- Email: [email protected]
Identification of sea cucumber species in processed food products by PCR-RFLP method
Food Control 90 (2018) 166e171
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Identification of sea cucumber species in processed food products by PCR-RFLP method Ling Zeng a, Jing Wen b, *, Sigang Fan c, Ziming Chen a, Youhou Xu d, Yulin Sun b, Daohai Chen b, Juan Zhao b, Lele Xu b, Yongqin Li b a
Department of Chemistry, Lingnan Normal University, Zhanjiang, 524048, China Department of Biology, Lingnan Normal University, Zhanjiang, 524048, China Key Laboratory of South China Sea Fishery Resources Utilization, Ministry of Agriculture, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, 510300, China d Guangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Qinzhou University, Qinzhou, 535000, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Available online 27 February 2018
A PCR-RFLP method has been developed for the identification of 16 commercial sea cucumber species in raw and processed food products. To implement the method, PCR amplification with the 16Sar/16Sbr primers, targeted to the amplification of a ca. 570 bp region of the 16S rRNA mitochondrial gene in sea cucumbers, was coupled to restriction analysis with Dde I, Hae III and Sty I. We also report the FINS method based on 16S rRNA mitochondrial sequences. Both proposed methodologies were independently applied to authenticate the species of 19 commercial products, showing that 9 products were incorrectly labeled (48%). Therefore, the 16S rRNA mitochondrial gene really provide convenient, useful and academic molecular marker to study questions related to correct labeling of commercial products, traceability, and the control of sea cucumber fisheries. © 2018 Elsevier Ltd. All rights reserved.
Keywords: Sea cucumbers Species identification 16S rRNA gene PCR-RFLP FINS
1. Introduction Sea cucumbers (also called holothurians, Echinodermata: Holothuroidea), and the dried form (‘beche-de-mer’ or ‘trepang’), have been a dietary delicacy and medicinal cure for Asians over many centuries. Sea cucumbers present high nutritional values due to their high protein, low fat content, amino acid, fatty acid profile (Wen, Hu, & Fan, 2010) and rich trace elements (Wen & Hu, 2010). Based on the most recent available catch and trade data, Asia and the Pacific area are the top producing regions despite the long history of exploitation. Depending on the conversion factor used for the dry: wet weight of sea cucumbers, it is possible to infer that the combined catches for the Asia and Pacific regions are in the order of 20, 000 to 40, 000 tonnes/year. Sea cucumber species are commercially exploited as food with most of them comprising tropical and sub-tropical species from the families Holothuriidae and Stichopodidae, including the genera Holothuria, Actinopyga, Bohadschia and Stichopus (FAO, 2004, pp. 1e425; FAO, 2008, pp. 1e317).
* Corresponding author. E-mail address: [email protected] (J. Wen). https://doi.org/10.1016/j.foodcont.2018.02.048 0956-7135/© 2018 Elsevier Ltd. All rights reserved.
Sea cucumber species can be ranked as of high, medium or low commercial importance based on species, abundance, appearance, odour, color, thickness of the body wall and main market demand. Once processed and depending of the occasion during which it will be served, sea cucumbers obtains different prices according to species, moisture content, exterior appearance, size and flesh thickness (Lo, 2005). Classically, holothuroid families have been distinguished by means of morphological characters, such as the dermal ossicles, the form of the oesophageal calcareous ring and the distribution and morphology of the tube feet. But differences in morphological characters can be quite subtle at the species level, often obscuring taxonomic distinctions (Arndt, Marquez, Lambert, & Smith, 1996). Moreover, once caught, sea cucumbers are gutted, boiled and dried or roasted. Products are then preserved through drying, smoking or freezing for sale (Bruckner, 2005). Therefore, it is very difficult to identify the species of processed sea cucumber clearly based on their morphology. Under Chinese Law of Food Safety (Regulation No.9 of Feb. 28, 2009) for the common organization of the markets in food products, these products must be correctly labeled with the scientific name (or commercial name) of the species and the provenance before retail distribution. However, the sea cucumber products
L. Zeng et al. / Food Control 90 (2018) 166e171
usually are labeled with the local denomination according to the color or source of the species, such as ‘black sea cucumber’, ‘red sea cucumber’, ‘American sea cucumber’, ‘Latin American sea cucumber’ etc., Therefore, the consumers can be confused and do not know the detailed and clear information of the products at purchase level. Moreover, due to high prices and the increasing consumer demand, illegal merchants may cheat consumers for highly commercial benefits by adulterating, mislabeling, or substituting high-value species with low-value species. The molecular biology techniques provide robust and valuable tools for identification of the plant or animal species present in a foodstuff (Peres, Barlet, Loiseau, & Montet, 2007). Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique is used extensively to identify the species of origin in foods. Recently, several mitochondrial or nuclear genes were studied in many fishery products to reach the goal of the species identification, for instance of fish (Besbes, Fattouch, & Sadok, 2012; Chen, Hsieh, & Hwang, 2012, 2014; Espineira, Gonzalez-L, Vieites, & Santaclara, 2008; Ferrito, Bertolino, & Pappalardo, 2016; Mueller et al., 2015; Pappalardo & Ferrito, 2015; Perez & Presa, 2008; Perez, Vieites, & Presa, 2005; Rea, Storani, Mascaro, Stocchi, & Loschi, 2009; Sumathi et al., 2015), shrimp (Pascoal et al., 2008, Pascoal, Barros-V, Cepeda, Gallardo, & Calo-M, 2008a, Pascoal, Barros-V, Cepeda, Gallardo, & Calo-M, 2008b, 2011, 2012) and shellfish (Fernandez-T, & Mendez, 2007; Fernandez-T et al., 2011; Freire, Fernandez-T, & Mendez, 2008). Therefore, the main objective of the present work was to identify main commercial sea cucumber species applying PCR-RFLP technique based on a fragment of the 16S rRNA gene. We also performed forensically informative nucleotide sequencing (FINS) method (Barlett & Davidson, 1992) to evaluate if the application of PCR-RFLP to identify the species is to be useful, fast and reliable. Furthermore, we evaluated the labeling situation of these products in the market of Guangzhou, China. 2. Materials and methods
167
A pair of primers (16Sar: CGCCTGTTTATCAAAAACAT and 16Sbr: CTCCGGTTTGAACTCAGAT CA) reported by Kerr et al. (2005) was used for PCR amplification of each sample. PCR amplification assays used 100 ng of template DNA and 50 mL master mix containing 2 mL each primer (10 mmoL/L), 5 mL of 10 Ex Taq buffer (20 mmoL/L Mg2þ plus), 1 mL dNTP mixture (10 mmoL/L each, Sangon Biotech, China), and 0.5 mL Ex Taq DNA polymerase (2 U/mL) (TaKaRa, Japan). PCR have been carried out in a T-100 thermo-cycler (Bio-Rad, USA). PCR reactions were carried out as follows: a preheating step at 95 C for 30 s, 40 cycles of amplification (30 s at 95 C for denaturation, 30 s at 50 C for annealing and 1 min at 72 C for extension), and a final 4 min step at 72 C to assure the complete extension of fragments. A non-template negative control is used for PCR. The products of PCR amplification were analyzed by agarose gel electrophoresis. PCR products were purified with AxyPrep™ DNA Gel Extraction Kit (Axygen, USA), then sequenced in both directions with Applied Biosystems 3730 Automatic Sequencer. The sequences were analyzed with the Chromas lite v2.23 software and aligned using Editseq software (DNASTAR Lasergene Version 7.1.0) and Jellyfish software 3.3 (Labvelocity, CA, USA). 2.3. BLAST analysis for species identification of commercial sea cucumbers The MEGABLAST search available at NCBI (http://blast.ncbi.nlm. nih.gov) was assessed to assign any sea cucumber DNA sequence to a particular species. The reference sequences data belonging to Holothuriidae, Stichopodidae and Caudinidae were retrieved from GenBank (Table 1). 16S rRNA fragment of all specimens were compared to the reference sequences of each sea cucumber species made available in GenBank. The correct assignment of individuals to species was tested through the calculation of the Expect (E) value of reference sequence identity. The assignment of individuals to the species level was performed based on the Expect (E) values resulting from BLAST, where sequences with the lowest E-value are those that best match the query sequence.
