Identification of transfer RNA suppressors in Escherichia coli

.I. Nol. Iliol. (1984) 177, 627-644

Identification

of Transfer

RNA

Suppressors

in

Escherichia coli IV?. Amber Suppressor

Su+6 a Double Mutant Leucine tRNA

MASAMI YOSHIMURA,

of a New Species of

HACHIRO INOKUCHI AND HARUO OZEKI

Department of Biophysics, Faculty of Science Kyoto liniversity, Kyoto 606. Japan, (Received 3 January 1984, and in revised form 6 April

1984)

-4n Escherichia coli DK’A fragment containing an Su+6 amber suppressor gene (supf’) was cloned into a lgtlCh vector by the shotgun method, selecting a Su+6 transducing phage ipSu+B. Through prophage integration followed by induction occurring at the transducing region of the IpSu+B in Sum E. coli. a counterpart transducing phage carrying the wild-type allele (Su”6) was isolated (lpSu”6). The fingeprint, of a tRKA encoded by IpSu”6 was identical to that of an unidentified tR&AE previously reported (Ikemura & Ozeki, 1977). The cloverleaf structure of this tRKA was determined by combining the results of tRPu’A analysis and DiT’A sequencing of the gene. Judging from the anticodon of 5’-CAA-3’, Su”6 tRNA was identified as a new type of leucine isoacceptor in E. coli. IJnlike other suppressors analyzed. Su+6 tRKA differed by two nucleotides from Su”6 tRNA; one at t’hr anticodon (CAA to CUA) and the other at t)he junction of D- and anticodon-stem (427 to G27). DPU’A sequence analysis revealed that a single stretch of tRriA is flanked bv the putative sequences of promoter and terminator. Thus a single copy of’ the Su’6 tRNA gene constitutes a solitary tRh’A transcription unit. Southern blotting showed only one copy of Su”6 tRSA gene per haploid penome of E. coli. Sinc+ethis single gene can mut’ate to the Su+6 suppressor, the S;‘S leucine tRXA may be accounted as a dispensable species among the leucine isoacceptor tRNAs. Two possible open reading frames are found immediately following the Su”6 t RXA gene.

1. Introduction Ku+6 (sqP) is one of the classical amber suppressors in Escherichia coli, which has been known to insert leucine at a UAG nonsense codon (Chan & Garen. 1969). Arnardbttir et nl. (1980) have mapped the 811~6 gene on t,he IS. coli chromosome at 95 minutes. By ribosomal binding experiments with fractionated leucyl tRSAs of E. co/i. it has been revealed that one of the t’wo fractions of ITI’G-binding leucyl tR?;As normally present in the wild-type strain is replaced by a UAG-binding t I’aper

III

in t,his srrirs

is Y’oshimura

el al. (1984). 627

628

M. YOSHIMURA,

H. INOKUCHI

AND

H. OZEKI

type in the Su+6 strain (Gopinathan & Garen, 1970). This result suggested that the mutation to Su+6 suppressor took place in one of the structural genes for leucine tRNA, and that the leucine tRNA gene product is not duplicated in sequence or modifications but that it is duplicated in function. The work presented here indicates that this gene is not duplicated in sequence elsewhere on the El:.coli chromosome. If this is the case, it is very different’ from other nonsense suppressors in E. coli, since the suppressor mutations so far analyzed, except Su+9, have been detected in one of the duplicated genes for essential tRNAs, resulting in the production of both wild-type and suppressor-type tRNAs in Suf bacteria (for a review, see Ozeki et aZ., 1980). In order to determine the gene structure and the mutation site(s) in Su+6, we have cloned the Su+6 suppressor gene and its wild-type allele (Su”6) in a ;1 vector, and analyzed the DNA sequences

of those genes as well as the tRNAs specified by them.

2. Materials

and Methods

(a) Bacterial and phage strains E. coli 2B6 (F - lac,&, trp,, str’ Su+6) was used as the source of the Su+6 gene. In this strain, which was kindly supplied by Dr A. Gysen, the Su+6 gene was transduced by phage Pl from the original Su+6 strain of A. Garen (Chan & Garen, 1969). E. coli CA274 (HfrC lac, trp,, Su-) was used as the Su- (Su”6) strain (Russell et aZ., 1970). E. coli CR63 was used as the host strain for the h mutant of 1 phage. E. coli NP29 (F- valS” (A)), used as the recipient strain for Pl transduction of vaZS+, was kindly supplied by Dr A. Kikuchi (Kikuchi et al., 1975). E. coli KS428 and DG508 (Blattner et al., 1978) were used for preparation of extracts for packaging of 1 DNA. lgtiCh was used as a cloning vector. The amber mutants of phage BF23 used here have been described by Okada et al. (1978). (b) Media M9 medium, M9 plate, A-broth, I-plate, EMB-plate used, all as described by Inokuchi et aZ. (1979).

and low phosphate

medium were

(r) Enzymes Phage T4 DNA ligase and phage T4 polynucleotide kinase were the products of Bethesda Research Laboratories, Inc. Bovine intestine alkaline phosphatase (Grade 1) was the product of Boehringer Mannheim Corp. Ribonuclease T, and pancreatic ribonuclease A were purchased from Sankyo Co., Tokyo. The following restriction endonucleases were used: AvaI was purchased from Bethesda Research Laboratories, Inc; HincII, HindIII, SmaI and XhoI were products of Takara Shuzo Co., Kyoto; EcoRI was purified from E. coli RY13 as described by Siimegi et al. (1977); HpaI and HpaII were purified from Haemophilus parainjhenzae as described by Sharp et al. (1973); HgaI was purified from Haemophilus gallinarum as described by Takanami (1973). (d) Cloning of E. coli DNA fragments in igtiCh High molecular weight DKA of E. coli 2B6 was prepared as described by Cosloy & Oishi (1973). Phage lysates of igtlCh and its DKA were prepared by standard procedures. The phage DNA and E. coli DNA were digested to completion with EcoRI. These DNAs were ligated by T4 ligase in the solution described by the enzyme manufacturer at 4°C for 12 h. Packaging of DNA in vitro was performed as described by Blattner et al. (1978) with the

AMBER

SUPPRESSOR

Su’6

(supP)

IN E. coli

629

following modifications: a sonicated extract of DG805 was used instead of purified protein A; a freeze-thaw lysate was not used. Transducing phages carrying Su+6 were selected as described in Results.

