 117) was directly repeated near the 5’ end of the U3 region (positions 1 18 to 131). The major difference between the A-l and A-2 LTR sequences was the absence of sequences in A-l : 5 bp at nucleotide positions 162 to 166, and 39 bp at nucleotide positions 226 to 267. Otherwise, they were closely related (96% homology). Nucleotide sequence comparison of LTR regions of A-l, A-2, and cDNA clones T-7.2 (8) and E2 (9) indicated a high degree of homology between A-2 and E2
SHORT COMMUNICATIONS A-l T-7,2 A-2
TGAAAGACCCTACCATAAGG .......... .“.G.. ............................................................
........
CTTAGCAAGC
GG.
TAGCTGCAGT
E2
A-l T-7.2
A-2 i2 A-l T-7.2 A-2 E2
AACGCCATTT ..................
TGCAAGGCAT
80
...........................
E2
A-l T-7,2 A-2
559
GAAAAAGTAC
CAGAGCTGAG
..................
G...........TTCTCAAAAG
.............................. ..............................
TTAAAGATTA “c. ...... ........c. ..c. ......
GCACCTGGGC .......................... .................... ........................
TTACAAGAAA .......G .......G .“....G
..
GGCTGAATA .......... .......... ..........
ATACTGGGAC GC .......... GC ........ GC ........
AGGGAACAAG ..GC.G ....GC.G ....GC.G
.. ...
CCCGGCTCAG
GGCCAA-GAA
CAGATGGCTC ““‘“T.’ .......T .......T
....... ..
4
......A
. ... ... .._ ...
GTT
.. ..
120
-GGTCGTCAA T.......G.
180
G
---------CGGAAcCA(.C
240
G
CGGAACCAGC CGGAACCAGC
A-----TATC ‘CAGGA .CAGGA .CAGGA
.... .............. ..............
TCAGA----.....TAAA .....TAAA
TAAAG
300
A-l T-7.2 A-2 E2
360
420
A-l T-7.2 A-2 E2
A-l T-72 A-2
TCAGTTT C . . . f 1 . . . . . . ..I.. *. * . . . . . . . . c I
CCAAATGACC . . . . . . . . . . ..........
GGGAAGTACC . . . . . . ...* .....A
CCAAACCTTA . . . . . . . . . .
..............
TTCGAACTAA . . . . . . . . . .
CCAACCAGCT m.....
480
CGCTTCTCGC . . . . . . . . . .
540
AAAACCCCAC C”“T”” . . ..I..... . . . . . . . . . .
600
...A .............................
E2
..........
.....A
........................
x
A-l T-7 2 A-2 E?
TTCTGTAACC <““AT...
A-l T-7,2 A-2 E2
ACTCGGCGCG . . . . . . . . . . . ..*....*. . . ...*....
CCAGTCCTCC . ...*..... . . . . . . . . . . . . . . . . . . . .
A-l T-7,2 A-2
CCTCTTGCTG . . . T . * . . . . . . . . ...*..
TTTGCATCCG * ’ ‘AA ...A......
TGATTGACTA
CCCACGTCGG-GGGTCTTTCA
““““‘G
.....C.G..
.......... ....................
...............
GCGCTTTTTG . . . . ...*..
..........
U31R GAT-GACTGC ...A.*...A ...A..“*A ...A....‘A
GTCGCCCGGG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
TACCCGTGTT .........A “...*.A.. .*..
CTCAATAAAG TC”.... . .c . . . . . . e .
660
AATCGTGGTC
TCGCTGGTCC
TTGAGAGGGT
CTCCTCAGAT
720
.....*.,A.
“...‘A...
...G......
..*.......
RkJ5
E2
A-l T-7.2 A-2 E2
. . . . . . . . . .
MuLV cDNAs T-7.2 FIG. 3. Nucleotide sequence analysis of the 3’ LTRs of A-l and A-2 MuLV DNAs. 3’ LTR sequences of cloned endogenous (8) and E2 (9) are also shown for comparison. +, identical nucleotide; -, gap; +, Inverted repeat; shaded sequences, 190-bp cellular insert (4); underline, regulatory signal; brackets, direct repeats; blank space, undetermined base.