2.1. Sample collection of sea cucumbers Samples of whole fresh Actinopyga lecanora, Actinopyga echinites, Bohadschia argus, Holothuria leucospilota, Holothuria scabra, Holothuria fuscogilva, Holothuria fuscopunctata, Stichopus herrmanni, Stichopus chloronotus, Thelenota ananas and Thelenota anax, Acaudina molpadioides were collected by scuba diving in Sanya (southern coastal city in China, N18 150 , E109 300 ). And the whole fresh Apostichopus japonicus were collected from aquaculture farm in Dalian (northern coastal city in China, N38 540 , E121360 ). Each species included 6 individuals. Identifications were based on morphological description by Liao (1997, pp. 82e147) and Massin (1999). Muscle tissues of each sample were preserved in ethanol for DNA extraction. Other 19 commercial food products of sea cucumber were considered, including six frozen products and 13 dried products, which were purchased from local supermarkets and retail markets in Guangzhou, China, respectively. Each product included 6 individuals and all 192 samples (78 fresh samples, 36 frozen samples and 78 dried samples) underwent DNA extraction, PCR, DNA sequencing, PCR-RFLP and FINS.
2.4. Development of the PCReRFLP methodology for identification of sea cucumber species Restriction maps of the DNA sequences obtained were generated using the Jellyfish software 3.3 (Labvelocity, CA, USA). Enzymes Dde I, Hae III and Sty I (New England Biolabs, USA) were selected by their ability to generate characteristic restriction profiles for each species with band sizes easily distinguishable on agarose gels. The PCR amplification product of the 16S rRNA gene was digested with Dde I (37 C, 1 h), Hae III (37 C, 1 h) and Sty I (37 C, 1 h), respectively. The reaction was carried out in 20 mL volumes with 100e200 ng amplified DNA, 10 U enzyme and 10 digestion buffer and bovine serum albumin (BSA). Digested products were separated by electrophoresis in a 2.5% agarose gel containing 10 mg/mL ethidium bromide at 130 V for 60 min. The sizes of the resulting DNA fragments were estimated by comparison with commercial 100-bp and 50-bp ladder (Tiangen Biotech Co. Ltd., Beijing, China). After electrophoresis, the gel was visualized under UV light.
2.2. DNA extraction, PCR and sequencing
2.5. FINS methodology
Total DNA extraction was performed starting from 30 mg of tissue samples using the TIANamp Marine Animals DNA Kit (TIANGEN, China) according to the manufacturer's instructions. A reagent blank was used as contamination control during DNA extraction. After extraction of template DNA, DNA concentrations were measured using a U-1800 spectrophotometer (Hitachi, Japan).
Phylogenetic analysis was undertaken using the PHYLIP package (Felsenstein, 2004). The tree was inferred through the Neighborjoining (NJ) method, with Kimura's 2-parameter distance (Kimura, 1980). The NJ tree was generated from the distance matrix on the basis of all pairwise comparisons of sequences. In order to assess the confidence placed in tree topology, bootstrap method
168
L. Zeng et al. / Food Control 90 (2018) 166e171
Table 1 Reference sea cucumber species included in this work. Scientific namea
Commercial nameb
Commercial valueb
Origin
16S rRNA accession number from Genbank
A. lecanora A. echinites A. caerulea B. argus H. leucospilota H. scabra H. fuscogilva H. mexicana H. fuscopunctata A. japonicus I. badionotus S. herrmanni S. chloronotus T. ananas T. anax A. molpadioides
Stonefish Deep water redfish e Tigerfish e Sandfish White teatfish Donkey dungfish Elephant trunkfish Spikyfish Chocolate chipfish Curryfish Greenfish Prickly redfish Amberfish Sea sweet potato
Low Medium Medium Low Low High High Medium Medium High Medium Medium Medium High Medium Low
China China Africa China/Africa China/America China/Africa Africa Latin America Africa China/Japan Latin America China/Africa China/Africa China/Africa China/Africa China
FJ971382/FJ589208/EU822465 FJ971383/FJ589209/EU822436 FJ971375/EU822430 FJ971384/FJ589210/AY338416 FJ971389/FJ589211/AY338419 FJ971376/AY509138 FJ971377 FJ971378/EU822443 FJ971379 FJ971381/FJ589207/AY852278 FJ794474/JN207495 FJ971385/FJ589203 FJ971386/FJ589204/AY338422 FJ971387/FJ589205 FJ971388/FJ589206 FJ971380
a Genera abbreviations: A., Actinopyga; B., Bohadschia; H., Holothuria; A. japonicus, Apostichopus japonicus; I., Isostichopus; S., Stichopus; T., Thelenota; A. molpadioides, Acaudina molpadioides. b Indicates not known.
was employed. Bootstrap values for NJ tree was estimated with searches using 1000 replicates. The tree was drawn using the program TREEVIEW (Page, 1996). 3. Results and discussion 3.1. Amplification and sequencing of PCR products The suitability of the mitochondrial 16S rRNA gene to develop a DNA-based method for the genetic identification of sea cucumber species was assessed in this study. Mitochondrial DNA (mtDNA) evolves much faster than nuclear DNA, and it is highly conserved with regard to other mitochondrial regions, will allow for the genetic identification of closely related species. Moreover, the high abundance of mitochondrial DNA in total cellular nucleic acid preparations allows for more effective PCR amplifications in comparison to nuclear DNA. This fact makes it easy for amplification when food processes are applied to the raw material, such as dried products, because intense heat coupled with overpressure conditions may cause severe nuclear DNA degradation (Bellagamba, Moretti, Comincini, & Valfre, 2001). In the present study, the ca. 570 bp fragment of 16S rRNA gene could be obtained in all of samples including fresh, frozen and dried commercial products (Fig. 1). After purification and sequencing of the PCR products, the 16 studied species were found genetically distinct from each other. The sequences of mtDNA fragments demonstrated simplicity and unambiguity. The sequences reported here have been deposited in the GenBank database under accession numbers FJ971375FJ971389 and FJ794474 (Table 1). 3.2. BLAST analysis for species identification of commercial sea cucumbers Partial 16S rRNA gene sequences obtained for all commercial samples were compared to those corresponding to each studied species made available in GenBank using BLAST. The BLAST was initially developed to find regions of similarity between sequences, nowadays BLAST is a suitable technique used for the genetic identification of species (Fernandez-T, & Mendez, 2007; Perez & Presa, 2008). In the present study, the MEGABLAST search available at NCBI was assessed to assign sea cucumber DNA sequence to a particular species. ca. 530 bp 16S rRNA sequences (cropped of primer sequence) from all authenticated sea cucumber samples
Fig. 1. Position of primer set used and PCR-amplification of the 16S rRNA fragments in different commercial sea cucumber species. Lane M, marker (Ladder 100 bp); lane 1, A. lecanora; lane 2, A. echinites; lane 3, A. caerulea; lane 4, B. argus; lane 5, H. leucospilota; lane 6, H. scabra; lane 7, H. fuscogilva; lane 8, H. mexicana; lane 9, H. fuscopunctata; lane 10, A. japonicus; lane 11, I. badionotus; lane 12, S. herrmanni; lane 13, S. chloronotus; lane 14, T. ananas; lane 15, T. anax; lane 16, A. molpadioides; lane 17, negative control. Genera abbreviations are as given in the legend to Table 1.
fully matched to each species indexed in GenBank and each species exhibited high values of intra-species similarity (ranged from 99.1% to 100%). Moreover, the inter-species similarity ranged from 67.2% to 92.0%. These results indicated that the high degree of intraspecies conservation of the 16S rRNA reinforces the use of this molecular marker.