(e) PI transduction Pl transduction

was carried out with Plvir

as described by Ikeda & Tomizawa

(1965).

(f) Structural analysis of RNA and DNA

The methods used were as described in the accompanying paper (Yoshimura et al.. 1984).

3. Results (a) Isolation

of transducing

phuge 2 bearing gene Su+6

A sample (16 pg) of IgtKJh DNA and 6 ,ug of E. coli DNA were digested to completion with EcoRI and ligated with five units of T4 DNA ligase at 4°C for 12 hours. The ligated DNA was added to 1 ml of the in vitro packaging system described above. The sample was divided into ten portions and phages were propagated independently by confluent lysis to a titer of 10s plaque-forming units/ml. An excess of helper phage lcI857 was added to each lysate and CA274 (lac,, trp, Su-) was infected at a total multiplicity of infection of ten and plated. Trpf Lac+ colonies on M9 lactoase plates at 32°C were purified and screened for inducible phage. Six independent colonies were isolated (# 1 to #6). The transducing phage from each colony was purified as a colored plaque on a CA274 lawn on EMB lactose plates. We designated these phage strains IpSu+G,, to xB. DNAs prepared from these six strains were digested with EcoRI and electrophoresed in an agarose gel (Fig. 1). DNA of lpSu+6,,, ApSu+6,, and ApSu+6,, were cleaved to three fragments, two of which correspond to the left and right arms of 1 phage; the third accounted for the transducing fragment of bacterial origin. The transducing fragment was about 12 kbt long. In contrast, DNA of IpSu+6,,, ApSu+fix5 and ApSi1+6~~ showed unexpected electrophoretic patterns. These may be explained if a recombination took place between the transducing phage and the helper phage 1~1857 during phage growth. For instance, if a recombination shown in Figure 2(a) occurs, dpSu+G,, type of phage may be produced whose DNA shows the electrophoretic pattern of lane d in Figure 1. A further deletion that causes a loss of the EcoRI site at the 44.5% position of 2 DNA may yield the ipSu+6 #5 type of transducing phage (Fig. 1, lane g). Similarly, the electrophoretic pattern of the ApSu’6,, strain (Fig. 1, lane h) can be explained by assuming the two recombinations shown in Figure 2(b). Figure 3 shows the electrophoretic pattern of Hind111 digests of the DNA of ApSu+6,, and lpSu+G,,. The Hind111 digests of lpSu+6#, and ApSu+&,, ApSu+6,, showed identical patterns, differing from that of 1pSuf6#,. Among the fragments that were not detected in the Hind111 digests of J.gtJCh DNA, the t Abbreviations used: kb, 10’ bases or base-pairs; bp, base-pair

M. YOSHINURA,

630

a

b

a

H. INOKUCHI d

AND

H. OZEKI h

f

e

C f

t

12 IO 7.4 6.4

3.5

FIG. 1. E’coRI digests of 2pSu+6 DNA. lcIXB7S7 USA. IgtlCh DSA and IpSu+6-,-lpSu*6-, DNA were digested with EcoRI and electrophoresed on a 1% agarose gel. The DNA bands were visualized by staining with ethidium bromide. Lane a, 1~185787; lane b, IgtlCh; lane c: IpSu+6-,; lane d, IpSu+G 2; lane e, IpSu+6 :$:lane f. I~Hu+~ 4; lane g, I~Ru+~ r,; lane h, IpSuf6~+ The numbers are in kb.

fragments of 6.6 kb and 4.2 kb were common to those three strains. A 5.8 kb fragment was common to ,?pSu+G,, and LpSu+6,,. while in ipSu+6,, it was replaced by a 6.3 kb fragment. From the Hind111 patterns, it could be deduced that the transducing fragment in LpSu’G,, has an orientation different from that of ApSu+G,, and IpSu+6,,. We used LpSu+ci#, for further analysis, designating it %pSu+6.

(a) XpSu+G Xc1857

1 I

XpSu+6 3

\n/n5+

21

12

3.5

IO

(b) ninb+

hpSu+6 Ad857 XpSu+G 6

21

12

74

64

Fro. 2. Recombination between ipSu+6 and i.cIX57. (a) Recombination that produces lpSu’6 a. (b) Recombination that produces ~PSU+B-~. Vertical lines show EcoRI cleavage sites. Cross lines show possible recombination sites. Parentheses show the nin5 deletion. The numbers are in kb.

AMBER

SUPPRESSOR (I

b

C

Su+6

(supP)

d

e

ti31

IN E. coli

-6.8 ~6.3 ~5-8

FIG. 3. HindI digests of 1pSu+6 DXA. Phage DNAs were digested with Hind111 and electrophoresed on a lo/,, agarose gel. The DNA bands were visualized by staining with ethidium bromide. Lane a. LclX57S7; lane b, IgtlCh; lane c, IpSu+6 1: lane d, iOSu+R 2: lane e. ApSu+6 J. The numbers are in kb.