560
SHORT COMMUNICATIONS
LTR sequences. A-l DNA was closely related to T-7.2 in the LTR region; however, these two sequences could be distinguished due to deletions of 5 and 39 bp in the A-l proviral LTR. The presence or absence of these 5- and 39-bp sequences can be used to categorize the majority of endogenous MuLV LTRs into two classes: A-l related LTRs which lack these two nucleotide stretches include AL1 0 (19), 36.1 (20), B-56, and B-73 (4); and A-2-related LTRs which contain both the 5- and 39-bp sequences include B-14 and B-34 proviral LTRs (4). The generation of leukemogenic MCF viruses is a complex, multistep process involving recombination between endogenous ecotropic, xenotropic-like, and MCF-related MuLV sequences (3, 5). We have recently described transcripts of these three MuLV classes which might participate in generation of recombinant MCF viruses in AKR mice (8). Among these potential MCF progenitor RNAs was an endogenous MCF-related 7.2-kb species in which a portion of env was deleted. Levy et al. (9) have also described an env-deleted 6.0-kb MuLV species (designated as E2) in Glx+ mouse which might be involved in MCF virus generation in that mouse strain. In this study, we have identified putative DNA templates for the 7.2-kb and E2 precursor MCF RNAs. Comparative sequence analysis in 3’po/, env, and LTR regions of endogenous MuLV DNAs A-l and A-2 and T-7.2 and E2 cDNAs indicated a high degree of homology between A-2 and E2 sequences and close relatedness between A-l DNA and T-7.2. Both A-2 and E2 sequences sustained an identical env deletion of 181 1 bp; adjacent regions of env, PO/, and LTR also showed a high degree of sequence conservation. This homology between A-2 and E2 sequences suggested that A-2 could be the template for E2 RNA species. Since A-2 was cloned from AKR/J mouse DNA, whereas E2 cDNA was derived from RNAs expressed in 129 GIx+ mouse, it remains to be determined, however, whether the chromosomal location of A-2 provirus is the same as the genomic template for the E2 RNA. The nucleotide sequences of A-l DNA and T-7.2 were closely related and exhibited the same large 1281 -bp env deletion. Adjacent sequences in env, PO/, and LTR regions of A-l DNA and T-7.2, however, could be distinguished: (i) the env region of A-l DNA sustained two deletions of 237 and 1281 bp; only the large deletion was seen in T-7.2; (ii) the LTR of A-l exhibited 5- and 39-bp deletions; T-7.2 contained sequences corresponding to these regions in its LTR region; (iii) a large deletion in pal in A-l DNA was previously mapped (10); thepol region in the 7.2-kb RNAs appeared to be intact based upon extensive hybridization analysis (8). These results indicate that A-l DNA cannot be the direct
template for the 7.2-kb RNAs; however, another DNA related to A-l in which the env deletion is preserved could serve as template for this RNA species (discussed below). The presence of an identical deletion in both provirus and RNA does not establish a template-transcript relationship. We have shown that A-l endogenous MuLV DNA and the 7.2-kb RNA sustained the same env deletion; however, adjacent regions in env, PO/, and LTR were distinct. The removal of sequences in env seems to have occurred via homologous recombination between direct repeats resulting in a single copy of the repeated sequence at the site of deletion. Short direct repeats have also been implicated in causing deletions in other retroviral sequences (14-16, 21, 22). Since this recombination event appears to occur randomly, it is unlikely that identical deletions were sustained independently in the A-l provirus and the DNA template for the 7.2-kb RNA. Thus, both sequences could share a common progenitor, which sustained an env deletion and subsequently amplified and diverged while retaining the deletion. These results suggest that, like other defective retroviral sequences such as VL30 (23) and A-particle (24), endogenous MuLV proviruses containing large structural deletions can also proliferate in the mouse genome. The mechanism for dispersion of defective proviruses is unclear. The distribution of such genes could occur in several ways, including amplification of large cellular DNA segments containing the deleted provirus or via a transposon-like mechanism. ACKNOWLEDGMENTS We thank Dr. Masanori Obata for technical advice, and Mrs. Brenda Marshall for excellent editorial assistance. This work was supported in part by the U.S.-Japan Cooperative Cancer Research Program.