L. Zeng et al. / Food Control 90 (2018) 166e171
169
3.3. Development of the PCReRFLP methodology for species identification of commercial sea cucumbers In the present study, a reliable PCR-RFLP analysis using the 16S rRNA gene region was developed for accurate discrimination of 16 commercial sea cucumber species belonging to family Holothuriidae, Stichopodidae and Caudinidae. The ca. 570 bp sequences obtained for all of the studied species allowed us to carry out the method based on the different restriction profiles generated by three endonucleases: Dde I, Hae III and Sty I (Fig. 2a, b and c). The DNA fragments with less than 50 bp generated in the restriction digestion were not used in identification, because most of these fragments were primer dimers, or the low amount of generated fragments could be affected by the fluorescent area and caused the difficulty of visualization under UV light. However, despite the absence of these fragments, the results were in agreement with the expected result inferred from preliminary computer-assisted analysis using Jellyfish software (Table 2). The endonuclease Dde I allowed to distinguish A. echinites, A. caerulea, H. leucospilota, H. fuscogilva, H. fuscopunctata, I. badionotus and T. anax; the endonucleases Hae III permitted to differentiate H. scabra, H. mexicana, S. herrmanni, S. chloronotus, and T. ananas; and the endonucleases Sty I was employed to distinguish A. lecanora, B. argus, A. japonicus and A. molpadioides. The combined haplotypes of these three
Fig. 2. Restriction fragments generated by endonucleases Dde I (a), Hae III (b) and Sty I (c) on ca. 570 bp amplicons of 16S rRNA gene obtained from different commercial sea cucumber species. Lane M, marker (Ladder 100 bp þ Ladder 50 bp); lane 1, A. lecanora; lane 2, A. echinites; lane 3, A. caerulea; lane 4, B. argus; lane 5, H. leucospilota; lane 6, H. scabra; lane 7, H. fuscogilva; lane 8, H. mexicana; lane 9, H. fuscopunctata; lane 10, A. japonicus; lane 11, I. badionotus; lane 12, S. herrmanni; lane 13, S. chloronotus; lane 14, T. ananas; lane 15, T. anax; lane 16, A. molpadioides; lane 17, negative control. Genera abbreviations are as given in the legend to Table 1. Capital letters below the image indicate single restriction haplotype which are showed in Table 2.
Fig. 3. Molecular phylogenetic tree in the commercial sea cucumber species investigated based on Neighbor-joining analyses of 16S rRNA gene sequences. Numbers above branches indicate bootstrap values (percentage of 1000 replicates) higher than 85 from Neighbor-joining analysis. The S1- S9 codes belong to the commercial samples analyzed for which a mislabeling was detected (Table 3).
Table 2 Expected restriction patterns of the sea cucumber species included in this study. Species
Seq. size (bp)
A. lecanora A. echinites A. caerulea B. argus H. leucospilota H. scabra H. fuscogilva H. mexicana H. fuscopunctata A. japonicus I. badionotus S. herrmanni S. chloronotus T. ananas T. anax A. molpadioides
551 552 549 567 558 541 552 553 566 571 569 573 576 577 572 564
Dde I
Hae III
Fragment size (bp)
a
422 277 231 266 484 412 361 288 396 279 298 444 447 278 443 435
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
113 þ 16 259 þ 16 189 þ 113 þ 16 178 þ 113 þ 16 58 þ 16 113 þ 16 62 þ 58 þ 55 þ 16 188 þ 61 þ 16 154 þ 16 164 þ 113 þ 16 74 þ 72 þ 68 þ 41 þ 16 113 þ 16 113 þ 16 170 þ 58 þ 55 þ 16 58 þ 55 þ 16 113 þ 16
The unique composite haplotype pattern for each species.
Type
Fragment size (bp)
A B C D E A F G H D I A A G J A
477 478 475 496 482 390 399 400 412 493 493 272 494 494 489 491
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
Patterna
Sty I
74 74 74 77 76 79 þ 72 79 þ 74 79 þ 59 þ 15 79 þ 75 78 76 222 þ 48 þ 31 51 þ 31 83 83 73
Type
Fragment size (bp)
Type
A A A A A B B C B A A D E A A A
551 552 475 322 309 292 304 303 319 571 253 297 281 577 323 311
A A B C C C C C D A E C C A C C
þ þ þ þ þ þ þ
74 251 249 249 248 250 173 þ 74
þ 251 þ 65 þ 251 þ 25 þ 251 þ 44 þ 249 þ 253
AAA BAA CAB DAC EAC ABC FBC GCC HBD DAA IAE ADC AEC GAA JAC AAC
170
L. Zeng et al. / Food Control 90 (2018) 166e171
Table 3 Commercial samples analyzed with the methods developed. Products Substituted
Frozen sea cucumber
Ambiguously labeled
Dried sea cucumber Frozen sea cucumber
Dried sea cucumber
Correctly labeled
Frozen sea cucumber Dried sea cucumber
Codes
Species labeled or declared
Species identified
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
Deep water redfish (A. echinites) Thorn trepang (A. japonicus) Thorn trepang (A. japonicus) Black sea cucumber American sea cucumber Red sea cucumber Latin American sea cucumber Black sea cucumber Bald sea cucumber Curryfish Thorn trepang Stonefish Tigerfish White teatfish Elephant trunkfish Curryfish Greenfish Prickly redfish Amberfish
H. leucospilota I. badionotus I. badionotus H. leucospilota H. leucospilota A. molpadioides H. mexicana A. caerulea H. scabra S. herrmanni A. japonicus A. lecanora B. argus H. fuscogilva H. fuscopunctata S. herrmanni S. chloronotus T. ananas T. anax
enzymes generated the unique composite haplotype pattern for each species and allowed for the identification of all of the studied species. Remarkably, despite the low nucleotide variability detected in certain species, none of the single nucleotide polymorphic events detected in the specimens analyzed affected the restriction patterns. Moreover, the developed methodology was applied to 6 standard individuals of each sample, and changes in the expected restriction profiles were not detected, the high number of samples that were taken into account giving a high degree of reliability to the developed method. Therefore, PCR-RFLP represents a suitable technique to identify the sea cucumber species included in this work. 3.4. FINS methodology for species identification of commercial sea cucumbers It was considered that the restriction profiles generated in unstudied species may coincide with those obtained in the studied species. Accordingly, an alternative method that called FINS was applied. FINS technique was described by Barlett and Davidson (1992), who proposed the genetic identification of species using phylogenetic analysis. A ca. 530 bp long sequence of 16S rRNA gene fragments (cropped of primer sequence) were aligned for genetic distances, and Neighbor-joining phylogenetic tree based on genetic distances was constructed, showing that samples belonging to the same species were grouped into the same clade, allowing for the differentiation of all of the species included in the present study (Fig. 3). All of the branches at the level of species have bootstrap values higher than 90. The result reflected the robust support of the assignation. And the result was accord with the specific assignations by means of PCR-RFLP technique in all cases. 3.5. Market study of sea cucumber species in commercial food products The PCR-RFLP and FINS methods developed were applied to 19 commercial products from the markets. All of the products analyzed were identified as some species of those included in this work. Three analyzed products detected a different species of those declared on the label (16%) and six of them were ambiguously labeled (32%), meaning 48% of the products were incorrectly labeled (Fig. 3 and Table 3). It was observed that the percentage of incorrect labeling was different depending on the commercial value
of the species, especially the species A. japonicus, which with high commercial value corresponding to high price. Another reason for substitution may be overexploiting, a multitude of sea cucumber species are being exploited worldwide, with new species being placed on the market whilst valuable species become scarcer and more difficult to find (FAO, 2008, pp. 1e317). Of those ambiguous labeling cases, in which the food product exhibited non-specific labeling, highlighted the fact that a considerable lack of information is currently associated with the commercialization of the sea cucumbers. The reason would be the lack of confidence in the phenotypic differentiation based on external features, or difficulty in identifying multispecies fished together on the basis of the morphological characters. At this point, the molecular methods evaluated in this work revealed as valuable tools to overcome this problem. In conclusion, PCR-RFLP and FINS methods developed in this study allow the genetic identification of commercial sea cucumber species in fresh, frozen and dried forms, and allow us to evaluate the labeling situation of these products in the market. The developed tools can be very useful in the normative control of processed products produced from sea cucumber, particularly in the authenticity of imported species, the correct labeling, the protection of the consumer's rights, the sustainment of ecological, social and economic benefits of these resources, and also for fisheries control of endangered species to conserve stocks biodiversity.
Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31201999, 31701688), the Natural Science Foundation of Guangdong Province (No. 2014A030307022), the China Spark Program (No. 2012GA780008), the Special Support Program of Guangdong Province (No. 2014TQ01N621), the Foundation for Distinguished Young Teachers in Higher Education of Guangdong (No. Yq2014115), the Foundation of Education Bureau of Guangdong Province (No. 2014KTSCX159), the Technology Program of Guangdong Province (Nos. 2017A040405060, 2015A030302089), the Technology Program of Zhanjiang (Nos. 2015A03017, 2016A03023), the Guangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Qassim University (No. 2017KB05) and the Program of Lingnan Normal University (No. YL1405).
L. Zeng et al. / Food Control 90 (2018) 166e171
References Arndt, A., Marquez, C., Lambert, P., & Smith, M. J. (1996). Molecular phylogeny of eastern Pacific sea cucumbers (Echinodermata: Holothuroidea) based on mitochondrial DNA sequence. Molecular Phylogenetics and Evolution, 6, 425e437. Barlett, S. E., & Davidson, W. S. (1992). FINS (forensically informative nucleotide sequencing): A procedure for identifying the animal origin of biological specimens. Biotechniques, 12, 408e411. Bellagamba, F., Moretti, V. M., Comincini, S., & Valfre, F. (2001). Identification of species in animal feedstuffs by polymerase chain reaction-restriction fragment length polymorphism analysis of mitochondrial DNA. Journal of Agricultural and Food Chemistry, 39, 3775e3781. Besbes, N., Fattouch, S., & Sadok, S. (2012). Differential detection of small pelagic fish in Tunisian canned products by PCR-RFLP: An efficient tool to control the label information. Food Control, 25, 260e264. Bruckner, A. W. (2005). The recent status of sea cucumber fisheries in the continental United States of America. SPC BechedeMer Information Bulletin, 22, 39e46. Chen, C. H., Hsieh, C. H., & Hwang, D. F. (2012). Species identification of Cyprinidae fish in Taiwan by FINS and PCR-RFLP analysis. Food Control, 28, 240e245. Chen, S., Zhang, Y., Li, H., Wang, J., Chen, W., Zhou, Y., et al. (2014). Differentiation of fish species in Taiwan Strait by PCR-RFLP and lab-on-a-chip system. Food Control, 44, 26e34. Espineira, M., Gonzalez-L, N., Vieites, J. M., & Santaclara, F. J. (2008). Authentication of anglerfish species (Lophius spp) by means of polymerase chain ReactionRestriction fragment length polymorphism (PCRRFLP) and forensically informative nucleotide sequencing (FINS) methodologies. Journal of Agricultural and Food Chemistry, 55, 10594e10599. FAO. (2004). Advances in sea cucumber aquaculture and management. FAO Fisheries and Aquaculture Technical Paper, No. 463, Rome. FAO. (2008). Sea cucumbers: A global review of fisheries and trade. FAO Fisheries and Aquaculture Technical Paper, No. 516, Rome. Felsenstein, J. (2004). PHYLIP (phylogeny inference package) version 3.6b. Distributed by the author. Seattle: Department of Genome Sciences, University of Washington. Fernandez-T, J., Longa, A., GarcIa-G, J., Chiu, Y., Huang, Y., Mendez, J., et al. (2011). Alternative PCReRFLP methods for mussel Mytilus species identification. European Food Research and Technology, 233, 791e796. Fernndez, T. J., & Mendez, J. (2007). Identification of the razor clam species Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus Using PCRRFLP Analysis of the 5SrrDNA Region. Journal of Agricultural and Food Chemistry, 55, 7278e7282. Ferrito, V., Bertolino, V., & Pappalardo, A. M. (2016). White fish authentication by COIBar-RFLP: Toward a common strategy for the rapid identification of species in convenience seafood. Food Control, 70, 130e137. Freire, R., Fernandez-T, J., & Mendez, J. (2008). Identification of razor clams Ensis arcuatus and Ensis siliqua by PCReRFLP analysis of ITS1 region. Fisheries Science, 74, 511e515. Kerr, A. M., Janies, D. A., Clouse, R. M., Samyn, Y., Kuszak, J., & Kim, J. (2005). Molecular phylogeny of coral-Reef sea cucumbers (Holothuriidae: Aspidochirotida) based on 16S mitochondrial ribosomal DNA sequence. Marine Biotechnology, 7, 53e60. Kimura, M. A. (1980). Simple method for estimating rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111e120. Liao, Y. (1997). Fauna Sincia: Phylum Echinodermata class Holothuroidea. Beijing:
171
Science Press. Lo, T. H. (2005). Valuation of sea cucumber attributes through laddering. SPC BechedeMer Information Bulletin, 20, 34e37. Massin, C. (1999). Reef-dwelling Holothuroidea (Echinodermata) of the Spermonde archipelago (South-West Sulawesi, Indonesia). Zoologische verhandelingen, 329, 1e144. Mueller, S., Handy, S. M., Deeds, J. R., George, G. O., Broadhead, W. J., Pugh, S. E., et al. (2015). Development of a COX1 based PCR-RFLP method for fish species identification. Food Control, 55, 39e42. Page, R. D. M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences, 12, 357e358. Pappalardo, A. M., & Ferrito, V. (2015). A COIBar-RFLP strategy for the rapid detection of Engraulis encrasicolus in processed anchovy products. Food Control, 57, 385e392. Pascoal, A., Barros-V, J., & Cepeda, A. (2008). Survey of the authenticity of prawn and shrimp species in commercial food products by PCR-RFLP analysis of a 16S rRNA/tRNAVal mitochondrial region. Food Chemistry, 109, 638e646. Pascoal, A., Barros-V, J., Cepeda, A., Gallardo, J. M., & Calo-M, P. (2008a). A polymerase chain reaction-restriction fragment length polymorphism method based on the analysis of a 16S rRNA/tRNAVal mitochondrial region for species identification of commercial penaeid shrimps (Crustacea: Decapoda: Penaeoidea) of food interest. Electrophoresis, 29, 499e509. Pascoal, A., Barros-V, J., Cepeda, A., Gallardo, J. M., & Calo-M, P. (2008b). Identification of shrimp species in raw and processed food products by means of a polymerase chain reaction-restriction fragment length polymorphism method targeted to cytochrome b mitochondrial sequences. Electrophoresis, 29, 3220e3228. Pascoal, A., Barros-V, J., Ortea, I., Cepeda, A., Gallardo, J. M., & Calo-M, P. (2011). Molecular identification of the black tiger shrimp (Penaeus monodon), the white leg shrimp (Litopenaeus vannamei) and the Indian white shrimp (Fenneropenaeus indicus) by PCR targeted to the 16S rRNA mtDNA. Food Chemistry, 125, 1457e1461. Pascoal, A., Ortea, I., Gallardo, J. M., Canas, B., Barros-V, J., & Calo-M, P. (2012). Species identification of the Northern shrimp (Pandalus borealis) by polymerase chain reaction-restriction fragment length polymorphism and proteomic analysis. Analytical Biochemistry, 421, 56e67. Peres, B., Barlet, N., Loiseau, G., & Montet, D. (2007). Review of the current methods of analytical traceability allowing determination of the origin of foodstuffs. Food Control, 18, 228e235. Perez, M., & Presa, P. (2008). Validation of a tRNAGlucytochrome b Key for the molecular identification of 12 Hake species (Merluccius spp.) and Atlantic cod (Gadus morhua) using PCRRFLPs, FINS, and BLAST. Journal of Agricultural and Food Chemistry, 56, 10865e10871. Perez, M., Vieites, J. M., & Presa, P. (2005). ITS1-rDNA-Based methodology to identify world-wide Hake species of the genus Merluccius. Journal of Agricultural and Food Chemistry, 53, 5239e5247. Rea, S., Storani, G., Mascaro, N., Stocchi, R., & Loschi, A. R. (2009). Species identification in anchovy pastes from the market by PCRRFLP technique. Food Control, 20, 515e520. Sumathi, G., Jeyasekaran, G., Shakila, R. J., Sivaraman, B., Arunkumar, G., Manimaran, U., et al. (2015). Molecular identification of grouper species using PCR-RFLP technique. Food Control, 51, 300e306. Wen, J., & Hu, C. (2010). Elemental composition of commercial sea cucumbers (holothurians). Food Additives and Contaminants: Part B, 3, 246e252. Wen, J., Hu, C., & Fan, S. (2010). Chemical composition and nutritional quality of sea cucumbers. Journal of the Science of Food and Agriculture, 90, 2469e2474.