(b) Location of the cloned suppressor gene on the E. coli chromosome The Suf6 gene has been mapped near 95 minutes on the E. coli chromosome. Tt was confirmed by PI cotransduction of Su+6 with genes previously mapped near 95 minutes, such as valS, argl and pyrB (Arnardbttir et al., 1980). However, when E. coli NP29 (waES*”(A)) was infected with IpSu+G, no ValS+ colonies appeared at 42°C on 1 agar. Thus lpSu+6 does not seem to bear the valS+ gene. To confirm that the cloned fragment in IpSu+6 was derived from a region near 95 minutes, the following Pl transduction experiment was performed. Since 1pSu+6 lacks the att” site, prophage integration was expected to take place preferentially at the cloned region. If the cloned fragment is derived from a region near 95 minutes on the chromosome, cotransduction of prophage 611~6 with bact’erial valS+ may be expected when a lysogen of IpSu+6 was used as a donor strain. A PI phage lysate was prepared on CA274 (,?pSu+6) as a Pl donor at 32°C’. SP29 was infected with this lysate and incubated at 42°C. Temperature-resistant transductants (ValS+) were purified and the Su+6 suppressor activity was

TABLE 1 Frequency of cotransduction between Su+6 and valS

Donor 2B6 (:A274 (IpSu +6)

ValS + 80 71

Transductant Su+6 ValS+ 56BO 18171

Votransduction frequency (06) 70 25

632

M. YOSHIMURA,

H. INOKUCHI

AND

H. OZEKI

examined by plaque formation of amber mutants of phage BF23. As shown in Table 1, the Su’6 on IpSu+6 prophage was cotransduced with the host valS+. When CA274 (IlpSu+6) was used as a Pl donor, the cotransduction frequency was somewhat lower than when our original strain of Su’6 (E. coli 2B6) was used (Table 1). This may be due to the presence of neighboring il DNA. We conclude that the cloned fragment in IpSu+6 has been derived from the 95 minute region of the E. coli chromosome. (c) Isolation

of transducing phages carrying Su”6

As shown by Pl transduction, LpSu+G was integrated in the bacterial chromosome at the transducing region. Upon induction of such a lysogen, therefore, not only the 1pSu+6 but also the transducing phages carrying the Su”6 wild-type allele were expected to be formed by marker exchange. When CA274 (IpSu+G) was heat induced, two types of phages were produced that formed colored (Su+) and non-colored (Su-) plaques on EMB lactose plates with lac, indicator, at almost equal frequency. One of the non-colored plaques was purified and designated IpSu”6. (d) Transfer RNAs encoded by ;lpSu+G and ~pSu”6 Su+6 suppressor tRNA could be detected by analyzing tRNA(s) encded by 2pSu+6 and comparing them with tRNA(s) of IpSu”6. 32P-labeled tRNAs were prepared from cells infected with either lpSu+S or J.pSu”6. To reduce the synthesis of tRNAs encoded by the host chromosome, the cells were irradiated with ultraviolet light before infection. 32P-labeled tRNAs were separated by twodimensional polyacrylamide gel electrophoresis (Fig. 4). Two notable spots appear as different in the two patterns: one is indicated by a horizontal arrow in the tRNAs from IlpSu+6-induced cells and the other is indicated by a vertical arrow in the tRNAs from ilpSu”6-infected cells. Both tRNAs were eluted from gels and fingerprint analysis of them was carried out (Fig. 5). Two fingerprints were essentially identical to each other except for some spots, presumably reflecting the mutation in Su+6. We designate these tRNAs Su”6 tRNA and Su’6 tRNA. To reveal the difference between the two tRNAs, we analyzed the oligonucleotides of all the spots in the fingerprints and confirmed their composition or sequence. T, fingerprints show that Su+6 tRNA has an A-A-A-U oligonucleotide instead of cells. FIG. 4. Two-dimensional separation of sZP-labeled tRNA from IpSu+G and IpSuWinfected CA274 cells were irradiated for 2.5 min at a dose of 10 erg mm-* s-l with a germicidal lamp and infected with (a) LpSu+G and (b) IpSu”6 at a multiplicity of 50. The cells were diluted with low phosphate medium at time zero: 100 pg chloramphenicol/ml and [32P]orthophosphate were added at 20 min. RNA was extracted after 200 min with phenol and precipitated with ethanol from 0.2 Msodium acetate (pH 5). Electrophoresis in the 1st dimension on 12.50/, (w/v) polyacrylamide gel was from left to right, The gel part corresponding to tRNA was cut out and rerun on 20% (w/v) polyacrylamide gel. The electrophoresis in the 2nd dimension was from top to bottom. The arrows show the spots that correspond to Sue6 tRNA(t) and Su”6 tRNA (t). The illustration shows the spots in the 2-dimensional gel autoradiogram. The species of the tRNAs were identified by fingerprint analysis (data not shown).

AMBER

12.5 yA0

.

SUPPRESSOR

Su+6

(supP)

IS E. coli

(a)

633

(b)

OLeu I

0

0

0 0

0

Gly3

Val I

0

Glu 2

I I I I I I I I I I

0

I I

Leu I

0

0

Val I

0

0

Gly 3

Glu 2 o”

0 t

0

634

M. YOSHIMURA,

H. INOKUCHI

AND

H. OZEKI

(b)

(a)

Cd)

(c)

FIG. 5

AMBER

SUPPRESSOR

Su+6

(supP)

