- Email: [email protected]
Immunolocalization of GnRHRI, gonadotropin receptors, PGR, and PGRMCI during follicular development in the rabbit ovary
Theriogenology 81 (2014) 1139–1147
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Immunolocalization of GnRHRI, gonadotropin receptors, PGR, and PGRMCI during follicular development in the rabbit ovary R.X. Lan a, F. Liu a, Z.B. He a, C. Chen a, S.J. Liu a, Y. Shi a, Y.L. Liu b, Y. Yoshimura c, M. Zhang a, *,1 a
College of Animal Science & Technology, Sichuan Agricultural University, Ya’an, Sichuan 625014, China Chengdu Research Base of Giant Panda Breeding, Chengdu 610081, China c Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima 739-8528, Japan b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 October 2013 Received in revised form 10 January 2014 Accepted 31 January 2014
The aim of this study was to investigate the presence and localization of gonadotropinreleasing hormone receptor-I (GnRHRI), gonadotropin receptors (FSHR, LHR), progesterone receptor (PGR), and progesterone receptor membrane-binding component-I (PGRMCI) in the different developmental stages of the rabbit follicle. The ovaries were collected from four healthy New Zealand white rabbits, and the mRNA expression and protein levels of GnRHRI, FSHR, LHR, PGR, and PGRMCI were examined with real-time PCR and immunohistochemistry. The results showed that GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA was expressed in the ovary; furthermore, we show cell-type specific and follicular development stage-specific expression of these receptors at the protein level. Specifically, all of the receptors were detected in the oocytes from the primordial to the tertiary follicles and in the granulosa and theca cells from the secondary and tertiary follicles. In the mature follicles, all receptors were primarily localized in the granulosa and theca cells. In addition, LHR was also localized in the granulosa cells from the primordial and primary follicles. With follicular development, the expression level of all of the receptors, except GnRHRI, in the follicles showed a tendency to decrease because the area of the follicle increased sharply. The expression level of GnRHRI, FSHR, and PGR in the granulosa and theca cells showed an increasing trend with ongoing follicular development. Interestingly, the expression level of FSHR in the oocytes obviously decreased from the primary to the tertiary follicles, whereas LHR in the oocytes increased from the secondary to tertiary follicles. In conclusion, the expression of GnRHRI, the gonadotropin receptors, PGR, and PGRMCI decreased from the preantral follicles (primordial, primary, and secondary follicles) to the tertiary follicles. The expression of GnRHRI and LHR in the oocytes increased from the secondary to the tertiary follicles, whereas FSHR decreased from the primary to the tertiary follicles. The expression of GnRHRI and PGR in the granulosa and theca cells increased from the secondary to the mature follicles. These observations suggest that these receptors play roles in follicular development and participate in the regulation of follicular development. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: GnRHRI Gonadotropin receptors PGR PGRMCI Rabbit Follicular development
* Corresponding author. Tel.: 0086-835-2885345; fax: 0086-8352886080. E-mail address: [email protected] (M. Zhang). 1 Present address: College of Animal Science & Technology, Sichuan Agricultural University, No 46, Xinkang St., Ya’an, Sichuan Province, 625014, China. 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.01.043
1. Introduction Follicular development, ovulation, and luteinization are complex processes that are regulated by endocrine hormones
1140
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
such as the GnRH from the hypothalamus and the pituitary gonadotropins (FSH and LH) [1]. It is well known that GnRH is involved in the regulation of ovarian development through paracrine/autocrine pathways [2]. GnRH is released in a pulsatile manner and regulates the biosynthesis and secretion of gonadotropins from the pituitary [3]. In addition to the hypothalamus and pituitary gland, GnRH and its receptor (gonadotropin-releasing hormone receptor-I (GnRHRI)) have also been shown to be expressed in extra-pituitary tissues including the ovary [2]. Indeed, in the rabbit ovary, evidence has indicated that there are specific GnRHRI binding sites in oocytes, granulosa cells, thecal cells, ovarian surface epithelial cells, and in the CLs [4]. However, nothing is known about its expression in specific follicular cell types during development. The gonadotropins FSH and LH play essential roles in follicular growth and steroid function [5]. The development and maturation of the follicles are dependent on the successive actions of FSH and LH, which are mediated by their receptors FSHR and LHR, respectively [6]. The expression of the FSHR and LHR proteins in the rabbit CLs has been reported [4]. Similarly, the expression of FSHR was detected in granulosa cells [7,8], theca cells [7] and oocytes [9–11] in other species, and LHR mRNA was localized in the theca cells, large follicles, CLs, and the surface epithelial cells of the mouse ovary [12]. Moreover, the FSHR and LHR transcripts have been detected in neonatal mouse ovary from D3 to D15 [13] and in preimplantation embryos [11]. These observations suggest that gonadotropin receptors are expressed in the ovary very early during the formation of the gonads and in early folliculogenesis during the neonatal period. However, in the rabbit, the expression and location of FSHR and LHR in the ovarian follicles has not yet been described. The interaction of FSH and LH stimulates the production of sexual steroid hormones by their receptors, such as estradiol and progesterone (P4) [14]. Progesterone is a steroid hormone that is known to influence follicular growth, ovulation, and luteinization [15]. Progesterone also acts directly on granulosa cells to inhibit apoptosis [16]. It is generally accepted that the effects of P4 are mediated by its interaction with the genomic progesterone receptor (PGR). Progesterone receptor is a member of the nuclear receptor superfamily of transcription factors and consists mainly of two different isoforms, PGR-A and PGR-B, both encoded by a single gene by transcription from alternative promoters [17]. A study in the monkey ovary has indicated that the PGR was detected in the granulosa cells of the primordial and primary follicles [18], and a study in the human ovary has shown that the PGR was detected in the granulosa cells of the primordial, preantral, and antral follicles; in the theca cells of the preantral and antral follicles; and in the CLs [19]. However, studies in the rat [20,21] have conclusively demonstrated that the PGR is not expressed in the granulosa cells of the developing follicles and luteal cells. A recent study in the mouse has shown PGR localization in the theca and in the granulosa cells of the mature follicles as well as the CLs. There are conflicting results in different species on the expression of the PGR in the ovary; therefore, it is essential to examine the expression of the PGR in the rabbit ovary. Another protein that could mediate the action of P4 is progesterone receptor membrane component I (PGRMCI) [22]. PGRMCI was first isolated from the porcine liver [23]
and is a relatively small protein (28 kDa) that possesses a short N-terminal extracellular domain, a single transmembrane domain, and a cytoplasmic domain [24]. The finding that PGRMC1 participates in the action of P4 in the ovary is supported by the observations that PGRMCI has been detected in the mouse granulosa [25] and luteal cells [26,27] and in bovine [28], rat [22], and human oocytes [29]. Furthermore, an antibody to PGRMCI completely attenuates the anti-apoptotic action of P4 [22]. Although these studies provide strong evidence that PGRMCI mediates the action of P4 in the ovary, nothing is known about its location and expression in the specific follicular cell types during follicular development. However, to the best of our knowledge, information on the expression pattern of the reproductive hormone receptors in the developing follicles of the rabbit is still limited. Notably, reports that have examined whether PGRMCI is expressed in the rabbit follicle and changes in its expression profile during follicular development are scarce. The aim of this study was to investigate the spatiotemporal expression of GnRHRI, FSHR, LHR, PGR, and PGRMCI at the mRNA and protein levels during rabbit follicular development. 2. Materials and methods 2.1. Animals and tissue collection Four mature female New Zealand white rabbits (3.18 0.40 kg body weight and 5–6 months of age) were housed individually in cages under controlled light (12 hour light:12 hour darkness) and temperature (18 C–24 C) conditions and provided with free access to water and food. The protocols for animal use for these experiments were approved by the Institutional Animal Care and Use Committee of the Sichuan Agricultural University. After being treated with a suitable dose of an anesthetic (containing sodium pentobarbital and procaine), the left-side ovaries were carefully collected and rinsed with RNase-free PBS and then frozen at 80 C for total mRNA extraction; the right-side ovary was fixed in 4% formaldehyde (vol/vol) for 72 hours at room temperature and subsequently dehydrated through a graded ethanol series and then cleared with xylene and finally embedded in paraffin for histological and immunohistochemical examination. 2.2. Antibodies The primary antibodies were a goat polyclonal antihuman GnRHR (sc-8681), goat polyclonal anti-human FSHR (sc-7798), goat polyclonal anti-human LHR (sc26341), mouse monoclonal anti-human PR (sc-810), and mouse monoclonal anti-human PGRMCI (sc-271275), all of which were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). A biotin-conjugated universal goat/ mouse-IgG secondary antibody kit (SA2003) containing normal rabbit serum, a rabbit anti-goat/mouse secondary antibody, and a streptavidin–biotin complex (SABC) was used for the goat primary antibodies. A biotin-conjugated universal mouse-IgG secondary antibody kit (SA2001) containing normal goat serum, a goat anti-mouse secondary antibody, and the SABC was used for the primary
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
1141
from 65 C to 95 C with 0.5 C increments, during which the fluorescence data were collected to evaluate the specific amplification. The relative differences for a gene in the different groups were determined using the comparative OO cycle threshold ( CT) method [30]. The resulting values were converted to fold changes compared with the GAPDH OO OOCT signal by raising two to the CT power (2). To confirm the product’s specificity, each PCR product was analyzed by 1.5% agarose gel electrophoresis followed by sequencing to confirm that these were the correct DNA fragments.