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Identification of sea cucumber species in processed food products by PCR-RFLP method Ling Zeng a, Jing Wen b, *, Sigang Fan c, Ziming Chen a, Youhou Xu d, Yulin Sun b, Daohai Chen b, Juan Zhao b, Lele Xu b, Yongqin Li b a
Department of Chemistry, Lingnan Normal University, Zhanjiang, 524048, China Department of Biology, Lingnan Normal University, Zhanjiang, 524048, China Key Laboratory of South China Sea Fishery Resources Utilization, Ministry of Agriculture, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, 510300, China d Guangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Qinzhou University, Qinzhou, 535000, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Available online 27 February 2018
A PCR-RFLP method has been developed for the identification of 16 commercial sea cucumber species in raw and processed food products. To implement the method, PCR amplification with the 16Sar/16Sbr primers, targeted to the amplification of a ca. 570 bp region of the 16S rRNA mitochondrial gene in sea cucumbers, was coupled to restriction analysis with Dde I, Hae III and Sty I. We also report the FINS method based on 16S rRNA mitochondrial sequences. Both proposed methodologies were independently applied to authenticate the species of 19 commercial products, showing that 9 products were incorrectly labeled (48%). Therefore, the 16S rRNA mitochondrial gene really provide convenient, useful and academic molecular marker to study questions related to correct labeling of commercial products, traceability, and the control of sea cucumber fisheries. © 2018 Elsevier Ltd. All rights reserved.
Keywords: Sea cucumbers Species identification 16S rRNA gene PCR-RFLP FINS
1. Introduction Sea cucumbers (also called holothurians, Echinodermata: Holothuroidea), and the dried form (‘beche-de-mer’ or ‘trepang’), have been a dietary delicacy and medicinal cure for Asians over many centuries. Sea cucumbers present high nutritional values due to their high protein, low fat content, amino acid, fatty acid profile (Wen, Hu, & Fan, 2010) and rich trace elements (Wen & Hu, 2010). Based on the most recent available catch and trade data, Asia and the Pacific area are the top producing regions despite the long history of exploitation. Depending on the conversion factor used for the dry: wet weight of sea cucumbers, it is possible to infer that the combined catches for the Asia and Pacific regions are in the order of 20, 000 to 40, 000 tonnes/year. Sea cucumber species are commercially exploited as food with most of them comprising tropical and sub-tropical species from the families Holothuriidae and Stichopodidae, including the genera Holothuria, Actinopyga, Bohadschia and Stichopus (FAO, 2004, pp. 1e425; FAO, 2008, pp. 1e317).
* Corresponding author. E-mail address: [email protected] (J. Wen). https://doi.org/10.1016/j.foodcont.2018.02.048 0956-7135/© 2018 Elsevier Ltd. All rights reserved.
Sea cucumber species can be ranked as of high, medium or low commercial importance based on species, abundance, appearance, odour, color, thickness of the body wall and main market demand. Once processed and depending of the occasion during which it will be served, sea cucumbers obtains different prices according to species, moisture content, exterior appearance, size and flesh thickness (Lo, 2005). Classically, holothuroid families have been distinguished by means of morphological characters, such as the dermal ossicles, the form of the oesophageal calcareous ring and the distribution and morphology of the tube feet. But differences in morphological characters can be quite subtle at the species level, often obscuring taxonomic distinctions (Arndt, Marquez, Lambert, & Smith, 1996). Moreover, once caught, sea cucumbers are gutted, boiled and dried or roasted. Products are then preserved through drying, smoking or freezing for sale (Bruckner, 2005). Therefore, it is very difficult to identify the species of processed sea cucumber clearly based on their morphology. Under Chinese Law of Food Safety (Regulation No.9 of Feb. 28, 2009) for the common organization of the markets in food products, these products must be correctly labeled with the scientific name (or commercial name) of the species and the provenance before retail distribution. However, the sea cucumber products
L. Zeng et al. / Food Control 90 (2018) 166e171
usually are labeled with the local denomination according to the color or source of the species, such as ‘black sea cucumber’, ‘red sea cucumber’, ‘American sea cucumber’, ‘Latin American sea cucumber’ etc., Therefore, the consumers can be confused and do not know the detailed and clear information of the products at purchase level. Moreover, due to high prices and the increasing consumer demand, illegal merchants may cheat consumers for highly commercial benefits by adulterating, mislabeling, or substituting high-value species with low-value species. The molecular biology techniques provide robust and valuable tools for identification of the plant or animal species present in a foodstuff (Peres, Barlet, Loiseau, & Montet, 2007). Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique is used extensively to identify the species of origin in foods. Recently, several mitochondrial or nuclear genes were studied in many fishery products to reach the goal of the species identification, for instance of fish (Besbes, Fattouch, & Sadok, 2012; Chen, Hsieh, & Hwang, 2012, 2014; Espineira, Gonzalez-L, Vieites, & Santaclara, 2008; Ferrito, Bertolino, & Pappalardo, 2016; Mueller et al., 2015; Pappalardo & Ferrito, 2015; Perez & Presa, 2008; Perez, Vieites, & Presa, 2005; Rea, Storani, Mascaro, Stocchi, & Loschi, 2009; Sumathi et al., 2015), shrimp (Pascoal et al., 2008, Pascoal, Barros-V, Cepeda, Gallardo, & Calo-M, 2008a, Pascoal, Barros-V, Cepeda, Gallardo, & Calo-M, 2008b, 2011, 2012) and shellfish (Fernandez-T, & Mendez, 2007; Fernandez-T et al., 2011; Freire, Fernandez-T, & Mendez, 2008). Therefore, the main objective of the present work was to identify main commercial sea cucumber species applying PCR-RFLP technique based on a fragment of the 16S rRNA gene. We also performed forensically informative nucleotide sequencing (FINS) method (Barlett & Davidson, 1992) to evaluate if the application of PCR-RFLP to identify the species is to be useful, fast and reliable. Furthermore, we evaluated the labeling situation of these products in the market of Guangzhou, China. 2. Materials and methods
167
A pair of primers (16Sar: CGCCTGTTTATCAAAAACAT and 16Sbr: CTCCGGTTTGAACTCAGAT CA) reported by Kerr et al. (2005) was used for PCR amplification of each sample. PCR amplification assays used 100 ng of template DNA and 50 mL master mix containing 2 mL each primer (10 mmoL/L), 5 mL of 10 Ex Taq buffer (20 mmoL/L Mg2þ plus), 1 mL dNTP mixture (10 mmoL/L each, Sangon Biotech, China), and 0.5 mL Ex Taq DNA polymerase (2 U/mL) (TaKaRa, Japan). PCR have been carried out in a T-100 thermo-cycler (Bio-Rad, USA). PCR reactions were carried out as follows: a preheating step at 95 C for 30 s, 40 cycles of amplification (30 s at 95 C for denaturation, 30 s at 50 C for annealing and 1 min at 72 C for extension), and a final 4 min step at 72 C to assure the complete extension of fragments. A non-template negative control is used for PCR. The products of PCR amplification were analyzed by agarose gel electrophoresis. PCR products were purified with AxyPrep™ DNA Gel Extraction Kit (Axygen, USA), then sequenced in both directions with Applied Biosystems 3730 Automatic Sequencer. The sequences were analyzed with the Chromas lite v2.23 software and aligned using Editseq software (DNASTAR Lasergene Version 7.1.0) and Jellyfish software 3.3 (Labvelocity, CA, USA). 2.3. BLAST analysis for species identification of commercial sea cucumbers The MEGABLAST search available at NCBI (http://blast.ncbi.nlm. nih.gov) was assessed to assign any sea cucumber DNA sequence to a particular species. The reference sequences data belonging to Holothuriidae, Stichopodidae and Caudinidae were retrieved from GenBank (Table 1). 16S rRNA fragment of all specimens were compared to the reference sequences of each sea cucumber species made available in GenBank. The correct assignment of individuals to species was tested through the calculation of the Expect (E) value of reference sequence identity. The assignment of individuals to the species level was performed based on the Expect (E) values resulting from BLAST, where sequences with the lowest E-value are those that best match the query sequence.