REFERENCES 1. CLOYD, M. W., Cell 32, 217-225 (1983). 2. CLOYO, M. W., HARTLEY, J. W., and ROWE, W. P., J. Exp. Med. 151, 542-552 (1980). 3. KHAN, A. S., f. Viral. 50, 864-871 (1984). 4. KHAN, A. S., and MARTIN, M. A., Proc. Nat% Acad. Sci. USA 80, 2699-2703 (1983). 5. THOMAS, C. Y., and COFFIN, J. M., J. Viral. 43, 416-426 (1982). 6. CHATTOPADHYAY,S. K., LANDER, M. R., GUPTA, S., RAND% E., and Lowv, D. R., virology 113, 465-483 (1981). 7. KHAN, A. S., LAIGRET, F., and RODI, C. P., J. Wrol. 61, 876-882 (1987). 8. LAIGRET,F., REPASKE,R., BOULUKOS,K., RABSON,A. B., and KHAN, A. S., 1. viral. 62, 376-386 (1988). 9. LEVY, D. E., LERNER,R. A., and WILSON, M. C., Ce//41,289-299 (1985).
SHORT COMMUNICATIONS 70. KHAN, A. S., ROWE, W. P., and MARTIN, M. A., J. Viral. 44, 625-636 (1982). 11. MAXAM, A. M., and GILBERT, W., in “Methods in Enzymology” (L. Grossman and K. Moldave, Eds.), Vol. 65, pp. 499-560. Academic Press, New York, 1980. 12. KELLY, M., HOLLAND, C. A., LUNG, M. L., CHATTOPADHYAY,S. K., Lowv, D. R., and HOPKINS, N. H., J. Viral. 45, 291-298 (1983). 73. LEVY, D. E., LERNER, R. A., and WILSON, M. C., J, L&o/. 56, 691-700 (1985). 14. AMANUMA, H., KATORI,A., OBATA, M., SAGATA, N., and IKAWA,Y., Proc. Nat/, Acad. Sci. USA 80, 3913-3917 (1983). 75. MARK, G. E., and RAPP, U. R.. J. Wrol. 49, 530-539 (1984). 76. VAN BEVEREN, C., VAN STRAATEN, F., GALLESHAW, J. A., and VERMA, I. M., Cell 27, 97-108 (1981). 17. TEMIN, H. M., Ceil27, l-3 (1981).
561
18. VARMUS, H. E., Science 216, 812-820 (t982). 19. Ou, C. Y., BOONE, L. R., and YANG, W. K., Nucleic Acids Res. II? 5603-5620 (1983). 20. SCHMIDT, M., GL~GGLER, K., WIRTH, T., and HORAK, I., Proc. #at/. Acad. Sci. USA 81, 6696-6700 (1984). 21. OMER, C. A., POGUE-GEILE,K., GUNTAKA, R., STASKIJS,K. A., and FARAS, A. J., J. viral. 47, 380-382 (1983). 22. SHIMOTOHNO, K., andTEMIN, H. M.,/. Hrol. 41, 163-171 23. KESHET, E., and ITIN, A., I. Viroi. 43, 50-56 (1982).
(1982).
24. KUFF, E. L., FEENSTRA,A., LUEDERS, K.. SMITH, L., HAWLEY, R., HOZUMI, N., and SHULMAN, R., Proc. r&t!. Acad. Sci. USA 80, 1992-1996 (1983). 25. LAZO, P. A., PRASAD, V., and TSICI-ILIS, P. N., /. Viral. 61, 2038-204 1 (1987).