IN E. coli

tix

=\-*&A-A-U in Su”6 tRNA and that Su”6 tRNA has a CAG spot, which disappears in Ku+6 tRNA. Furthermore, pancreatic ribonuclease A fingerprints show that Su”6 tRNA has an AGU spot, which disappears in Su+6 tRNA. These result,s suggest that at least two single-base changes did occur in Su+6 tRNA. As is seen in Figures 4 and 5, both the amount and the G* modification of Su+6 tRNA were tnarkedly reduced compared to those of Su”6. Searching t’he published fingerprints of various tRh’As, we found that the T, tingvrprint, of Su”6 tRNA is identical to that of tRNAE previously reported as an unidentified t,RNA, which has been mapped near 95 minut’es on the E. coli (+romosome (Tkemura & Ozeki, 1977). Thus tRNAE is now identified as Sue6 t WA. (e) Two-dimlensional

gel electrophoresis

qf tRNAs

-from E. coli 2B6 (Su’6)

The spot of tRNAE (Su”6 tRNA) can be separated easily from other spots of E. ~oli tRNAs by two-dimensional polyacrylamide gel electrophoresis (Tkemura & Ozeki. 1977). 32P-labeled tRNAs of CA274 (Su”6) and 2B6 (Su+6) were prepared and subject’ed to two-dimensional polyacrylamide gel electrophoresis. Figure 6 shows the electrophoretic patterns obtained. The spot corresponding to Su”6 tRNA of CA274 is indicated by an arrow in Figure 6(b). So corresponding spot was det,ected in tRNAs from strain 2B6 (Fig. 6(a)). These result’s suggest that a single copy of the gene coding for Su”6 tRNA exists on the E. coli chromosome, and that it was mutated to the Su+6 suppressor. As is shown in Figure 4. the electrophoretic mobilit’y of Su+6 tRNA is quite different from that of Su”6 tRNA. However, no new spot for Su’6 tRh’A was detected in Figure 6(a). It may not be separable from other cellular tRNAs under the electrophoretir conditions used. (f) Localization

of &+6

gene in, the transducing

fragment

To localize the Su+6 gene in the transducing phage, LpSu+6 DNA was digested with various rest,riction endonucleases and Southern blotting experiments were carried out. 32P-labeled Su”6 tRNA was used as a probe. which was purified from (:A274 by two-dimensional polyacrylamide gel electrophoresis. The EcoRI transducing fragment in JpSu+G was about 12 kb. It was split into two fragments (6.3 kb and 58 kb) when digested with HpaI. The smaller fragment was hybridized by Su”6 tRNA (data not shown). When H~~LI digest)s of ipSu+B D?U’A

FIG. 6. Fingerprints of ribonuclease T, or pancreatic ribonurlease A digests of tRNAs. t+ctrophoresis in the 1st dimension on cellulose acetate in pyridine acetate containing 7 M-Urea (pH 3.5) was from right to left; in the second dimension, on DEAE-cellulose paper in 7*/, (v/v) formic acid. it was from top to bottom. (a) Ribonurlease T, digests of Sun6 tRNA; (b) ribonuclease T, digests ofSu’6 tRSA; (c) pancreatic ribonuclease A digests of Su”6 tRXA; (d) pancreatic ribonuclease A digests of 8u+6 tRSA. The sequences (hyphens omitted) of oligonucleotides shown beside the spots were derived from further analysis of those oligonucleotides and DNA sequence analysis. The modified nucleotides are not shown, except G*. which is not cut by T, ribonuclease. In (b) the oligonucleotides that differ from those in (a) are shown. In (d) the oligonucleotides that differ from those in (c) are d10w11.

636

M. YOSHIMURA,

H. INOKUCHI

AND

H. OZEKI

(a)

FIG. 6 Two-dimensional separation of 32P-labeled tRNA of Su+6 and Su”6 strains. The overnight culture of (a) 2B6 and (b) CA274 were diluted 50 times in low phosphate medium containing [32P]orthophosphate. After 3 h, RNA was extracted with phenol and precipitated with ethanol from 0.2 M sodium acetate (pH 5). Electrophoresis in the 1st dimension on 10% (w/v) polyacrylamide gel was (a) from right to left for 286 and (b) from left to right for CA274. Electrophoresis in the 2nd dimension on 20% (w/v) was from top to bottom. The arrow shows the spot that corresponds to Su”6 tRNA (tRNAE).

were used in Southern blotting experiment, a fragment of about 13 kb was hybridized by Su”6 tRNA (Fig. 7). Comparing these results with the HpaI restriction map of I DNA (Daniels & Blattner, 1982), an HpaI site in the transducing fragment was determined. When the EcoRI 12 kb fragment was digested with HindIII, four fragments were produced, of 6.6 kb, 4.2 kb, 1.0 kb and 0.5 kb, and the 4.2 kb fragment was hybridized by Su”6 tRNA. When IpSu+6 DNA was digested with HindIII, fragments of 6.6 kb and 4.2 kb were produced, but fragments of 1-O kb and 0.5 kb could not be detected. Considering all the results together, including the result in Figure 3, three Hind111 sites were determined. Two SmaI sites in the EcoRI 12 kb fragment were determined by double digestion with Hind111 and Smal. For further localization of the Suf6 gene, the Hind111 4.2 kb fragment was prepared. XhoI, AvaI and AccI sites were mapped in this fragment by double digestion. The AvaI 1.1 kb fragment was hybridized by Su”6 tRNA (Fig. 8). All these sites are indicated in Figure 9. The same results were also obtained with ApSu”6 DNA in restriction mapping and Southern blotting experiments. When E. coli 2B6 DNA was digested with HindIII, a DNA band was produced that was hybridized by Su”6 tRNA and that has the same mobility as the Hind111 4.2 kb fragment produced from LpSu’6 DNA (Fig. 7). A similar result was obtained when AvaI was used (Fig. 8).