2.1. Sample collection of sea cucumbers Samples of whole fresh Actinopyga lecanora, Actinopyga echinites, Bohadschia argus, Holothuria leucospilota, Holothuria scabra, Holothuria fuscogilva, Holothuria fuscopunctata, Stichopus herrmanni, Stichopus chloronotus, Thelenota ananas and Thelenota anax, Acaudina molpadioides were collected by scuba diving in Sanya (southern coastal city in China, N18 150 , E109 300 ). And the whole fresh Apostichopus japonicus were collected from aquaculture farm in Dalian (northern coastal city in China, N38 540 , E121360 ). Each species included 6 individuals. Identifications were based on morphological description by Liao (1997, pp. 82e147) and Massin (1999). Muscle tissues of each sample were preserved in ethanol for DNA extraction. Other 19 commercial food products of sea cucumber were considered, including six frozen products and 13 dried products, which were purchased from local supermarkets and retail markets in Guangzhou, China, respectively. Each product included 6 individuals and all 192 samples (78 fresh samples, 36 frozen samples and 78 dried samples) underwent DNA extraction, PCR, DNA sequencing, PCR-RFLP and FINS.
2.4. Development of the PCReRFLP methodology for identification of sea cucumber species Restriction maps of the DNA sequences obtained were generated using the Jellyfish software 3.3 (Labvelocity, CA, USA). Enzymes Dde I, Hae III and Sty I (New England Biolabs, USA) were selected by their ability to generate characteristic restriction profiles for each species with band sizes easily distinguishable on agarose gels. The PCR amplification product of the 16S rRNA gene was digested with Dde I (37 C, 1 h), Hae III (37 C, 1 h) and Sty I (37 C, 1 h), respectively. The reaction was carried out in 20 mL volumes with 100e200 ng amplified DNA, 10 U enzyme and 10 digestion buffer and bovine serum albumin (BSA). Digested products were separated by electrophoresis in a 2.5% agarose gel containing 10 mg/mL ethidium bromide at 130 V for 60 min. The sizes of the resulting DNA fragments were estimated by comparison with commercial 100-bp and 50-bp ladder (Tiangen Biotech Co. Ltd., Beijing, China). After electrophoresis, the gel was visualized under UV light.
2.2. DNA extraction, PCR and sequencing
2.5. FINS methodology
Total DNA extraction was performed starting from 30 mg of tissue samples using the TIANamp Marine Animals DNA Kit (TIANGEN, China) according to the manufacturer's instructions. A reagent blank was used as contamination control during DNA extraction. After extraction of template DNA, DNA concentrations were measured using a U-1800 spectrophotometer (Hitachi, Japan).
Phylogenetic analysis was undertaken using the PHYLIP package (Felsenstein, 2004). The tree was inferred through the Neighborjoining (NJ) method, with Kimura's 2-parameter distance (Kimura, 1980). The NJ tree was generated from the distance matrix on the basis of all pairwise comparisons of sequences. In order to assess the confidence placed in tree topology, bootstrap method
168
L. Zeng et al. / Food Control 90 (2018) 166e171
Table 1 Reference sea cucumber species included in this work. Scientific namea
Commercial nameb
Commercial valueb
Origin
16S rRNA accession number from Genbank
A. lecanora A. echinites A. caerulea B. argus H. leucospilota H. scabra H. fuscogilva H. mexicana H. fuscopunctata A. japonicus I. badionotus S. herrmanni S. chloronotus T. ananas T. anax A. molpadioides
Stonefish Deep water redfish e Tigerfish e Sandfish White teatfish Donkey dungfish Elephant trunkfish Spikyfish Chocolate chipfish Curryfish Greenfish Prickly redfish Amberfish Sea sweet potato
Low Medium Medium Low Low High High Medium Medium High Medium Medium Medium High Medium Low
China China Africa China/Africa China/America China/Africa Africa Latin America Africa China/Japan Latin America China/Africa China/Africa China/Africa China/Africa China
FJ971382/FJ589208/EU822465 FJ971383/FJ589209/EU822436 FJ971375/EU822430 FJ971384/FJ589210/AY338416 FJ971389/FJ589211/AY338419 FJ971376/AY509138 FJ971377 FJ971378/EU822443 FJ971379 FJ971381/FJ589207/AY852278 FJ794474/JN207495 FJ971385/FJ589203 FJ971386/FJ589204/AY338422 FJ971387/FJ589205 FJ971388/FJ589206 FJ971380
a Genera abbreviations: A., Actinopyga; B., Bohadschia; H., Holothuria; A. japonicus, Apostichopus japonicus; I., Isostichopus; S., Stichopus; T., Thelenota; A. molpadioides, Acaudina molpadioides. b Indicates not known.
was employed. Bootstrap values for NJ tree was estimated with searches using 1000 replicates. The tree was drawn using the program TREEVIEW (Page, 1996). 3. Results and discussion 3.1. Amplification and sequencing of PCR products The suitability of the mitochondrial 16S rRNA gene to develop a DNA-based method for the genetic identification of sea cucumber species was assessed in this study. Mitochondrial DNA (mtDNA) evolves much faster than nuclear DNA, and it is highly conserved with regard to other mitochondrial regions, will allow for the genetic identification of closely related species. Moreover, the high abundance of mitochondrial DNA in total cellular nucleic acid preparations allows for more effective PCR amplifications in comparison to nuclear DNA. This fact makes it easy for amplification when food processes are applied to the raw material, such as dried products, because intense heat coupled with overpressure conditions may cause severe nuclear DNA degradation (Bellagamba, Moretti, Comincini, & Valfre, 2001). In the present study, the ca. 570 bp fragment of 16S rRNA gene could be obtained in all of samples including fresh, frozen and dried commercial products (Fig. 1). After purification and sequencing of the PCR products, the 16 studied species were found genetically distinct from each other. The sequences of mtDNA fragments demonstrated simplicity and unambiguity. The sequences reported here have been deposited in the GenBank database under accession numbers FJ971375FJ971389 and FJ794474 (Table 1). 3.2. BLAST analysis for species identification of commercial sea cucumbers Partial 16S rRNA gene sequences obtained for all commercial samples were compared to those corresponding to each studied species made available in GenBank using BLAST. The BLAST was initially developed to find regions of similarity between sequences, nowadays BLAST is a suitable technique used for the genetic identification of species (Fernandez-T, & Mendez, 2007; Perez & Presa, 2008). In the present study, the MEGABLAST search available at NCBI was assessed to assign sea cucumber DNA sequence to a particular species. ca. 530 bp 16S rRNA sequences (cropped of primer sequence) from all authenticated sea cucumber samples
Fig. 1. Position of primer set used and PCR-amplification of the 16S rRNA fragments in different commercial sea cucumber species. Lane M, marker (Ladder 100 bp); lane 1, A. lecanora; lane 2, A. echinites; lane 3, A. caerulea; lane 4, B. argus; lane 5, H. leucospilota; lane 6, H. scabra; lane 7, H. fuscogilva; lane 8, H. mexicana; lane 9, H. fuscopunctata; lane 10, A. japonicus; lane 11, I. badionotus; lane 12, S. herrmanni; lane 13, S. chloronotus; lane 14, T. ananas; lane 15, T. anax; lane 16, A. molpadioides; lane 17, negative control. Genera abbreviations are as given in the legend to Table 1.
fully matched to each species indexed in GenBank and each species exhibited high values of intra-species similarity (ranged from 99.1% to 100%). Moreover, the inter-species similarity ranged from 67.2% to 92.0%. These results indicated that the high degree of intraspecies conservation of the 16S rRNA reinforces the use of this molecular marker.