antibodies from mouse. Both kits were purchased from Wuhan Boster (Wuhan, China). 2.3. Real-time PCR Total RNA was extracted from the ovaries with Trizol according to the manufacturer’s instructions (TaKaRa, Dalian, China). The collected supernatant (400 mL) was precipitated with 400 mL of isopropanol, followed by washing with precooled 75% ethanol. The precipitated total RNA samples were dried and then dissolved in 1 mL RNase-free dH2O. The amount and purity of the total RNA were quantified by measuring the optical density at 260 and 280 nm; the RNA integrity was checked by 1.5% agarose gel electrophoresis. The cDNA synthesis was performed using a PrimerScript RT reagent kit with gDNA Eraser (TaKaRa) according to the manufacturer’s instructions. First, the genomic DNA elimination reaction was performed. The 10-mL reaction solution contained 2 mL 5 gDNA Eraser Buffer, 1 mL gDNA Eraser,1 mg total RNA, and 4 mL RNase-free dH2O. The reaction proceeded at room temperature for 5 minutes. Then, 4 mL 5 PrimerScript buffer, 1 mL 5 PrimerScript RT enzyme mix, 1 mL RT primer mix, and 4 mL RNase-free dH2O were added to the solution. The reaction was performed in a programmable thermal controller PTC-100 (MJ Research Inc.) and incubated at 37 C for 15 minutes, followed by heat inactivation at 85 C for 5 seconds. Real-time PCR analysis for GnRHRI, FSHR, LHR, PGR, and PGRMCI expression in the ovary was performed using a CFX-96 (Bio-Rad). The 25-mL real-time PCR solution mixture contained 12.5 mL SYBR premix, 1 mL sense and antisense primers (stock concentration 10 mmol/L), 8.5 mL water, and 2 mL cDNA. The primers used are listed in Table 1. The rabbit GAPDH and PGR and the Homo sapiens PGRMCI mRNA sequences were obtained from the GenBank of the National Center for Biotechnology Information of the National Institutes of Health (http://www.ncbi.nlm.nih.gov/ cgi-bin/genbank). The specific primers were designed using Primer Premier 5.0 software, and the GnRHRI primer was as previously described [4]. The annealing temperature for each primer set is given in Table 1. The real-time PCR was performed with an initial incubation at 95 C for 30 seconds, followed by 40 cycles at 95 C for 5 seconds, and then annealing for 30 seconds; during this period, the real-time fluorescence data were collected. A melting-curve protocol was performed by repeating the 95 C heating for 10 seconds,
2.4. Histology Serial tissue sections were cut at 4 mm thickness and mounted on Fisherbrand Superfrost Plus Microscope Slides (Fisher Scientific, USA). The sections were deparaffinized, rehydrated, and rinsed in distilled water. Finally, they were stained with hematoxylin for 5 minutes and then eosin for 40 seconds, dehydrated, and mounted. For each ovary sample, we made five slides, and each slide had six tissue sections mounted on it. The diameter of the follicles and oocytes and the thickness of the zona pellucida (ZP) from the different developmental stages of the follicles were measured using a Nikon-90i microscope (Nikon, Japan) linked to a computerbased image analyzer (ACT-2U software; Nikon, Japan). The primordial, primary, secondary, tertiary, and mature follicles were defined according to a previous reference [31]. 2.5. Immunohistochemistry These sections were subjected to antigen retrieval at 120 C for 5 minutes in a citrate buffer solution (10 mmol/L, pH 6) after being deparaffinized and rehydrated. To block the endogenous peroxidase activity, the sections were dipped in 3% H2O2 (vol/vol) in methanol for 10 minutes and then incubated with the corresponding serum for 20 minutes. Subsequently, the sections were incubated with either a goat polyclonal anti-GNRHRI primary antibody, goat polyclonal anti-FSHR primary antibody, goat polyclonal anti-LHR primary antibody, mouse monoclonal antiPR primary antibody, or a mouse monoclonal anti-PGRMCI antibody at 4 C overnight. The primary antibodies were diluted 1:200 in PBS. These sections were then incubated with the corresponding secondary antibodies (diluted
Table 1 Primers used for real-time PCR. Gene name
Sequence (50 –30 )
Product length (bp)
Annealing temperature ( C)
Accession number
GAPDH
F: TGTTTGTGATGGGCGTGAA R: CCTCCACAATGCCGAAGT F: TGATCCACCTCA CAA ATG GA R: ATGAAGGACCCGTGTCAGAG F: GAGGAATGCCATTGA ACTGAGG R: AAGGTTGGAGAACACATCTG F: CTG GAG AAG ATG CAC AAT GG R: AATTAGCCTCTGAATGGACTC F: GCTGCCCCCGCTACCAAAGG R: TCCCCTGGGCAGCACCTTGT F: GCCCAACCTTTACTCCA R: TCGTCGTCGTCGCTGTC
150
57.4
NC-013676.1
191
61.3
AY781779
150
57
AY429104.1
118
57
S57793
108
61
NM-001082267
205
57
NC-013676.1
GnRHRI FSHR LHR PGR PGRMCI
1142
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
1:100 in PBS) and the SABC for 1 hour each at room temperature. The immunoreaction products were visualized using a 3,30 -diaminobenzidine (DAB) kit (Wuhan Boster, China). The sections were counterstained with hematoxylin, sequentially dehydrated and mounted. To confirm the specificity of the immunostaining, the primary antibody was replaced with PBS (Fig. 2A to E). The sections were examined under a light microscope (Olympus BX-51, Japan) with image analysis software (NIS Element, Nikon, Tokyo, Japan). The integrated optical density (IOD) of the positive immunostaining was analyzed in the area of interest (AOI), such as the follicle, oocyte, granulose, and theca cell layer, using Image-Pro plus software, and then the optical density (OD) was calculated as follows: OD ¼ IOD/AOI. Six tissue sections for each ovary from each animal were mounted on a slide, six different eyefields from each section were analyzed for the OD, and the ODs were averaged to obtain a mean optical density (mOD). The mOD value represents the expression density of the specific receptors. 2.6. Statistical analysis The mODs from the different developmental stages of the follicles were compared. The data were analyzed by one-way ANOVA. Duncan’s multiple comparison was used for the detection of significant differences using SAS 9.1 software. Pvalue <0.05 was considered to be a significant difference. 3. Results 3.1. Expression of GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA in the rabbit ovary The expression levels of GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA were detected in the rabbit ovary. Compared with GnRHRI, the expression level of LHR was the highest at approximately 348-fold, and PGRMCI, FSHR, and PGR were approximately 12-, 7-, and 4-fold, respectively (Fig. 1).
Fig. 1. GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA expression in the rabbit ovary. Values are presented as the mean SEM (n ¼ 4); all values were standardized to their respective GAPDH control values.
3.2. Histological measurements The diameters of the primordial, primary, secondary, and tertiary follicles; the diameters of the oocytes; and the thickness of the ZP were measured (Table 2). There were very few mature follicles. The diameters of the primordial, primary, secondary, and tertiary follicles were 42.26 0.21 mm, 59.76 0.77 mm, 177.12 4.50 mm, and 742.69 9.67 mm, respectively, and the oocyte diameters were 25.23 0.15 mm, 31.33 0.43 mm, 74.11 1.82 mm, and 104.87 3.68 mm, respectively. These results suggested that the diameter increase of the rabbit follicles mainly occurred at the secondary and tertiary follicle stages. A possible reason for this is that the rapid proliferation of the granulosa cells and the emergence and expansion of the follicular cavity occurred at this stage. However, the diameter increase of the oocytes occurred mainly at the tertiary follicle stage. The ZP thickness of the secondary and tertiary follicles was 3.88 0.05 mm and 7.85 0.27 mm, respectively. Meanwhile, the regression relationship between the follicle diameter (Y) and the oocyte diameter (X) was Y ¼ 0.5078X 1.3838 (R2 ¼ 0.8958), and the regression relationship between the follicle diameter (Y) and the thickness of the ZP (X) was Y ¼ 119.54X–271.96 (R2 ¼ 0.7876). 3.3. Immunostaining 3.3.1. GnRHRI The results indicated that immunoreactive GnRHRI was localized in the oocytes of the primordial and primary follicles (Fig. 2A1); the secondary (Fig. 2B1) and tertiary follicles (Fig. 2C1); and in the granulosa and theca cells of the secondary, tertiary, and mature follicles (Fig. 2B1 to D1); and the CLs (Fig. 2E1). The changes in the expression levels of GnRHRI with follicular development are shown in Figure 3A. Moreover, the density of GnRHRI had a decreasing trend with ongoing follicular development, but the expression level of GnRHRI in the oocyte, granulose, and theca had an increasing trend with ongoing follicular development. Specifically, the expression level of GnRHRI in the primordial follicles was significantly greater than in the secondary follicles (P < 0.05); the expression level of GnRHRI in the oocytes of the tertiary follicles was significantly greater than that of the secondary follicles (P < 0.05), and its density in the granulosa and theca cells of the mature follicles was significantly greater than in the secondary follicles (P < 0.05). 3.3.2. FSHR FSHR was detected at all stages of the follicles and corpus luteal cells. Specifically, the immunoreactive FSHR was localized in the oocytes of the primordial and primary follicles (Fig. 2A2), the secondary (Fig. 2B2) and tertiary follicles (Fig. 2C2), and in the granulosa and theca cells of the secondary, tertiary, and mature follicles (Fig. 2B2 to D2), and in the CL (Fig. 2E2). The expression pattern of FSHR was similar to GnRHRI, except in the oocytes. The expression level of FSHR in the oocytes showed an obvious decreasing trend with ongoing follicular development (Fig. 3B). Namely, the expression level of FSHR in the oocytes of the primary follicles was significantly greater than that of the
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
1143
Fig. 2. Immunostaining for GnRHRI, FSHR, LHR, PGR, and PGRMCI in the rabbit ovary. (A–E) The negative control, (A1–E1) immunostaining for GnRHRI, (A2–E2) immunostaining for FSHR, (A3–E3) immunostaining for LHR, (A4–E4) immunostaining for PGR, (A5–E5) immunostaining for PGRMCI, (A1–A5) primordial or primary follicle, (B1–B5) secondary follicle, (C1–C5) tertiary follicle, (D1–D5) mature follicle, (E1–E5) CL. Ep, epithelial; ETC, external theca cells; GC, granulosa cells; ITC, internal theca cells; Me, mesenchyme; O, oocyte; PF, primary follicles; PrF, primordial follicles; TC, theca cells; ZP, zona pellucida. Scale bars ¼ 50 mm.
tertiary follicles (P < 0.05), and the expression level of FSHR in the follicles had a significant decreasing trend with ongoing follicular development. The expression level of FSHR in the primordial follicles was significantly higher than that of the secondary and tertiary follicles (P < 0.01 and P < 0.05, respectively).