AMBER a

b

SUPPRESSOR C

6

Su’6 e

(au@) f

637

IN E. coli Q

h

-

13 12

c4.2

IGo. 7. Restriction endonuclease digests and Southern blot autoradiogram. IpSu+G DNA was digested with restriction endonuclease, electrophoresed on a 1% agarose gel and stained with ethidium bromide. The DNA fragments were transferred onto a nitrocellulose filter and hvbridized with s2Plabeled Su”6 tRNA. Lane a, EcoRI digests of IpSu+6 DNA; lane b, autoradiogram”of Southern blotted gel of lane a. Lane c, HpaI digests of IpSu+G DNA; lane d, autoradiogram of Southern blotted gel of lane c. Lane e, Hind111 digests of ,lpSu+G DNA; lane f, Hind111 digests of E. coli 2B6 DNA; lane g, autoradiogram of Southern blotted gel of lane e. Lane h, autoradiogram of Southern blotted gel of lane f. Arrows show the DNA fragments that hybridize to Su”6 tRNA, the numbers are in kb.

(g) DNA

sequence analysis

of Su’6

and Su”6 gene loci

In order to analyze the DNA sequence of the suppressor gene, the 4.2 kb Hind111 fragment of ApSu+G DNA was further digested with HgaI or HpaII. As is shown in Figure 8, Southern blotting revealed that an HgaI fragment of 450 bp and an HpaII fragment of 320 bp were hybridized by Su”6 tRNA. These two fragments were purified and labeled with [Y-~~P]ATP, followed by strand separation for DNA sequencing. In the DNA sequence determined, the Su+6 tRNA gene was identified as a stretch of nucleotide sequence that was consistent with fingerprint analysis of the oligonucleotides produced by ribonuclease T, or pancreatic ribonuclease A digestion of Su’ 6 tRNA. This tRNA was 85 nucleotides long including the S/-terminal CCA, which was encoded in the gene. The anticodon sequence was 5’-CUA-3’, which corresponds to the amber codon (UAG). We also sequenced the corresponding fragments of IpSu”6 DNA. The result was the same, except for two bases as marked in Figure 10. Two base substitutions were expected from the fingerprint analysis of tRNAs described above. Thus the two mutation sites in Su+6 tRNA were determined on the cloverleaf structure; one was at the junction between the D- and anticodon-stem, and the other in the anticodon (Fig. 11).

M. YOSHIMURA,

638

o

c

b

H. INOKUCHI d

e

AND

f

H. OZEKI h

D

-

wds

1100

+-450 S-320

FIG. 8. Restriction endonuclease digests of the Hind111 4.2 kb fragment and Southern blot autoradiogram. An Hind111 4.2 kb fragment that hybridizes to Su”6 tRNA was digested with restriction endonuclease, electrophoresed on a 2% agarose gel and stained with ethidium bromide. The DNA fragments were transfered onto a nitrocellulose filter and hybridized with 32P-labeled Su”6 tRNA. Lane a, HpaII digests of the Hind111 fragment; lane b, autoradiogram of Southern blotted gel of lane a. Lane c, HgaI digests of the Hind111 fragment; lane d, autoradiogram of Southern blotted gel of lane c. Lane e, AvaI digests of the Hind111 fragment; lane f, AvaI digests of E. co& 2B6 DNA; lane g, autoradiogram of Southern blotted gel of lane e. Lane h, autoradiogram of Southern blotted gel of lane f. Arrows show the DNA fragments that hybridize to Su”6 tRNA, the numbers are in base-pairs.

SSH

H

E b

H

P

I

/

-.

/

%x X v

/ H /

V

i I VA rr .

E

,

/

/%

/

/

C

I

J G AA I II

I

I

-.

\

S V‘

-_

I

\

\

A I

\ GA II

-c

\ ’

\

I.

12 kb

S VH 4

42kb

X $ I Ikb

*

e *

t

* .

FIG. 9. Restriction map of the EcoRI insert of IpSu+G. The following restriction endonuclease cleavage sites are shown: A, HpII; C, AccI; E, EcoRI; G, HgaI; H, HindIII; P, HpaI; S, SmaI; V, AvaI; X, XhoI. (a) EcoRI transducing fragment of 12 kb in IpSu+6. (b) Hind111 4.2 kb fragment in the above EcoRI fragment. (c) AvaI 1.1 kb fragment in the above Hind111 fragment. The 5’ termini or restriction fragments labeled with s2P are indicated by small dots, and arrows attached to them show the directions of sequencing.

AMBER

SUPPRESSOR

Su+6

(supI’)

639

IX E‘. coli

* GCAGTAATCEACCTGCACT;CAACATCTTETGGCCTCAGETCACC~~~A~C~TACTCAT~AACTTCCA~~TC~CC~CCC~CTTCTTTT~C~~CATA~CT CGTCATTAGGTG6ACGTGAAGTTGTAGAACACCGGAGTCGAGTGGCCCTA6CATGAGTATTTGAA66TCAAGCG6CGGGCGAAGAAAACGCC6T l

l

l

TTCA6T6CCEAA6TGGCGA;ATC66TAGIEGCAGTTSAT~CAAAATCAA~C~TA~AAAT~C~T~CCGGT;C6A6TCC66;E::E@GCACCAAAAGTATGT AAGTCAC66CTTCACCGCTTTAGCCATCTGCGTCAACTAA6TTTTAGTT6GCATCTTTAT6CACGGCCAAGCTCA66CC6 CGTGGTTTTCATACA pCCCGAAG”GGCGAAA”CGG”*GAcGcAG~“GA””cAA*A”c**ccG”AGA**“AcG~GccGG”“cGAG”ccGGcc”“cGGc*cc**s G ”

l

l

l

.

.

l

.

l

l

.

l

l

l

l

l

l

l

l

l

l

GA6C GCC AGCCAACGGATAAGCAATATTT TG TGfiTGGCGGTAVtATCTGCTTGTCC T CA ATGGTT TAAGTACTGCGTTTGCAH-?, CTCG~CGGAiTCGGTTGCCTATTCGTTATAA~~~A~~~AC~ACCACC~CCATAC~TA~AC~AACA~~~A~~T~TACCAA~ATTCAT~AC~~CAAAC~TCA rgAlaAlaLysProThrAspLysGluTyr .

l

l

l

.