L. Zeng et al. / Food Control 90 (2018) 166e171
169
3.3. Development of the PCReRFLP methodology for species identification of commercial sea cucumbers In the present study, a reliable PCR-RFLP analysis using the 16S rRNA gene region was developed for accurate discrimination of 16 commercial sea cucumber species belonging to family Holothuriidae, Stichopodidae and Caudinidae. The ca. 570 bp sequences obtained for all of the studied species allowed us to carry out the method based on the different restriction profiles generated by three endonucleases: Dde I, Hae III and Sty I (Fig. 2a, b and c). The DNA fragments with less than 50 bp generated in the restriction digestion were not used in identification, because most of these fragments were primer dimers, or the low amount of generated fragments could be affected by the fluorescent area and caused the difficulty of visualization under UV light. However, despite the absence of these fragments, the results were in agreement with the expected result inferred from preliminary computer-assisted analysis using Jellyfish software (Table 2). The endonuclease Dde I allowed to distinguish A. echinites, A. caerulea, H. leucospilota, H. fuscogilva, H. fuscopunctata, I. badionotus and T. anax; the endonucleases Hae III permitted to differentiate H. scabra, H. mexicana, S. herrmanni, S. chloronotus, and T. ananas; and the endonucleases Sty I was employed to distinguish A. lecanora, B. argus, A. japonicus and A. molpadioides. The combined haplotypes of these three
Fig. 2. Restriction fragments generated by endonucleases Dde I (a), Hae III (b) and Sty I (c) on ca. 570 bp amplicons of 16S rRNA gene obtained from different commercial sea cucumber species. Lane M, marker (Ladder 100 bp þ Ladder 50 bp); lane 1, A. lecanora; lane 2, A. echinites; lane 3, A. caerulea; lane 4, B. argus; lane 5, H. leucospilota; lane 6, H. scabra; lane 7, H. fuscogilva; lane 8, H. mexicana; lane 9, H. fuscopunctata; lane 10, A. japonicus; lane 11, I. badionotus; lane 12, S. herrmanni; lane 13, S. chloronotus; lane 14, T. ananas; lane 15, T. anax; lane 16, A. molpadioides; lane 17, negative control. Genera abbreviations are as given in the legend to Table 1. Capital letters below the image indicate single restriction haplotype which are showed in Table 2.
Fig. 3. Molecular phylogenetic tree in the commercial sea cucumber species investigated based on Neighbor-joining analyses of 16S rRNA gene sequences. Numbers above branches indicate bootstrap values (percentage of 1000 replicates) higher than 85 from Neighbor-joining analysis. The S1- S9 codes belong to the commercial samples analyzed for which a mislabeling was detected (Table 3).
Table 2 Expected restriction patterns of the sea cucumber species included in this study. Species
Seq. size (bp)
A. lecanora A. echinites A. caerulea B. argus H. leucospilota H. scabra H. fuscogilva H. mexicana H. fuscopunctata A. japonicus I. badionotus S. herrmanni S. chloronotus T. ananas T. anax A. molpadioides
551 552 549 567 558 541 552 553 566 571 569 573 576 577 572 564
Dde I
Hae III
Fragment size (bp)
a
422 277 231 266 484 412 361 288 396 279 298 444 447 278 443 435
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
113 þ 16 259 þ 16 189 þ 113 þ 16 178 þ 113 þ 16 58 þ 16 113 þ 16 62 þ 58 þ 55 þ 16 188 þ 61 þ 16 154 þ 16 164 þ 113 þ 16 74 þ 72 þ 68 þ 41 þ 16 113 þ 16 113 þ 16 170 þ 58 þ 55 þ 16 58 þ 55 þ 16 113 þ 16
The unique composite haplotype pattern for each species.
Type
Fragment size (bp)
A B C D E A F G H D I A A G J A
477 478 475 496 482 390 399 400 412 493 493 272 494 494 489 491
þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ þ
Patterna
Sty I
74 74 74 77 76 79 þ 72 79 þ 74 79 þ 59 þ 15 79 þ 75 78 76 222 þ 48 þ 31 51 þ 31 83 83 73
Type
Fragment size (bp)
Type
A A A A A B B C B A A D E A A A
551 552 475 322 309 292 304 303 319 571 253 297 281 577 323 311
A A B C C C C C D A E C C A C C
þ þ þ þ þ þ þ
74 251 249 249 248 250 173 þ 74
þ 251 þ 65 þ 251 þ 25 þ 251 þ 44 þ 249 þ 253
AAA BAA CAB DAC EAC ABC FBC GCC HBD DAA IAE ADC AEC GAA JAC AAC
170
L. Zeng et al. / Food Control 90 (2018) 166e171
Table 3 Commercial samples analyzed with the methods developed. Products Substituted
Frozen sea cucumber
Ambiguously labeled
Dried sea cucumber Frozen sea cucumber
Dried sea cucumber
Correctly labeled
Frozen sea cucumber Dried sea cucumber
Codes
Species labeled or declared
Species identified
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
Deep water redfish (A. echinites) Thorn trepang (A. japonicus) Thorn trepang (A. japonicus) Black sea cucumber American sea cucumber Red sea cucumber Latin American sea cucumber Black sea cucumber Bald sea cucumber Curryfish Thorn trepang Stonefish Tigerfish White teatfish Elephant trunkfish Curryfish Greenfish Prickly redfish Amberfish
H. leucospilota I. badionotus I. badionotus H. leucospilota H. leucospilota A. molpadioides H. mexicana A. caerulea H. scabra S. herrmanni A. japonicus A. lecanora B. argus H. fuscogilva H. fuscopunctata S. herrmanni S. chloronotus T. ananas T. anax
enzymes generated the unique composite haplotype pattern for each species and allowed for the identification of all of the studied species. Remarkably, despite the low nucleotide variability detected in certain species, none of the single nucleotide polymorphic events detected in the specimens analyzed affected the restriction patterns. Moreover, the developed methodology was applied to 6 standard individuals of each sample, and changes in the expected restriction profiles were not detected, the high number of samples that were taken into account giving a high degree of reliability to the developed method. Therefore, PCR-RFLP represents a suitable technique to identify the sea cucumber species included in this work. 3.4. FINS methodology for species identification of commercial sea cucumbers It was considered that the restriction profiles generated in unstudied species may coincide with those obtained in the studied species. Accordingly, an alternative method that called FINS was applied. FINS technique was described by Barlett and Davidson (1992), who proposed the genetic identification of species using phylogenetic analysis. A ca. 530 bp long sequence of 16S rRNA gene fragments (cropped of primer sequence) were aligned for genetic distances, and Neighbor-joining phylogenetic tree based on genetic distances was constructed, showing that samples belonging to the same species were grouped into the same clade, allowing for the differentiation of all of the species included in the present study (Fig. 3). All of the branches at the level of species have bootstrap values higher than 90. The result reflected the robust support of the assignation. And the result was accord with the specific assignations by means of PCR-RFLP technique in all cases. 3.5. Market study of sea cucumber species in commercial food products The PCR-RFLP and FINS methods developed were applied to 19 commercial products from the markets. All of the products analyzed were identified as some species of those included in this work. Three analyzed products detected a different species of those declared on the label (16%) and six of them were ambiguously labeled (32%), meaning 48% of the products were incorrectly labeled (Fig. 3 and Table 3). It was observed that the percentage of incorrect labeling was different depending on the commercial value
of the species, especially the species A. japonicus, which with high commercial value corresponding to high price. Another reason for substitution may be overexploiting, a multitude of sea cucumber species are being exploited worldwide, with new species being placed on the market whilst valuable species become scarcer and more difficult to find (FAO, 2008, pp. 1e317). Of those ambiguous labeling cases, in which the food product exhibited non-specific labeling, highlighted the fact that a considerable lack of information is currently associated with the commercialization of the sea cucumbers. The reason would be the lack of confidence in the phenotypic differentiation based on external features, or difficulty in identifying multispecies fished together on the basis of the morphological characters. At this point, the molecular methods evaluated in this work revealed as valuable tools to overcome this problem. In conclusion, PCR-RFLP and FINS methods developed in this study allow the genetic identification of commercial sea cucumber species in fresh, frozen and dried forms, and allow us to evaluate the labeling situation of these products in the market. The developed tools can be very useful in the normative control of processed products produced from sea cucumber, particularly in the authenticity of imported species, the correct labeling, the protection of the consumer's rights, the sustainment of ecological, social and economic benefits of these resources, and also for fisheries control of endangered species to conserve stocks biodiversity.
Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31201999, 31701688), the Natural Science Foundation of Guangdong Province (No. 2014A030307022), the China Spark Program (No. 2012GA780008), the Special Support Program of Guangdong Province (No. 2014TQ01N621), the Foundation for Distinguished Young Teachers in Higher Education of Guangdong (No. Yq2014115), the Foundation of Education Bureau of Guangdong Province (No. 2014KTSCX159), the Technology Program of Guangdong Province (Nos. 2017A040405060, 2015A030302089), the Technology Program of Zhanjiang (Nos. 2015A03017, 2016A03023), the Guangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Qassim University (No. 2017KB05) and the Program of Lingnan Normal University (No. YL1405).