3.3.3. LHR Unlike the expression pattern of the immunoreactive GnRHRI and FSHR, the immunoreactive LHR was specifically detected in the granulosa of the primordial and primary follicles (Fig. 2A3, B3). LHR was detected in the oocytes from the primordial to tertiary follicles
Table 2 The diameter of the follicles and oocytes and the thickness of the zona pellucida. Development stages of follicles
n
Diameter of follicles (mm)
Diameter of oocytes (mm)
Thickness of ZP (mm)
Primordial follicles Primary follicles Secondary follicles Tertiary follicles
333 186 132 19
42.26 0.21 （30.79w57.52） 59.76 0.77 （40.00w96.56） 177.12 4.50 （98.50w513.06） 742.69 9.67 （698.04w881.27）
25.23 0.15 （17.21w38.37） 31.33 0.43 （20.44w54.03） 74.11 1.82 （36.78w129.50） 104.87 3.68 （94.09w165.65）
d d 3.88 0.05 （3.00w5.56） 7.85 0.27 （5.10w9.40）
1144
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
(Fig. 2A3 to C3), the granulosa and theca cells in the secondary, tertiary, and mature follicles (Fig. 2B3 to D3), and the CL (Fig. 2E3). Its expression pattern was similar to GnRHR. The changes in the expression level of LHR with follicular development are shown in Figure 3C. The expression level of LHR had an obvious decreasing trend with ongoing follicular development. Specifically, the expression level of LHR in the primordial and primary follicles was significantly greater than that of the secondary and tertiary follicles (P < 0.05 and P < 0.01, respectively). In the oocytes of the tertiary follicles, the expression level of LHR was extremely significantly greater than that of the secondary follicles. Similar to the changes in the expression level of FSHR in the granulosa and theca cells with follicular development, the expression level of LHR did not show a significant increase with ongoing follicular development. 3.3.4. PGR And PGRMCI Immunoreactive PGR (Fig. 2A4 to E4) and PGRMCI (Fig. 2A5 to E5) were detected in the different follicular developmental stages. The results showed that PGR and PGRMCI were localized in the oocytes of the primordial and primary follicles, the secondary and tertiary follicles, in the granulosa and theca cells of the secondary, tertiary, and mature follicles, and the CL. The changes in the expression level of PGR and PGRMCI with follicular development are shown in Figure 3D and E, respectively. The results show that the expression level of PGR and PGRMCI in the follicles had a decreasing trend with ongoing follicular development, whereas the expression level of PGR in the granulosa and theca cells had an increasing trend with follicular development. Specifically, the expression level of PGR in the primordial and primary follicles was significantly greater than that of the secondary follicles (P < 0.01 and P < 0.05, respectively). The expression level of PGR in the granulosa cells of the secondary follicles was significantly lower than that of the mature follicles (P < 0.01). In the theca cells of the secondary follicles, its density was also significantly lower than that in the tertiary and mature follicles (P < 0.05). The expression level of PGRMCI in the primordial and primary follicles was significantly greater than that of the secondary and tertiary follicles (P < 0.01 and P < 0.05, respectively), and the density in the secondary follicles was significantly greater than that of the tertiary follicles (P < 0.05). 4. Discussion The present study has demonstrated the following: (1) the growth of the follicle was closely correlated with the growth of the oocyte and the thickness of the ZP; (2) GnRHRI, FSHR, LHR, PGR, and PGRMCI were localized in the oocytes, granulose, and theca cells of the different developmental stages of the follicles; and (3) the expression
Fig. 3. Changes in the mOD of GnRHRI, FSHR, LHR, PGR, and PGRMCI with follicle development. (A) The mOD of GnRHRI, (B) the mOD of FSHR, (C) the mOD of LHR, (D) the mOD of PGR, and (E) the mOD of PGRMCI. MF, mature
follicles; PF, primary follicles; PrF, primordial follicles; SF, secondary follicles; TF, tertiary follicles. Statistical significance was compared in the same groups during follicle development. a,b,c;A,BValues with different letters are significantly different (P < 0.05 and P < 0.01, respectively).
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
level of GnRHRI in the oocytes, granulose, and theca cells; the expression level of LHR in the oocytes; and the expression level of PGR in the granulosa and theca cells were all increased, whereas the expression level of FSHR in the oocytes was decreased during follicular development. The follicular diameter results showed considerable overlap, which confirms that follicular development is a dynamic process. Meanwhile, the results suggested that the diameter increase of the rabbit follicles mainly occurred at the stage of the secondary and tertiary follicle, which is in agreement with previous reports that the small follicles grew more slowly than the larger follicles [32]. A possible reason was that the fast proliferation of the granulosa cells and the emergence and expansion of the follicular cavity occurred at these stages. A previous study reported that GnRHRI was located in the rabbit oocytes, granulosa cells, theca cells, ovarian surface epithelial cells, and CLs [4], and our study is consistent with those observations. However, in the rat ovary, GnRHRI mRNA was only detected in the granulosa cells from the primary to mature follicles, but not in the oocytes and theca cells [33,34]. However, in the human ovary, no significant immunoreactive GnRHRI was detected in the follicles from the primordial to the early antral stages, and GnRHRI was only expressed in the granulosa cells and internal theca cells in the mature follicles [35]. Interestingly, our study showed that in mature rabbit follicles, GnRHRI was expressed both in theca internal and external cells. Thus, it is likely that GnRHRI can be commonly expressed in the ovary in many mammals, although there are some minor differences in their expression profiles. In this study, the GnRHRI expression level in the oocytes of the tertiary follicles was significantly higher than that of the secondary follicles, and in the granulosa and theca cells of the mature follicles, it was significantly greater than in the secondary follicles. This stage-specific change in its expression in rabbit follicular development suggests a possible interaction between GnRH and the gonadotropin system. Previous reports have shown that when treated with GnRH, a significant downregulation of FSHR and LHR was observed, suggesting that GnRH may have anti-gonadotropic effects [36]. The present study has shown that GnRHRI expression was increased in the oocytes, granulose, and theca cells during follicular development, while FSHR, but not LHR, expression was decreased in the oocytes, suggesting that GnRH and GnRHRI play an important role in follicular growth through regulating the expression of FSHR and LHR. FSHR and LHR were expressed in the oocytes, granulosa, theca cells, and CL in our study, which agrees with previous reports [4,7–10,12,37,38]. The thecal cells expressed LHR in the secondary follicles when it was initially differentiated, which triggered the biosynthesis of thecal androgens and was essential to stimulate the formation of FSHR in the granulosa cells, suggesting that an LH and LHR interaction may amplify the effects of FSH on follicular development [39]. However, both the FSHR and LHR expression levels did not change in the granulosa and theca cells at the different follicular stages, suggesting that in the rabbit, ovarian follicular gonadotropin receptors are not dynamically regulated during follicular development. Although both
1145
FSHR and LHR were detected in the primordial, primary, and secondary follicles, the growth of the preantral follicles is independent of circulating gonadotropins [40,41]. Mice deficient in the FSHb subunit [42] or in FSHR [42,43], as well as mice with natural mutations in GnRH, which results in a marked reduction in the synthesis of FSH and LH, have normal preantral follicle growth despite having defective antral follicles [44]. However, this is not to say that the initial development of the follicles is gonadotropin independent. When an FSH neutralizing antibody was injected into pregnant hamsters, the number of primordial follicles was reduced [45]. Additionally, follitropin receptor knockout (FORKO) mice contained fewer primordial follicles in comparison with wild-type animals [46]. All of these data suggest that FSH and FSHR are essential for the formation and recruitment of the primordial follicles into the growing pool. In this study, both FSHR and LHR were expressed in the oocytes, suggesting a potential role for FSH and LH in the modulation of the meiotic resumption and completion of oocyte maturation. The FSHR expression level in the oocytes in the primary follicles was significantly higher than that of the tertiary follicles, reaching a minimum at the tertiary follicles, while the expression level of LHR in the oocytes in the tertiary follicles was extremely significantly greater than that of the secondary follicles, reaching a peak at the tertiary follicle. These results indicate that the oocytes are highly responsive to the regulation of FSH during the earlier stage, but from development to maturation, the oocytes are likely more responsive to LH. To a certain extent, this finding suggests that the sensitivity of the oocytes to gonadotropins shifts from FSH to LH during the development of the follicles, which might be involved in the establishment of the follicular hierarchy in rabbits. Some previous studies have reported that PGRs were not expressed in the granulosa cells of the developing follicles and luteal cells of the rat [20,21]. In a recent study in the mouse, PGR localization was shown in the theca and granulosa cells of the mature follicles as well as in the CLs. However, a study in the monkey ovary has indicated that PGR was detected in the granulosa cells of the primordial and primary follicles [18], and a study in the human ovary has shown that PGR was detected in the granulosa cells of the primordial, preantral, and antral follicles; in the theca cells of the preantral and antral follicles; and in the CLs [19]. Our present study showed that the immunostaining for PGR was detected in the granulosa and theca cells of the primordial, primary, secondary, tertiary, and mature follicles; in the oocytes of the primordial, primary, secondary, and tertiary follicles; and in the CLs. Although species differences clearly exist, the reason may be that rabbits are reflex ovulators that regulate P4 function in a specific way. Meanwhile, this result supports the hypothesis that P4 and PGR play a role in the intra-ovarian regulation of follicle growth from the first step of follicular development, although the mechanism will require further elucidation. The present study showed that PGRMCI was expressed not only in the granulosa cells but also in the oocytes, thecal cells, luteal cells, and ovarian surface epithelial cells, supporting previous studies on rat and bovine [22,47]. Our study detected PGRMCI in the oocytes. PGRMCI has also been detected in bovine [28], rat [22], and human oocytes