.

l

l

l

l

CCGTTATGAG6GAAAGCAAAAAATGCT66CACTTGGGGTTTATCCT6AAATCACACTAGCGGATGCCA6A6TAC6TC6TGAC6A6GCGCGTAAGCT GGCAATACTCCCTTTCGTTTTTTACGACCGTGAACCCCAAATA6GACTTTA6TGTGATCGCCTACGGTCTCAT6CA6CACTGCTCCGCGCATTCGA

l

ATAAAAAtTEtTCT6AAGA;CACGCCCATEGTGTGCTAA;T~A~TTAAAA TATTTTTCACCAGACTTCTAGTGCGGGTAGCACACGATTTTTCA6AACTTCTATTAGAAAAACGTCGCGAACCAGCCTTGCATTATAGC6ACTCAA snLysLysTrpSerCluAspHisllaHisAl~SisArgV~lLeuLysSe~LeuGl~AspAs~LeuPheAlaAl~LeuGlyAl~AsnV~lIleSerLeuSer

FIG. 10. Nucleotide sequence of the AvaI 1.1 kb fragment. The nucleotide sequence of mature tRN.4 sequence is presented in italics. The 2 mutated bases in the Su+6 tRNA gene are shown under the tRNA sequence. The amino acids of 2 open reading frames are shown in italics. The arrows show a dyad symmetry. The Pribnow box sequence in the possible promoter region is enclosed in a box. Sequence hyphens have been omitted for clarity.

23

640

M. YOGHIMURA,

H. INOKlJCHI

AND

H. OZEKI

For further sequence analysis, the AvaI 1.1 kb fragment of IpSu”6 DNA (Fig. 8) was purified and labeled. This fragment was digested with AccT and sequenced. The result of sequencing is shown in Figure 10. We searched for tRNA-like structure in this DNA sequence of 1100 bp, but no other t,RKA gene was detected. Thus only one tRNA gene exists in the Ad fragment of 1.1 kb. There is a putative Pribnow box sequence (5’.T-A-T-A-A-T-C-3’) (Pribnow, 1975a,b) at a position 30 bp preceding the tRNA sequence, as marked in Figure 10. In addition, 16 bp upstream of the putative Pribnow box, there is an octanucleotide sequence (5’~G-C-T-T-G-C-A-T-3’) that is similar to the consensus -35 promoter sequence (Rosenberg & Court, 1979). There is an inverted repeat, 13 bp downstream of the tRNA gene: followed by a T cluster (Fig. 10). Two possible open reading frames are also shown in Figure 10, one corresponds to 67 amino acid residues and the other to 115 amino acid residues.

4. Discussion The results presented here describe the cloning and characterization of the Su+6 suppressor tRNA of the supP locus in E. coli. First of all, the Su+6 gene was shotgun cloned into the EcoRI site of the vector AgtlCh, and the resulting clones were selected for the suppressor-active transducing phages. Among the Su+6

/U .C

'G-C-d

c‘G

'U

!J' G

'A-ANA

G-C- C-G-G \ ! G C ‘C

/C-G-C\

'A-G-A

G&AXG

,u U 'C

6 ‘G, 'A -? lJ 'U-A 'A 'A 'G-A'

iJ il G 4

il

\ A'

'A 'A A'

v U FIG. 11. The cloverleaf structure of Su”6 tRNA. The modified nucleotides are not shown in the Figure. The arrows point to the substituted bases that are detected in Su+6 tRSA.

AMBER

SUPPRESSOR

Su+6

(supP)

IN E. coli

641

transducing phages obtained, one strain (#2) was chosen for study, in which it was confirmed that an EcoRI DNA fragment of bacteria containing the suppressor gene was simply integrated into the vector just as it is. Since this vector lacks the att’ site, prophage integration of lpSu+6, and in consequence its excision as well, takes place predominantly at the transducing region by Utilizing this property, a counterpart transducing homologous recombination. phage was isolated, through lysogenization and induction of the IlpSu+6 in an Su- host bacteria. IpSu”6 thus obtained carried the same transducing fragment, hut the Su+6 gene was replaced by its wild-type allele (Su”6). Although the Sustrain used in this marker replacement was not the parental strain itself from which the Su+6 suppressor mutant was originally isolated, the restriction map of the transducing fragment in ApSu”6 was identical with that in LpSu+6. Thus the allelic relationship between Su+6 and Su”6 genes we cloned was evident, not only by the isolation procedures used but also by their DNA homology. Taking the results of fingerprint analysis of tRNAs encoded by both apSu+6 and LpSu”6 on one hand, and that of DNA sequence analysis of their tRNA genes on the other, the supP locus was identified as a structural gene for a new type of Ieucine isoacceptor tRNA, judging from the anticodon of 5’.CAA-3’ in the wildtype Su”6 tRNA. This tRNA is different from four known leucine tRNAs of’ E. coli: i.e. tRNAke” (Dube et al., 1970; Black & &ill, 1971); tRNA4”” (Black & Soil, 1971); tRNA, Le” (Yamaizumi et al., 1980); and tRNAX (Nakajima et al.. 1981). During the course of this study, it was noticed that the fingerprint of Su”6 t RNA is identical with that of an unidentified tRNAE previously reported by lkemura & Ozeki (1977). Thus the tRNAE is now assigned as a leucine tRNA having a ZCAA-3’ anticodon. Figures 4 and 5 show that the cellular amount as well as the G* modification is reduced in Su+6 as compared to Su”6 tRNA. The mutations in Su+6 tRNA may reduce its production compared with that of Su”6 tRNA. possibly due to the incomplete processing, or they may cause Su’6 tRR;A to be less stable than Su”6 tRNA due to the structural change. Similarly, the mutations may cause inefficient interaction of Su’6 tRNA with G* modification system. The G* modification may also affect the stability of the tRNA molecules. The Su ‘6 gene has been mapped at 95 minutes by phage Pl cotransduction with the markers locating in this region of E. coli chromosome, such as valS (Arnardottir et al., 1980). Although our IpSu+G transducing phage does not carry the valS gene when it is integrated at the transducing region, the Su+6 of the prophage becomes cotransducible by Pl phage with the host valS gene. This indicates that the shotgun-cloned Su+6 gene was derived from the 95 minute region of the E. coli chromosome. On the other hand, the gene for tRNAE (now Su”6 tRNA) has been mapped independently, but at the same region, by an tntirrly different method using F’-factors (Ikemura & Ozeki, 1977). All thesr results are consistent with each other, allocating the Su”6 tR?IJA gene and its suppressor allele at 95 minutes (97 min, under ZeuX, in a recently revised map: f%achmann, 1983). Under these circumstances, previous descriptions may as well be reconsidered, locating the Sut6 in the F’14 region covering the ilv genes (Sol1 &, Berg, 1969; Smith, 1972; Ozeki et al., 1980). DiRering from other nonsense-suppressor tRNAs so far analyzed (see Ozeki ~1