L. Zeng et al. / Food Control 90 (2018) 166e171
References Arndt, A., Marquez, C., Lambert, P., & Smith, M. J. (1996). Molecular phylogeny of eastern Pacific sea cucumbers (Echinodermata: Holothuroidea) based on mitochondrial DNA sequence. Molecular Phylogenetics and Evolution, 6, 425e437. Barlett, S. E., & Davidson, W. S. (1992). FINS (forensically informative nucleotide sequencing): A procedure for identifying the animal origin of biological specimens. Biotechniques, 12, 408e411. Bellagamba, F., Moretti, V. M., Comincini, S., & Valfre, F. (2001). Identification of species in animal feedstuffs by polymerase chain reaction-restriction fragment length polymorphism analysis of mitochondrial DNA. Journal of Agricultural and Food Chemistry, 39, 3775e3781. Besbes, N., Fattouch, S., & Sadok, S. (2012). Differential detection of small pelagic fish in Tunisian canned products by PCR-RFLP: An efficient tool to control the label information. Food Control, 25, 260e264. Bruckner, A. W. (2005). The recent status of sea cucumber fisheries in the continental United States of America. SPC BechedeMer Information Bulletin, 22, 39e46. Chen, C. H., Hsieh, C. H., & Hwang, D. F. (2012). Species identification of Cyprinidae fish in Taiwan by FINS and PCR-RFLP analysis. Food Control, 28, 240e245. Chen, S., Zhang, Y., Li, H., Wang, J., Chen, W., Zhou, Y., et al. (2014). Differentiation of fish species in Taiwan Strait by PCR-RFLP and lab-on-a-chip system. Food Control, 44, 26e34. Espineira, M., Gonzalez-L, N., Vieites, J. M., & Santaclara, F. J. (2008). Authentication of anglerfish species (Lophius spp) by means of polymerase chain ReactionRestriction fragment length polymorphism (PCRRFLP) and forensically informative nucleotide sequencing (FINS) methodologies. Journal of Agricultural and Food Chemistry, 55, 10594e10599. FAO. (2004). Advances in sea cucumber aquaculture and management. FAO Fisheries and Aquaculture Technical Paper, No. 463, Rome. FAO. (2008). Sea cucumbers: A global review of fisheries and trade. FAO Fisheries and Aquaculture Technical Paper, No. 516, Rome. Felsenstein, J. (2004). PHYLIP (phylogeny inference package) version 3.6b. Distributed by the author. Seattle: Department of Genome Sciences, University of Washington. Fernandez-T, J., Longa, A., GarcIa-G, J., Chiu, Y., Huang, Y., Mendez, J., et al. (2011). Alternative PCReRFLP methods for mussel Mytilus species identification. European Food Research and Technology, 233, 791e796. Fernndez, T. J., & Mendez, J. (2007). Identification of the razor clam species Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus Using PCRRFLP Analysis of the 5SrrDNA Region. Journal of Agricultural and Food Chemistry, 55, 7278e7282. Ferrito, V., Bertolino, V., & Pappalardo, A. M. (2016). White fish authentication by COIBar-RFLP: Toward a common strategy for the rapid identification of species in convenience seafood. Food Control, 70, 130e137. Freire, R., Fernandez-T, J., & Mendez, J. (2008). Identification of razor clams Ensis arcuatus and Ensis siliqua by PCReRFLP analysis of ITS1 region. Fisheries Science, 74, 511e515. Kerr, A. M., Janies, D. A., Clouse, R. M., Samyn, Y., Kuszak, J., & Kim, J. (2005). Molecular phylogeny of coral-Reef sea cucumbers (Holothuriidae: Aspidochirotida) based on 16S mitochondrial ribosomal DNA sequence. Marine Biotechnology, 7, 53e60. Kimura, M. A. (1980). Simple method for estimating rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111e120. Liao, Y. (1997). Fauna Sincia: Phylum Echinodermata class Holothuroidea. Beijing:
171
Science Press. Lo, T. H. (2005). Valuation of sea cucumber attributes through laddering. SPC BechedeMer Information Bulletin, 20, 34e37. Massin, C. (1999). Reef-dwelling Holothuroidea (Echinodermata) of the Spermonde archipelago (South-West Sulawesi, Indonesia). Zoologische verhandelingen, 329, 1e144. Mueller, S., Handy, S. M., Deeds, J. R., George, G. O., Broadhead, W. J., Pugh, S. E., et al. (2015). Development of a COX1 based PCR-RFLP method for fish species identification. Food Control, 55, 39e42. Page, R. D. M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences, 12, 357e358. Pappalardo, A. M., & Ferrito, V. (2015). A COIBar-RFLP strategy for the rapid detection of Engraulis encrasicolus in processed anchovy products. Food Control, 57, 385e392. Pascoal, A., Barros-V, J., & Cepeda, A. (2008). Survey of the authenticity of prawn and shrimp species in commercial food products by PCR-RFLP analysis of a 16S rRNA/tRNAVal mitochondrial region. Food Chemistry, 109, 638e646. Pascoal, A., Barros-V, J., Cepeda, A., Gallardo, J. M., & Calo-M, P. (2008a). A polymerase chain reaction-restriction fragment length polymorphism method based on the analysis of a 16S rRNA/tRNAVal mitochondrial region for species identification of commercial penaeid shrimps (Crustacea: Decapoda: Penaeoidea) of food interest. Electrophoresis, 29, 499e509. Pascoal, A., Barros-V, J., Cepeda, A., Gallardo, J. M., & Calo-M, P. (2008b). Identification of shrimp species in raw and processed food products by means of a polymerase chain reaction-restriction fragment length polymorphism method targeted to cytochrome b mitochondrial sequences. Electrophoresis, 29, 3220e3228. Pascoal, A., Barros-V, J., Ortea, I., Cepeda, A., Gallardo, J. M., & Calo-M, P. (2011). Molecular identification of the black tiger shrimp (Penaeus monodon), the white leg shrimp (Litopenaeus vannamei) and the Indian white shrimp (Fenneropenaeus indicus) by PCR targeted to the 16S rRNA mtDNA. Food Chemistry, 125, 1457e1461. Pascoal, A., Ortea, I., Gallardo, J. M., Canas, B., Barros-V, J., & Calo-M, P. (2012). Species identification of the Northern shrimp (Pandalus borealis) by polymerase chain reaction-restriction fragment length polymorphism and proteomic analysis. Analytical Biochemistry, 421, 56e67. Peres, B., Barlet, N., Loiseau, G., & Montet, D. (2007). Review of the current methods of analytical traceability allowing determination of the origin of foodstuffs. Food Control, 18, 228e235. Perez, M., & Presa, P. (2008). Validation of a tRNAGlucytochrome b Key for the molecular identification of 12 Hake species (Merluccius spp.) and Atlantic cod (Gadus morhua) using PCRRFLPs, FINS, and BLAST. Journal of Agricultural and Food Chemistry, 56, 10865e10871. Perez, M., Vieites, J. M., & Presa, P. (2005). ITS1-rDNA-Based methodology to identify world-wide Hake species of the genus Merluccius. Journal of Agricultural and Food Chemistry, 53, 5239e5247. Rea, S., Storani, G., Mascaro, N., Stocchi, R., & Loschi, A. R. (2009). Species identification in anchovy pastes from the market by PCRRFLP technique. Food Control, 20, 515e520. Sumathi, G., Jeyasekaran, G., Shakila, R. J., Sivaraman, B., Arunkumar, G., Manimaran, U., et al. (2015). Molecular identification of grouper species using PCR-RFLP technique. Food Control, 51, 300e306. Wen, J., & Hu, C. (2010). Elemental composition of commercial sea cucumbers (holothurians). Food Additives and Contaminants: Part B, 3, 246e252. Wen, J., Hu, C., & Fan, S. (2010). Chemical composition and nutritional quality of sea cucumbers. Journal of the Science of Food and Agriculture, 90, 2469e2474.