1146
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
[29], thereby supporting the conclusion that PGRMCI is expressed in mammalian oocytes. In spite of its expression in oocytes, little is known about PGRMCI and oocyte function. Until recently, the expression of PGRMCI was detected in the mitotic spindle [48], suggesting that PGRMCI had a role in regulating oocyte maturation. It was known that P4 acts on amphibian and Xenopus laevis oocytes to induce oocyte maturation [49]. Unlike its action in amphibian and Xenopus laevis oocytes, P4 does not induce oocyte maturation in mammals. An in vivo study in the mouse showed that when adding progesterone, the number of follicles undergoing germinal vesicle breakdown decreased [50]. Because PGRMCI is expressed in mammalian oocytes, it may inhibit the resumption of meiosis. Therefore, the involvement of PGRMCI in regulating oocyte maturation remains to be examined. PGRMCI expression in the granulosa and theca cells during follicular development as well as in the CLs was detected. Treatment with an antibody to PGRMCI completely attenuates the anti-apoptotic action of P4 [22]. These results suggest the possibility that PGRMCI is involved in regulating the anti-apoptotic actions of P4 in granulosa, theca, and luteal cells. 4.1. Conclusions The present study reveals that GnRHRI, FSHR, LHR, PGR, and PGRMCI are expressed in the oocyte, granulose, and theca cells during follicular development as well as the CLs of the rabbit. The expression of GnRHRI in the oocyte, granulose, and theca cells increases during follicular development, suggesting the involvement of GnRHRI in follicular development. Although the growth of the preantral follicles is independent of circulating gonadotropins, the formation and recruitment of the primordial follicles are mainly dependent on FSH and FSHR. During follicular development, the expression of FSHR in the oocytes decreased, whereas the LHR expression increased, suggesting that the sensitivity of the oocytes to gonadotropins shifts from FSH to LH. PGR is expressed in all follicular stages, playing a role in the regulation of follicle growth from the first stage of follicular development. The expression of PGRMCI in the oocytes suggests that PGRMCI has a role in regulating oocyte maturation, and its expression in granulosa, theca, and luteal cells suggests the possibility that PGRMCI is involved in regulating the anti-apoptotic actions of P4 in granulosa, theca, and luteal cells. Acknowledgments This work was supported by the National Innovative Experiment Fund of Undergraduate for Liu F, the Fund of Research Activities for Overseas Scholars, and the “Doublesupport” Fund of Sichuan Agricultural University to Zhang M. References [1] Richards JS. Perspective: the ovarian follicleda perspective in 2001. Endocrinology 2001;142:2184–93. [2] Ramakrishnappa N, Rajamahendran R, Lin Y-M, Leung P. GnRH in non-hypothalamic reproductive tissues. Anim Reprod Sci 2005;88: 95–113.
[3] Perrin M, Bilezikjian L, Hoeger C, Donaldson C, Rivier J, Haas Y, et al. Molecular and functional characterization of GnRH receptors cloned from rat pituitary and a mouse pituitary tumor cell line. Biochem Biophys Res Commun 1993;191:1139–44. [4] Zerani M, Parillo F, Brecchia G, Guelfi G, Dall’Aglio C, Lilli L, et al. Expression of type I GNRH receptor and in vivo and in vitro GNRH-I effects in corpora lutea of pseudopregnant rabbits. J Endocrinol 2010;207:289–300. [5] Kakar SS, Musgrove LC, Devor DC, Sellers JC, Neill JD. Cloning, sequencing, and expression of human gonadotropin releasing hormone (GnRH) receptor. Biochem Biophys Res Commun 1992;189: 289–95. [6] Ni Y, Zhou Y, Lu L, Grossmann R, Zhao R. Developmental changes of FSH-R, LH-R, ER-b and GnRH-I expression in the ovary of prepubertal ducks (Anas platyrhynchos). Anim Reprod Sci 2007;100:318–28. [7] Li X, Zhang H, Sheng X, Li B, Zhou J, Xu M, et al. Immunoreactivities of androgen receptor, estrogen receptors, p450arom, p450c17 proteins in wild ground squirrels ovaries during the nonbreeding and breeding seasons. J Ovarian Res 2012;5:1–10. [8] Taru Sharma G, Dubey P, Sai Kumar G. Localization and expression of follicle-stimulating hormone receptor gene in buffalo (Bubalus bubalis) pre-antral follicles. Reprod Domest Anim 2011;46:114–20. [9] Méduri G, Charnaux N, Driancourt M-A, Combettes L, Granet P, Vannier B, et al. Follicle-stimulating hormone receptors in oocytes? J Clin Endocrinol Metab 2002;87:2266–76. [10] Patsoula E, Loutradis D, Drakakis P, Michalas L, Bletsa R, Michalas S. Messenger RNA expression for the follicle-stimulating hormone receptor and luteinizing hormone receptor in human oocytes and preimplantation-stage embryos. Fertil Steril 2003;79:1187–93. [11] Patsoula E, Loutradis D, Drakakis P, Kallianidis K, Bletsa R, Michalas S. Expression of mRNA for the LH and FSH receptors in mouse oocytes and preimplantation embryos. Reproduction 2001; 121:455–61. [12] Zheng M, Shi H, Segaloff DL, Van Voorhis BJ. Expression and localization of luteinizing hormone receptor in the female mouse reproductive tract. Biol Reprod 2001;64:179–87. [13] O’shaughnessy P, McLelland D, McBride M. Regulation of luteinizing hormone-receptor and follicle-stimulating hormone-receptor messenger ribonucleic acid levels during development in the neonatal mouse ovary. Biol Reprod 1997;57:602–8. [14] Ashley P, Frank L, Schmeitzel L, Bailey E, Oliver J. Effect of oral melatonin administration on sex hormone, prolactin, and thyroid hormone concentrations in adult dogs. J Am Vet Med Assoc 1999; 215:1111. [15] Peluso JJ. Multiplicity of progesterone’s actions and receptors in the mammalian ovary. Biol Reprod 2006;75:2–8. [16] Peluso JJ, Pappalardo A, Losel R, Wehling M. Expression and function of PAIRBP1 within gonadotropin-primed immature rat ovaries: PAIRBP1 regulation of granulosa and luteal cell viability. Biol Reprod 2005;73:261–70. [17] Conneely OM, Mulac-Jericevic B, DeMayo F, Lydon JP, O’Malley BW. Reproductive functions of progesterone receptors. Recent Prog Horm Res 2002;57:339–55. [18] Hild-Petito S, Stouffer RL, Brenner RM. Immunocytochemical localization of estradiol and progesterone receptors in the monkey ovary throughout the menstrual cycle. Endocrinology 1988;123:2896– 905. [19] Revelli A, Paahioni D, Cassoni P, Bussolati G, Massobrio M. In situ hybridization study of messenger RNA for estrogen receptor and immunohistochemical detection of estrogen and progesterone receptors in the human ovary. Gynecol Endocrinol 1996;10:177–86. [20] Park O-K, Mayo KE. Transient expression of progesterone receptor messenger RNA in ovarian granulosa cells after the preovulatory luteinizing hormone surge. Mol Endocrinol 1991;5:967–78. [21] Park-Sarge O, Parmer T, Gu Y, Gibori G. Does the rat corpus luteum express the progesterone receptor gene? Endocrinology 1995;136: 1537–43. [22] Peluso J, Pappalardo A, Losel R, Wehling M. Progesterone membrane receptor component 1 expression in the immature rat ovary and its role in mediating progesterone’s antiapoptotic action. Endocrinology 2006;147:3133–40. [23] Meyer C, Schmid R, Schmieding K, Falkenstein E, Wehling M. Characterization of high affinity progesterone-binding membrane proteins by an anti-peptide antiserum. Steroids 1998;63:111–6. [24] Cahill MA. Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 2007;105:16–36. [25] McRae R, Johnston H, Mihm M, O’Shaughnessy P. Changes in mouse granulosa cell gene expression during early luteinization. Endocrinology 2005;146:309–17.
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147 [26] Cai Z, Stocco C. Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 2005;146:5522–32. [27] Sasson R, Rimon E, Dantes A, Cohen T, Shinder V, Land-Bracha A, et al. Gonadotrophin-induced gene regulation in human granulosa cells obtained from IVF patients. Modulation of steroidogenic genes, cytoskeletal genes and genes coding for apoptotic signalling and protein kinases. Mol Hum Reprod 2004;10:299–311. [28] Dode MAN, Dufort I, Massicotte L, Sirard MA. Quantitative expression of candidate genes for developmental competence in bovine two-cell embryos. Mol Reprod Dev 2006;73:288–97. [29] Wood JR, Dumesic DA, Abbott DH, Strauss JF. Molecular abnormalities in oocytes from women with polycystic ovary syndrome revealed by microarray analysis. J Clin Endocrinol Metab 2007;92:705–13. [30] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCT method. Methods 2001;25:402–8. [31] Hafez ESE. Reproduction in farm animals. Philadelphia, USA: Lea & Febiger; 1987. [32] Lussier J, Matton P, Dufour J. Growth rates of follicles in the ovary of the cow. J Reprod Fertil 1987;81:301–7. [33] Whitelaw P, Eidne K, Sellar R, Smyth C, Hillier S. Gonadotropinreleasing hormone receptor messenger ribonucleic acid expression in rat ovary. Endocrinology 1995;136:172–9. [34] Kogo H, Fujimoto T, Park M, Mori T. Gonadotropin-releasing hormone receptor mRNA expression in the ovaries of neonatal and adult rats. Cells Tissues Organs 1999;164:14–22. [35] Choi J-H, Gilks CB, Auersperg N, Leung PC. Immunolocalization of gonadotropin-releasing hormone (GnRH)-I, GnRH-II, and type I GnRH receptor during follicular development in the human ovary. J Clin Endocrinol Metab 2006;91:4562–70. [36] Kang SK, Tai C-J, Nathwani PS, Leung PC. Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid in human granulosa-luteal cells. Endocrinology 2001;142:182–92. [37] Wei S, Gong Z, Dong J, Ouyang X, Wei M, Xie K, et al. Effect of a GnRH agonist on the FSH receptors in prepubertal ewes. Small Ruminant Res 2012;105:237–43. [38] Peluso J, Fernandez G, Pappalardo A, White B. Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 2001;65:94–101.