642

M. YOSHIMURA,H.INOKUCHI

al., 1980), Su+6 carried

AND H.OZEKI

two mutations, one in the anticodon (CAA to GUA) and the other at the junction between I>- and the anticodon-stem (A27 to G27: Fig. 11). Whether or not both of these two mutations are necessary to express the suppressor activity is not known. Since, however, our effort to isolate suppressoractive phage from LpSu”6 has been unsuccessful so far, under the conditions where amber or ochre suppressors are easily obtainable by single-base anticodon mutation in Su”2, Su”3 or Su”B, we are inclined to think that both of the mutations are needed in the case of Su+6. If this is so, it is puzzling how the original Suf6 was isolated. Several possibilities may be considered. (1) The parental strain (which was different from the Su- strain used in our study) already carried one of the mutations, such as G27. (2) One of the mutations (e.g. the anticodon mutation) occurred first, which showed weak but significant suppressor activity, and during the course of purification. selecting more evident Ls u + clones, the second mutation (e.g. G27) took place. which enhances the suppressor activity. (3) Heavy mutagenesis yielded a suppressor carrying t,wo mutations in one step. We prefer to consider the second case t,o be more likely. but others are equally possible. In the case of Suf9, a single-base mutation (A to G at position 24) in the D-stem of tryptophan tRNA is enough to express CGA suppression activity without anticodon mutation (Hirsh. 1971). This suggests that, in some tRNA at least, the structure of the Dstem region somehow affects its codon recognition. Tn the case of Su’6, therefore. it is conceivable that both of the mutations detected could collaborate together to express an appreciable act’ivity for amber suppression. Tf this is the case, Suf6 may be the first instance of a nonsense suppressor that requires an additional mut’ation besides the ordinary anticodon alteration. The Su+6 suppressor also differs from other instances of nonsense suppressors in E. coli in the following respect. Hitherto, in all the cases analyzed, suppressor mutations have been detected in one of the duplicat’ed tRNA genes, leaving the remaining ones intact in order to perform their normal function (see Ozeki ef al., 1980). In contrast, in the Su+6 strain. the wild-type Su”6 tRK’A became undetectable (Fig. 6). This observation is consistent with a previous report that one of the two column fractions of UUG-binding leucine tRNAs in the Su- strain was t’otally converted to a FAG-binding one in the Su’6 strain (Gopinat’han & Garen, 1970). Southern blotting experiments (Figs 7 and 8) reveal that only one copy of this tRNA gene does exist, in E. coli. Nevertheless, it is capable of converting to the Su+6 type. All these results indicate that t’he Su”6 leucine tRNA appears to be dispensable in E. coli. Tn the Su+6 strain, the IJUG codon corresponding to the Su”6 may be read by another leucine tRNA carrying a modified adenosine in the “wobble” posit,ion of its anticodon 5’-NAA-3’ reported by Yamaizumi et a2. (1980). In the case of tRNA *Ip , there is a single copy of its gene on the E. coli chromosome and it mutates to UGA suppressor (Su+9: Hirsh, retains the activity of tryptophan codon 1971). But t’his mutant tRNATrp recognit,ion. DNA sequence analysis reveals that only one tR1LA gene does exist within an as either Su”6 or AvaT fragment (approx. 1100 bp, Fig. lo), which was identified Su+6 gene, and no other possible stretch for tRNA cloverleaf structure. There is a

AMSER

SUPPRESSOR

Su’6

(supP) IN E. co/i

ti43

typical consensus sequence for promoter at 28 bp upstream of the tRNA gene; namely. 5’-G-C-T-T-G-C-A-T-( 16 bp)-T-A-T-A-A-T-C-3’ (a putative Pribnow box is marked in Fig. 10). In contrast, the sequence of stringency controlling region following the promoter is somewhat different from the consensus G +C-rich ’ ’ C-N-C-C-3’ (T ravers, 1980); namely, sequence of :5’-(1-(:-(:,

5’.C-A-C-A-A-C-G-3’.