1147
[39] Van den Hurk R, Abir R, Telfer E, Bevers M. Primate and bovine immature oocytes and follicles as sources of fertilizable oocytes. Hum Reprod Update 2000;6:457–74. [40] Campbell B, Baird D, Souza C, Webb R. The FecB (Booroola) gene acts at the ovary: in vivo evidence. Reproduction 2003;126:101–11. [41] Webb R, Nicholas B, Gong J, Campbell B, Gutierrez C, Garverick H, et al. Mechanisms regulating follicular development and selection of the dominant follicle. Reprod Suppl 2003;61:71–90. [42] Kumar TR, Wang Y, Lu N, Matzuk MM. Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 1997;15:201–4. [43] Abel MH, Wootton AN, Wilkins V, Huhtaniemi I, Knight PG, Charlton HM. The effect of a null mutation in the follicle-stimulating hormone receptor gene on mouse reproduction. Endocrinology 2000;141:1795–803. [44] Cattanach B, Iddon CA, Charlton H, CHIAPPA SA, Fink G. Gonadotrophin-releasing hormone deficiency in a mutant mouse with hypogonadism. Nature 1977;269:338–40. [45] Roy SK, Albee L. Requirement for follicle-stimulating hormone action in the formation of primordial follicles during perinatal ovarian development in the hamster. Endocrinology 2000;141: 4449–56. [46] Balla A, Danilovich N, Yang Y, Sairam MR. Dynamics of ovarian development in the FORKO immature mouse: Structural and functional implications for ovarian reserve. Biol Reprod 2003;69:1281– 93. [47] Luciano A, Corbani D, Lodde V, Tessaro I, Franciosi F, Peluso J, et al. Expression of progesterone receptor membrane component-1 in bovine reproductive system during estrous cycle. Eur J Histochem 2011;55:145–50. [48] Nousiainen M, Silljé HH, Sauer G, Nigg EA, Körner R. Phosphoproteome analysis of the human mitotic spindle. Proc Natl Acad Sci U.S. A 2006;103:5391–6. [49] Bayaa M, Booth RA, Sheng Y, Liu XJ. The classical progesterone receptor mediates Xenopus oocyte maturation through a nongenomic mechanism. Proc Natl Acad Sci U.S.A 2000;97:12607–12. [50] Eppig J, Koide SL. Effects of progesterone and oestradiol-17b on the spontaneous meiotic maturation of mouse oocytes. J Reprod Fertil 1978;53:99–101.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Immunolocalization of GnRHRI, gonadotropin receptors, PGR, and PGRMCI during follicular development in the rabbit ovary R.X. Lan a, F. Liu a, Z.B. He a, C. Chen a, S.J. Liu a, Y. Shi a, Y.L. Liu b, Y. Yoshimura c, M. Zhang a, *,1 a
College of Animal Science & Technology, Sichuan Agricultural University, Ya’an, Sichuan 625014, China Chengdu Research Base of Giant Panda Breeding, Chengdu 610081, China c Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima 739-8528, Japan b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 October 2013 Received in revised form 10 January 2014 Accepted 31 January 2014
The aim of this study was to investigate the presence and localization of gonadotropinreleasing hormone receptor-I (GnRHRI), gonadotropin receptors (FSHR, LHR), progesterone receptor (PGR), and progesterone receptor membrane-binding component-I (PGRMCI) in the different developmental stages of the rabbit follicle. The ovaries were collected from four healthy New Zealand white rabbits, and the mRNA expression and protein levels of GnRHRI, FSHR, LHR, PGR, and PGRMCI were examined with real-time PCR and immunohistochemistry. The results showed that GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA was expressed in the ovary; furthermore, we show cell-type specific and follicular development stage-specific expression of these receptors at the protein level. Specifically, all of the receptors were detected in the oocytes from the primordial to the tertiary follicles and in the granulosa and theca cells from the secondary and tertiary follicles. In the mature follicles, all receptors were primarily localized in the granulosa and theca cells. In addition, LHR was also localized in the granulosa cells from the primordial and primary follicles. With follicular development, the expression level of all of the receptors, except GnRHRI, in the follicles showed a tendency to decrease because the area of the follicle increased sharply. The expression level of GnRHRI, FSHR, and PGR in the granulosa and theca cells showed an increasing trend with ongoing follicular development. Interestingly, the expression level of FSHR in the oocytes obviously decreased from the primary to the tertiary follicles, whereas LHR in the oocytes increased from the secondary to tertiary follicles. In conclusion, the expression of GnRHRI, the gonadotropin receptors, PGR, and PGRMCI decreased from the preantral follicles (primordial, primary, and secondary follicles) to the tertiary follicles. The expression of GnRHRI and LHR in the oocytes increased from the secondary to the tertiary follicles, whereas FSHR decreased from the primary to the tertiary follicles. The expression of GnRHRI and PGR in the granulosa and theca cells increased from the secondary to the mature follicles. These observations suggest that these receptors play roles in follicular development and participate in the regulation of follicular development. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: GnRHRI Gonadotropin receptors PGR PGRMCI Rabbit Follicular development
* Corresponding author. Tel.: 0086-835-2885345; fax: 0086-8352886080. E-mail address: [email protected] (M. Zhang). 1 Present address: College of Animal Science & Technology, Sichuan Agricultural University, No 46, Xinkang St., Ya’an, Sichuan Province, 625014, China. 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.01.043
1. Introduction Follicular development, ovulation, and luteinization are complex processes that are regulated by endocrine hormones
1140
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
such as the GnRH from the hypothalamus and the pituitary gonadotropins (FSH and LH) [1]. It is well known that GnRH is involved in the regulation of ovarian development through paracrine/autocrine pathways [2]. GnRH is released in a pulsatile manner and regulates the biosynthesis and secretion of gonadotropins from the pituitary [3]. In addition to the hypothalamus and pituitary gland, GnRH and its receptor (gonadotropin-releasing hormone receptor-I (GnRHRI)) have also been shown to be expressed in extra-pituitary tissues including the ovary [2]. Indeed, in the rabbit ovary, evidence has indicated that there are specific GnRHRI binding sites in oocytes, granulosa cells, thecal cells, ovarian surface epithelial cells, and in the CLs [4]. However, nothing is known about its expression in specific follicular cell types during development. The gonadotropins FSH and LH play essential roles in follicular growth and steroid function [5]. The development and maturation of the follicles are dependent on the successive actions of FSH and LH, which are mediated by their receptors FSHR and LHR, respectively [6]. The expression of the FSHR and LHR proteins in the rabbit CLs has been reported [4]. Similarly, the expression of FSHR was detected in granulosa cells [7,8], theca cells [7] and oocytes [9–11] in other species, and LHR mRNA was localized in the theca cells, large follicles, CLs, and the surface epithelial cells of the mouse ovary [12]. Moreover, the FSHR and LHR transcripts have been detected in neonatal mouse ovary from D3 to D15 [13] and in preimplantation embryos [11]. These observations suggest that gonadotropin receptors are expressed in the ovary very early during the formation of the gonads and in early folliculogenesis during the neonatal period. However, in the rabbit, the expression and location of FSHR and LHR in the ovarian follicles has not yet been described. The interaction of FSH and LH stimulates the production of sexual steroid hormones by their receptors, such as estradiol and progesterone (P4) [14]. Progesterone is a steroid hormone that is known to influence follicular growth, ovulation, and luteinization [15]. Progesterone also acts directly on granulosa cells to inhibit apoptosis [16]. It is generally accepted that the effects of P4 are mediated by its interaction with the genomic progesterone receptor (PGR). Progesterone receptor is a member of the nuclear receptor superfamily of transcription factors and consists mainly of two different isoforms, PGR-A and PGR-B, both encoded by a single gene by transcription from alternative promoters [17]. A study in the monkey ovary has indicated that the PGR was detected in the granulosa cells of the primordial and primary follicles [18], and a study in the human ovary has shown that the PGR was detected in the granulosa cells of the primordial, preantral, and antral follicles; in the theca cells of the preantral and antral follicles; and in the CLs [19]. However, studies in the rat [20,21] have conclusively demonstrated that the PGR is not expressed in the granulosa cells of the developing follicles and luteal cells. A recent study in the mouse has shown PGR localization in the theca and in the granulosa cells of the mature follicles as well as the CLs. There are conflicting results in different species on the expression of the PGR in the ovary; therefore, it is essential to examine the expression of the PGR in the rabbit ovary. Another protein that could mediate the action of P4 is progesterone receptor membrane component I (PGRMCI) [22]. PGRMCI was first isolated from the porcine liver [23]
and is a relatively small protein (28 kDa) that possesses a short N-terminal extracellular domain, a single transmembrane domain, and a cytoplasmic domain [24]. The finding that PGRMC1 participates in the action of P4 in the ovary is supported by the observations that PGRMCI has been detected in the mouse granulosa [25] and luteal cells [26,27] and in bovine [28], rat [22], and human oocytes [29]. Furthermore, an antibody to PGRMCI completely attenuates the anti-apoptotic action of P4 [22]. Although these studies provide strong evidence that PGRMCI mediates the action of P4 in the ovary, nothing is known about its location and expression in the specific follicular cell types during follicular development. However, to the best of our knowledge, information on the expression pattern of the reproductive hormone receptors in the developing follicles of the rabbit is still limited. Notably, reports that have examined whether PGRMCI is expressed in the rabbit follicle and changes in its expression profile during follicular development are scarce. The aim of this study was to investigate the spatiotemporal expression of GnRHRI, FSHR, LHR, PGR, and PGRMCI at the mRNA and protein levels during rabbit follicular development. 2. Materials and methods 2.1. Animals and tissue collection Four mature female New Zealand white rabbits (3.18 0.40 kg body weight and 5–6 months of age) were housed individually in cages under controlled light (12 hour light:12 hour darkness) and temperature (18 C–24 C) conditions and provided with free access to water and food. The protocols for animal use for these experiments were approved by the Institutional Animal Care and Use Committee of the Sichuan Agricultural University. After being treated with a suitable dose of an anesthetic (containing sodium pentobarbital and procaine), the left-side ovaries were carefully collected and rinsed with RNase-free PBS and then frozen at 80 C for total mRNA extraction; the right-side ovary was fixed in 4% formaldehyde (vol/vol) for 72 hours at room temperature and subsequently dehydrated through a graded ethanol series and then cleared with xylene and finally embedded in paraffin for histological and immunohistochemical examination. 2.2. Antibodies The primary antibodies were a goat polyclonal antihuman GnRHR (sc-8681), goat polyclonal anti-human FSHR (sc-7798), goat polyclonal anti-human LHR (sc26341), mouse monoclonal anti-human PR (sc-810), and mouse monoclonal anti-human PGRMCI (sc-271275), all of which were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). A biotin-conjugated universal goat/ mouse-IgG secondary antibody kit (SA2003) containing normal rabbit serum, a rabbit anti-goat/mouse secondary antibody, and a streptavidin–biotin complex (SABC) was used for the goat primary antibodies. A biotin-conjugated universal mouse-IgG secondary antibody kit (SA2001) containing normal goat serum, a goat anti-mouse secondary antibody, and the SABC was used for the primary
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
1141
from 65 C to 95 C with 0.5 C increments, during which the fluorescence data were collected to evaluate the specific amplification. The relative differences for a gene in the different groups were determined using the comparative OO cycle threshold ( CT) method [30]. The resulting values were converted to fold changes compared with the GAPDH OO OOCT signal by raising two to the CT power (2). To confirm the product’s specificity, each PCR product was analyzed by 1.5% agarose gel electrophoresis followed by sequencing to confirm that these were the correct DNA fragments.
antibodies from mouse. Both kits were purchased from Wuhan Boster (Wuhan, China). 2.3. Real-time PCR Total RNA was extracted from the ovaries with Trizol according to the manufacturer’s instructions (TaKaRa, Dalian, China). The collected supernatant (400 mL) was precipitated with 400 mL of isopropanol, followed by washing with precooled 75% ethanol. The precipitated total RNA samples were dried and then dissolved in 1 mL RNase-free dH2O. The amount and purity of the total RNA were quantified by measuring the optical density at 260 and 280 nm; the RNA integrity was checked by 1.5% agarose gel electrophoresis. The cDNA synthesis was performed using a PrimerScript RT reagent kit with gDNA Eraser (TaKaRa) according to the manufacturer’s instructions. First, the genomic DNA elimination reaction was performed. The 10-mL reaction solution contained 2 mL 5 gDNA Eraser Buffer, 1 mL gDNA Eraser,1 mg total RNA, and 4 mL RNase-free dH2O. The reaction proceeded at room temperature for 5 minutes. Then, 4 mL 5 PrimerScript buffer, 1 mL 5 PrimerScript RT enzyme mix, 1 mL RT primer mix, and 4 mL RNase-free dH2O were added to the solution. The reaction was performed in a programmable thermal controller PTC-100 (MJ Research Inc.) and incubated at 37 C for 15 minutes, followed by heat inactivation at 85 C for 5 seconds. Real-time PCR analysis for GnRHRI, FSHR, LHR, PGR, and PGRMCI expression in the ovary was performed using a CFX-96 (Bio-Rad). The 25-mL real-time PCR solution mixture contained 12.5 mL SYBR premix, 1 mL sense and antisense primers (stock concentration 10 mmol/L), 8.5 mL water, and 2 mL cDNA. The primers used are listed in Table 1. The rabbit GAPDH and PGR and the Homo sapiens PGRMCI mRNA sequences were obtained from the GenBank of the National Center for Biotechnology Information of the National Institutes of Health (http://www.ncbi.nlm.nih.gov/ cgi-bin/genbank). The specific primers were designed using Primer Premier 5.0 software, and the GnRHRI primer was as previously described [4]. The annealing temperature for each primer set is given in Table 1. The real-time PCR was performed with an initial incubation at 95 C for 30 seconds, followed by 40 cycles at 95 C for 5 seconds, and then annealing for 30 seconds; during this period, the real-time fluorescence data were collected. A melting-curve protocol was performed by repeating the 95 C heating for 10 seconds,
2.4. Histology Serial tissue sections were cut at 4 mm thickness and mounted on Fisherbrand Superfrost Plus Microscope Slides (Fisher Scientific, USA). The sections were deparaffinized, rehydrated, and rinsed in distilled water. Finally, they were stained with hematoxylin for 5 minutes and then eosin for 40 seconds, dehydrated, and mounted. For each ovary sample, we made five slides, and each slide had six tissue sections mounted on it. The diameter of the follicles and oocytes and the thickness of the zona pellucida (ZP) from the different developmental stages of the follicles were measured using a Nikon-90i microscope (Nikon, Japan) linked to a computerbased image analyzer (ACT-2U software; Nikon, Japan). The primordial, primary, secondary, tertiary, and mature follicles were defined according to a previous reference [31]. 2.5. Immunohistochemistry These sections were subjected to antigen retrieval at 120 C for 5 minutes in a citrate buffer solution (10 mmol/L, pH 6) after being deparaffinized and rehydrated. To block the endogenous peroxidase activity, the sections were dipped in 3% H2O2 (vol/vol) in methanol for 10 minutes and then incubated with the corresponding serum for 20 minutes. Subsequently, the sections were incubated with either a goat polyclonal anti-GNRHRI primary antibody, goat polyclonal anti-FSHR primary antibody, goat polyclonal anti-LHR primary antibody, mouse monoclonal antiPR primary antibody, or a mouse monoclonal anti-PGRMCI antibody at 4 C overnight. The primary antibodies were diluted 1:200 in PBS. These sections were then incubated with the corresponding secondary antibodies (diluted
Table 1 Primers used for real-time PCR. Gene name
Sequence (50 –30 )
Product length (bp)
Annealing temperature ( C)
Accession number
GAPDH
F: TGTTTGTGATGGGCGTGAA R: CCTCCACAATGCCGAAGT F: TGATCCACCTCA CAA ATG GA R: ATGAAGGACCCGTGTCAGAG F: GAGGAATGCCATTGA ACTGAGG R: AAGGTTGGAGAACACATCTG F: CTG GAG AAG ATG CAC AAT GG R: AATTAGCCTCTGAATGGACTC F: GCTGCCCCCGCTACCAAAGG R: TCCCCTGGGCAGCACCTTGT F: GCCCAACCTTTACTCCA R: TCGTCGTCGTCGCTGTC
150
57.4
NC-013676.1
191
61.3
AY781779
150
57
AY429104.1
118
57
S57793
108
61
NM-001082267
205
57
NC-013676.1
GnRHRI FSHR LHR PGR PGRMCI
1142
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
1:100 in PBS) and the SABC for 1 hour each at room temperature. The immunoreaction products were visualized using a 3,30 -diaminobenzidine (DAB) kit (Wuhan Boster, China). The sections were counterstained with hematoxylin, sequentially dehydrated and mounted. To confirm the specificity of the immunostaining, the primary antibody was replaced with PBS (Fig. 2A to E). The sections were examined under a light microscope (Olympus BX-51, Japan) with image analysis software (NIS Element, Nikon, Tokyo, Japan). The integrated optical density (IOD) of the positive immunostaining was analyzed in the area of interest (AOI), such as the follicle, oocyte, granulose, and theca cell layer, using Image-Pro plus software, and then the optical density (OD) was calculated as follows: OD ¼ IOD/AOI. Six tissue sections for each ovary from each animal were mounted on a slide, six different eyefields from each section were analyzed for the OD, and the ODs were averaged to obtain a mean optical density (mOD). The mOD value represents the expression density of the specific receptors. 2.6. Statistical analysis The mODs from the different developmental stages of the follicles were compared. The data were analyzed by one-way ANOVA. Duncan’s multiple comparison was used for the detection of significant differences using SAS 9.1 software. Pvalue <0.05 was considered to be a significant difference. 3. Results 3.1. Expression of GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA in the rabbit ovary The expression levels of GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA were detected in the rabbit ovary. Compared with GnRHRI, the expression level of LHR was the highest at approximately 348-fold, and PGRMCI, FSHR, and PGR were approximately 12-, 7-, and 4-fold, respectively (Fig. 1).
Fig. 1. GnRHRI, FSHR, LHR, PGR, and PGRMCI mRNA expression in the rabbit ovary. Values are presented as the mean SEM (n ¼ 4); all values were standardized to their respective GAPDH control values.