This might be related to the dispensable feature of Su”6 leucine tRNA in E. coli. as its production may not be necessarily controlled stringently. Downstream of the tRNA gene, there is an inverted repeat (arrows in Fig. 10) followed by T-clust,er. which may be a rho-independent terminator. In E. coli. the tR?;A genes tend to exist in clusters of several genes for homologous or heterologous species of tR?;As forming one transcription unit (see Ozeki, 1980). Some tRXA genes are associat’ed with other genes for rRNAs (see Morgan et ccl., 1980) or proteins (Hudson et al.. 1981: Miyajima et al.. 1981), forming composite operons. In the present case, DNA sequence analysis reveals that a single Su”6 tRZI’A gene seems to comprise a transcription unit. There are two possible open reading frames downstream of the Su”6 tRNA gene, which are indicated by their amino acid sequences in Figure 10. Putative ribosome binding sites (Shine & Dalgarno. 1974) are present upstream of the AL’G of each open reading frame, but no promoter-like sequence is found further upstream of them, except that for the tRSA gene. Accordingly. if those> open reading frames are real genes, thei must’ be transcribed toget’her with thf> tRXA. Since a putat’ivr t’erminator exists between the tRNA gene and the first open reading frame, only the R?I;A transcripts read through this point may serve as mRNA for these frames. If this is the case, the Su”6 tRXA gene could btl expressed not only as a solitary tRSA transcription unit, but also as a tRSAprottlin composit,e operon. Recently, two comparable cases were found: one in the ttud operon (Ishii et a.Z., 1984) and the other in the divE operon (Tamura ef al.. 1984) in E. cobi, each of which contains a single gene copy for tRNA, for an initi&or methionine tRNA and for a serine tRNA, respectively. In both cases, t,hr operon starts with the tRNA gene, being followed by protein gene(s). A possible t)erminator structure of inverted repeats with a T-cluster does exist between the t,R#SA gene and the first protein gene. It would be very interesting if those tRSA genes turn out’ t.o be somehow involved in the attenuated regulation of this tyIJc' of composite operon. Wr are grateful t’o Dr Toshiro Shimura for his critical reading of the manuscript. This work was support’ed by a Grant-in-Aid for Special Project R’ewarch from the Minist,ry of’ lCducation. S&nce and Culture of Japan. REFERESCES .jrnardGt,tir. A.. Thorbjamardhttir. S. & Eggertson, G. (1980). .I. Hactrriol. 141. 977--!)iX. Bachmann. K. ?J. (1983). Microbial. Rev. 47. 180--230. 8lack. H. I’. & Ml. Il. (1971). Biochem. Biophy,s. Ras. C’ommun. 43, 1192-l 197. I~lattner. F. It.. Rlrchl. A. E.. Denniston-Thompson. K.. Faber. H. E., Richards, .J. E.. Slightom. .J. I,.. Tucker, P. W. & Smithes, 0. (1978). Scienw, 202. 1279-1284. (‘ban. T. & (iawn, A. (1969). J. Mol. Riol. 45, 545-548. (‘osloy. S. I). & O&hi. M. (1973). Mol. Gun. &net. 124. l-10.

644

M. YOSHIMURA,

H. INOKUCHI

AND

H. OZEKI

Daniels, D. L. & Blattner, F. R. (1982). Virology, 117, 81-92. Dube, S. K. Marcker, K. A. & Yudelevich, A. (1970). FEBS Letter.9, 9, 168-170. Gopinathan, K. P. & Garen, A. (1970). J. Mol. Biol. 47, 393-401. Hirsh, D. (1971). J. Mol. Biol. 58, 439-458. Hudson, I,., Rossi, J. & Landy, A. (1981). Nature (London), 294, 422-427. Ikeda, H. & Tomizawa, J. (1965). J. Mol. Biol. 14, 85-109. Tkemura, T. & Ozeki, H. (1977). J. Mol. Biol. 117, 419-446. Inokuchi, H., Yamao, F., Sakano, H. & Ozeki, H. (1979). J. Mol. Biol. 132, 649-662. Ishii, S., Kuroki, K. & Imamoto, F. (1984). Proc. Nut. Acad. Sci., U.S.A. 81, 409-413. Kikuchi, A., Elseviers, D. & Gorini, L. (1975). J. Bacterial. 122, 727-742. Miyajima, A., Shibuya, M., Kuchino, Y. & Kaziro, Y. (1981). Mol. Gen. Genet. 183, 13-19. Morgan, E. A., Ikemura, T., Post, L. E. & Nomura, M. (1980). In Transfer RNA: Biological Aspects (&ill, D., Abelson, J. & Shimmel, P., eds), pp. 259-266, Cold Spring Harbor Laboratory Press, New York. Nakajima, N., Ozeki, H. & Shimura, Y. (1981). Cell, 23, 239-249. Okada, K., Ohira, M. & Ozeki, H. (1978). Virology, 90, 133-141. Ozeki, H. (1980). In RNA-Polymerase, tRNA and Ribosomes: Their Genetics and Evolution (Osawa, S., Ozeki, H., Uchida, H. & Yura, T., eds), pp. 173-183, Tokyo University Press, Tokyo. Ozeki, H., Inokuchi, H., Yamao, F., Kodaira, M., Sakano, H., Ikemura, T. & Shimura, Y. (1980). In Transfer RNA: Biological Aspects (SSll, D., Abelson, J. & Shimmel, P., eds), pp. 341-362, Cold Spring Harbor Laboratory Press, New York. Pribnow, D. (1975a). Proc. Nut. Acad. Sci., U.S.A. 72, 784-788. Pribnow, D. (1975b). J. Mol. Biol. 99, 419-443. Rosenberg, M. & Court, D. (1979). Annu. Reti. Genet. 13, 319-353. Russell, R. L.. Abelson, J. N., Landy, A., Gefter, M. L., Brenner. S. & Smith, J. D. (1970). J. Mol. Biol. 47, 1-13. Sharp, P. A., Sugden, B. & Sambrook,
by S. Brenner