3.2. Histological measurements The diameters of the primordial, primary, secondary, and tertiary follicles; the diameters of the oocytes; and the thickness of the ZP were measured (Table 2). There were very few mature follicles. The diameters of the primordial, primary, secondary, and tertiary follicles were 42.26 0.21 mm, 59.76 0.77 mm, 177.12 4.50 mm, and 742.69 9.67 mm, respectively, and the oocyte diameters were 25.23 0.15 mm, 31.33 0.43 mm, 74.11 1.82 mm, and 104.87 3.68 mm, respectively. These results suggested that the diameter increase of the rabbit follicles mainly occurred at the secondary and tertiary follicle stages. A possible reason for this is that the rapid proliferation of the granulosa cells and the emergence and expansion of the follicular cavity occurred at this stage. However, the diameter increase of the oocytes occurred mainly at the tertiary follicle stage. The ZP thickness of the secondary and tertiary follicles was 3.88 0.05 mm and 7.85 0.27 mm, respectively. Meanwhile, the regression relationship between the follicle diameter (Y) and the oocyte diameter (X) was Y ¼ 0.5078X 1.3838 (R2 ¼ 0.8958), and the regression relationship between the follicle diameter (Y) and the thickness of the ZP (X) was Y ¼ 119.54X–271.96 (R2 ¼ 0.7876). 3.3. Immunostaining 3.3.1. GnRHRI The results indicated that immunoreactive GnRHRI was localized in the oocytes of the primordial and primary follicles (Fig. 2A1); the secondary (Fig. 2B1) and tertiary follicles (Fig. 2C1); and in the granulosa and theca cells of the secondary, tertiary, and mature follicles (Fig. 2B1 to D1); and the CLs (Fig. 2E1). The changes in the expression levels of GnRHRI with follicular development are shown in Figure 3A. Moreover, the density of GnRHRI had a decreasing trend with ongoing follicular development, but the expression level of GnRHRI in the oocyte, granulose, and theca had an increasing trend with ongoing follicular development. Specifically, the expression level of GnRHRI in the primordial follicles was significantly greater than in the secondary follicles (P < 0.05); the expression level of GnRHRI in the oocytes of the tertiary follicles was significantly greater than that of the secondary follicles (P < 0.05), and its density in the granulosa and theca cells of the mature follicles was significantly greater than in the secondary follicles (P < 0.05). 3.3.2. FSHR FSHR was detected at all stages of the follicles and corpus luteal cells. Specifically, the immunoreactive FSHR was localized in the oocytes of the primordial and primary follicles (Fig. 2A2), the secondary (Fig. 2B2) and tertiary follicles (Fig. 2C2), and in the granulosa and theca cells of the secondary, tertiary, and mature follicles (Fig. 2B2 to D2), and in the CL (Fig. 2E2). The expression pattern of FSHR was similar to GnRHRI, except in the oocytes. The expression level of FSHR in the oocytes showed an obvious decreasing trend with ongoing follicular development (Fig. 3B). Namely, the expression level of FSHR in the oocytes of the primary follicles was significantly greater than that of the
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
1143
Fig. 2. Immunostaining for GnRHRI, FSHR, LHR, PGR, and PGRMCI in the rabbit ovary. (A–E) The negative control, (A1–E1) immunostaining for GnRHRI, (A2–E2) immunostaining for FSHR, (A3–E3) immunostaining for LHR, (A4–E4) immunostaining for PGR, (A5–E5) immunostaining for PGRMCI, (A1–A5) primordial or primary follicle, (B1–B5) secondary follicle, (C1–C5) tertiary follicle, (D1–D5) mature follicle, (E1–E5) CL. Ep, epithelial; ETC, external theca cells; GC, granulosa cells; ITC, internal theca cells; Me, mesenchyme; O, oocyte; PF, primary follicles; PrF, primordial follicles; TC, theca cells; ZP, zona pellucida. Scale bars ¼ 50 mm.
tertiary follicles (P < 0.05), and the expression level of FSHR in the follicles had a significant decreasing trend with ongoing follicular development. The expression level of FSHR in the primordial follicles was significantly higher than that of the secondary and tertiary follicles (P < 0.01 and P < 0.05, respectively).
3.3.3. LHR Unlike the expression pattern of the immunoreactive GnRHRI and FSHR, the immunoreactive LHR was specifically detected in the granulosa of the primordial and primary follicles (Fig. 2A3, B3). LHR was detected in the oocytes from the primordial to tertiary follicles
Table 2 The diameter of the follicles and oocytes and the thickness of the zona pellucida. Development stages of follicles
n
Diameter of follicles (mm)
Diameter of oocytes (mm)
Thickness of ZP (mm)
Primordial follicles Primary follicles Secondary follicles Tertiary follicles
333 186 132 19
42.26 0.21 （30.79w57.52） 59.76 0.77 （40.00w96.56） 177.12 4.50 （98.50w513.06） 742.69 9.67 （698.04w881.27）
25.23 0.15 （17.21w38.37） 31.33 0.43 （20.44w54.03） 74.11 1.82 （36.78w129.50） 104.87 3.68 （94.09w165.65）
d d 3.88 0.05 （3.00w5.56） 7.85 0.27 （5.10w9.40）
1144
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
(Fig. 2A3 to C3), the granulosa and theca cells in the secondary, tertiary, and mature follicles (Fig. 2B3 to D3), and the CL (Fig. 2E3). Its expression pattern was similar to GnRHR. The changes in the expression level of LHR with follicular development are shown in Figure 3C. The expression level of LHR had an obvious decreasing trend with ongoing follicular development. Specifically, the expression level of LHR in the primordial and primary follicles was significantly greater than that of the secondary and tertiary follicles (P < 0.05 and P < 0.01, respectively). In the oocytes of the tertiary follicles, the expression level of LHR was extremely significantly greater than that of the secondary follicles. Similar to the changes in the expression level of FSHR in the granulosa and theca cells with follicular development, the expression level of LHR did not show a significant increase with ongoing follicular development. 3.3.4. PGR And PGRMCI Immunoreactive PGR (Fig. 2A4 to E4) and PGRMCI (Fig. 2A5 to E5) were detected in the different follicular developmental stages. The results showed that PGR and PGRMCI were localized in the oocytes of the primordial and primary follicles, the secondary and tertiary follicles, in the granulosa and theca cells of the secondary, tertiary, and mature follicles, and the CL. The changes in the expression level of PGR and PGRMCI with follicular development are shown in Figure 3D and E, respectively. The results show that the expression level of PGR and PGRMCI in the follicles had a decreasing trend with ongoing follicular development, whereas the expression level of PGR in the granulosa and theca cells had an increasing trend with follicular development. Specifically, the expression level of PGR in the primordial and primary follicles was significantly greater than that of the secondary follicles (P < 0.01 and P < 0.05, respectively). The expression level of PGR in the granulosa cells of the secondary follicles was significantly lower than that of the mature follicles (P < 0.01). In the theca cells of the secondary follicles, its density was also significantly lower than that in the tertiary and mature follicles (P < 0.05). The expression level of PGRMCI in the primordial and primary follicles was significantly greater than that of the secondary and tertiary follicles (P < 0.01 and P < 0.05, respectively), and the density in the secondary follicles was significantly greater than that of the tertiary follicles (P < 0.05). 4. Discussion The present study has demonstrated the following: (1) the growth of the follicle was closely correlated with the growth of the oocyte and the thickness of the ZP; (2) GnRHRI, FSHR, LHR, PGR, and PGRMCI were localized in the oocytes, granulose, and theca cells of the different developmental stages of the follicles; and (3) the expression
Fig. 3. Changes in the mOD of GnRHRI, FSHR, LHR, PGR, and PGRMCI with follicle development. (A) The mOD of GnRHRI, (B) the mOD of FSHR, (C) the mOD of LHR, (D) the mOD of PGR, and (E) the mOD of PGRMCI. MF, mature
follicles; PF, primary follicles; PrF, primordial follicles; SF, secondary follicles; TF, tertiary follicles. Statistical significance was compared in the same groups during follicle development. a,b,c;A,BValues with different letters are significantly different (P < 0.05 and P < 0.01, respectively).
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
level of GnRHRI in the oocytes, granulose, and theca cells; the expression level of LHR in the oocytes; and the expression level of PGR in the granulosa and theca cells were all increased, whereas the expression level of FSHR in the oocytes was decreased during follicular development. The follicular diameter results showed considerable overlap, which confirms that follicular development is a dynamic process. Meanwhile, the results suggested that the diameter increase of the rabbit follicles mainly occurred at the stage of the secondary and tertiary follicle, which is in agreement with previous reports that the small follicles grew more slowly than the larger follicles [32]. A possible reason was that the fast proliferation of the granulosa cells and the emergence and expansion of the follicular cavity occurred at these stages. A previous study reported that GnRHRI was located in the rabbit oocytes, granulosa cells, theca cells, ovarian surface epithelial cells, and CLs [4], and our study is consistent with those observations. However, in the rat ovary, GnRHRI mRNA was only detected in the granulosa cells from the primary to mature follicles, but not in the oocytes and theca cells [33,34]. However, in the human ovary, no significant immunoreactive GnRHRI was detected in the follicles from the primordial to the early antral stages, and GnRHRI was only expressed in the granulosa cells and internal theca cells in the mature follicles [35]. Interestingly, our study showed that in mature rabbit follicles, GnRHRI was expressed both in theca internal and external cells. Thus, it is likely that GnRHRI can be commonly expressed in the ovary in many mammals, although there are some minor differences in their expression profiles. In this study, the GnRHRI expression level in the oocytes of the tertiary follicles was significantly higher than that of the secondary follicles, and in the granulosa and theca cells of the mature follicles, it was significantly greater than in the secondary follicles. This stage-specific change in its expression in rabbit follicular development suggests a possible interaction between GnRH and the gonadotropin system. Previous reports have shown that when treated with GnRH, a significant downregulation of FSHR and LHR was observed, suggesting that GnRH may have anti-gonadotropic effects [36]. The present study has shown that GnRHRI expression was increased in the oocytes, granulose, and theca cells during follicular development, while FSHR, but not LHR, expression was decreased in the oocytes, suggesting that GnRH and GnRHRI play an important role in follicular growth through regulating the expression of FSHR and LHR. FSHR and LHR were expressed in the oocytes, granulosa, theca cells, and CL in our study, which agrees with previous reports [4,7–10,12,37,38]. The thecal cells expressed LHR in the secondary follicles when it was initially differentiated, which triggered the biosynthesis of thecal androgens and was essential to stimulate the formation of FSHR in the granulosa cells, suggesting that an LH and LHR interaction may amplify the effects of FSH on follicular development [39]. However, both the FSHR and LHR expression levels did not change in the granulosa and theca cells at the different follicular stages, suggesting that in the rabbit, ovarian follicular gonadotropin receptors are not dynamically regulated during follicular development. Although both
1145
FSHR and LHR were detected in the primordial, primary, and secondary follicles, the growth of the preantral follicles is independent of circulating gonadotropins [40,41]. Mice deficient in the FSHb subunit [42] or in FSHR [42,43], as well as mice with natural mutations in GnRH, which results in a marked reduction in the synthesis of FSH and LH, have normal preantral follicle growth despite having defective antral follicles [44]. However, this is not to say that the initial development of the follicles is gonadotropin independent. When an FSH neutralizing antibody was injected into pregnant hamsters, the number of primordial follicles was reduced [45]. Additionally, follitropin receptor knockout (FORKO) mice contained fewer primordial follicles in comparison with wild-type animals [46]. All of these data suggest that FSH and FSHR are essential for the formation and recruitment of the primordial follicles into the growing pool. In this study, both FSHR and LHR were expressed in the oocytes, suggesting a potential role for FSH and LH in the modulation of the meiotic resumption and completion of oocyte maturation. The FSHR expression level in the oocytes in the primary follicles was significantly higher than that of the tertiary follicles, reaching a minimum at the tertiary follicles, while the expression level of LHR in the oocytes in the tertiary follicles was extremely significantly greater than that of the secondary follicles, reaching a peak at the tertiary follicle. These results indicate that the oocytes are highly responsive to the regulation of FSH during the earlier stage, but from development to maturation, the oocytes are likely more responsive to LH. To a certain extent, this finding suggests that the sensitivity of the oocytes to gonadotropins shifts from FSH to LH during the development of the follicles, which might be involved in the establishment of the follicular hierarchy in rabbits. Some previous studies have reported that PGRs were not expressed in the granulosa cells of the developing follicles and luteal cells of the rat [20,21]. In a recent study in the mouse, PGR localization was shown in the theca and granulosa cells of the mature follicles as well as in the CLs. However, a study in the monkey ovary has indicated that PGR was detected in the granulosa cells of the primordial and primary follicles [18], and a study in the human ovary has shown that PGR was detected in the granulosa cells of the primordial, preantral, and antral follicles; in the theca cells of the preantral and antral follicles; and in the CLs [19]. Our present study showed that the immunostaining for PGR was detected in the granulosa and theca cells of the primordial, primary, secondary, tertiary, and mature follicles; in the oocytes of the primordial, primary, secondary, and tertiary follicles; and in the CLs. Although species differences clearly exist, the reason may be that rabbits are reflex ovulators that regulate P4 function in a specific way. Meanwhile, this result supports the hypothesis that P4 and PGR play a role in the intra-ovarian regulation of follicle growth from the first step of follicular development, although the mechanism will require further elucidation. The present study showed that PGRMCI was expressed not only in the granulosa cells but also in the oocytes, thecal cells, luteal cells, and ovarian surface epithelial cells, supporting previous studies on rat and bovine [22,47]. Our study detected PGRMCI in the oocytes. PGRMCI has also been detected in bovine [28], rat [22], and human oocytes
1146
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147
[29], thereby supporting the conclusion that PGRMCI is expressed in mammalian oocytes. In spite of its expression in oocytes, little is known about PGRMCI and oocyte function. Until recently, the expression of PGRMCI was detected in the mitotic spindle [48], suggesting that PGRMCI had a role in regulating oocyte maturation. It was known that P4 acts on amphibian and Xenopus laevis oocytes to induce oocyte maturation [49]. Unlike its action in amphibian and Xenopus laevis oocytes, P4 does not induce oocyte maturation in mammals. An in vivo study in the mouse showed that when adding progesterone, the number of follicles undergoing germinal vesicle breakdown decreased [50]. Because PGRMCI is expressed in mammalian oocytes, it may inhibit the resumption of meiosis. Therefore, the involvement of PGRMCI in regulating oocyte maturation remains to be examined. PGRMCI expression in the granulosa and theca cells during follicular development as well as in the CLs was detected. Treatment with an antibody to PGRMCI completely attenuates the anti-apoptotic action of P4 [22]. These results suggest the possibility that PGRMCI is involved in regulating the anti-apoptotic actions of P4 in granulosa, theca, and luteal cells. 4.1. Conclusions The present study reveals that GnRHRI, FSHR, LHR, PGR, and PGRMCI are expressed in the oocyte, granulose, and theca cells during follicular development as well as the CLs of the rabbit. The expression of GnRHRI in the oocyte, granulose, and theca cells increases during follicular development, suggesting the involvement of GnRHRI in follicular development. Although the growth of the preantral follicles is independent of circulating gonadotropins, the formation and recruitment of the primordial follicles are mainly dependent on FSH and FSHR. During follicular development, the expression of FSHR in the oocytes decreased, whereas the LHR expression increased, suggesting that the sensitivity of the oocytes to gonadotropins shifts from FSH to LH. PGR is expressed in all follicular stages, playing a role in the regulation of follicle growth from the first stage of follicular development. The expression of PGRMCI in the oocytes suggests that PGRMCI has a role in regulating oocyte maturation, and its expression in granulosa, theca, and luteal cells suggests the possibility that PGRMCI is involved in regulating the anti-apoptotic actions of P4 in granulosa, theca, and luteal cells. Acknowledgments This work was supported by the National Innovative Experiment Fund of Undergraduate for Liu F, the Fund of Research Activities for Overseas Scholars, and the “Doublesupport” Fund of Sichuan Agricultural University to Zhang M. References [1] Richards JS. Perspective: the ovarian follicleda perspective in 2001. Endocrinology 2001;142:2184–93. [2] Ramakrishnappa N, Rajamahendran R, Lin Y-M, Leung P. GnRH in non-hypothalamic reproductive tissues. Anim Reprod Sci 2005;88: 95–113.
[3] Perrin M, Bilezikjian L, Hoeger C, Donaldson C, Rivier J, Haas Y, et al. Molecular and functional characterization of GnRH receptors cloned from rat pituitary and a mouse pituitary tumor cell line. Biochem Biophys Res Commun 1993;191:1139–44. [4] Zerani M, Parillo F, Brecchia G, Guelfi G, Dall’Aglio C, Lilli L, et al. Expression of type I GNRH receptor and in vivo and in vitro GNRH-I effects in corpora lutea of pseudopregnant rabbits. J Endocrinol 2010;207:289–300. [5] Kakar SS, Musgrove LC, Devor DC, Sellers JC, Neill JD. Cloning, sequencing, and expression of human gonadotropin releasing hormone (GnRH) receptor. Biochem Biophys Res Commun 1992;189: 289–95. [6] Ni Y, Zhou Y, Lu L, Grossmann R, Zhao R. Developmental changes of FSH-R, LH-R, ER-b and GnRH-I expression in the ovary of prepubertal ducks (Anas platyrhynchos). Anim Reprod Sci 2007;100:318–28. [7] Li X, Zhang H, Sheng X, Li B, Zhou J, Xu M, et al. Immunoreactivities of androgen receptor, estrogen receptors, p450arom, p450c17 proteins in wild ground squirrels ovaries during the nonbreeding and breeding seasons. J Ovarian Res 2012;5:1–10. [8] Taru Sharma G, Dubey P, Sai Kumar G. Localization and expression of follicle-stimulating hormone receptor gene in buffalo (Bubalus bubalis) pre-antral follicles. Reprod Domest Anim 2011;46:114–20. [9] Méduri G, Charnaux N, Driancourt M-A, Combettes L, Granet P, Vannier B, et al. Follicle-stimulating hormone receptors in oocytes? J Clin Endocrinol Metab 2002;87:2266–76. [10] Patsoula E, Loutradis D, Drakakis P, Michalas L, Bletsa R, Michalas S. Messenger RNA expression for the follicle-stimulating hormone receptor and luteinizing hormone receptor in human oocytes and preimplantation-stage embryos. Fertil Steril 2003;79:1187–93. [11] Patsoula E, Loutradis D, Drakakis P, Kallianidis K, Bletsa R, Michalas S. Expression of mRNA for the LH and FSH receptors in mouse oocytes and preimplantation embryos. Reproduction 2001; 121:455–61. [12] Zheng M, Shi H, Segaloff DL, Van Voorhis BJ. Expression and localization of luteinizing hormone receptor in the female mouse reproductive tract. Biol Reprod 2001;64:179–87. [13] O’shaughnessy P, McLelland D, McBride M. Regulation of luteinizing hormone-receptor and follicle-stimulating hormone-receptor messenger ribonucleic acid levels during development in the neonatal mouse ovary. Biol Reprod 1997;57:602–8. [14] Ashley P, Frank L, Schmeitzel L, Bailey E, Oliver J. Effect of oral melatonin administration on sex hormone, prolactin, and thyroid hormone concentrations in adult dogs. J Am Vet Med Assoc 1999; 215:1111. [15] Peluso JJ. Multiplicity of progesterone’s actions and receptors in the mammalian ovary. Biol Reprod 2006;75:2–8. [16] Peluso JJ, Pappalardo A, Losel R, Wehling M. Expression and function of PAIRBP1 within gonadotropin-primed immature rat ovaries: PAIRBP1 regulation of granulosa and luteal cell viability. Biol Reprod 2005;73:261–70. [17] Conneely OM, Mulac-Jericevic B, DeMayo F, Lydon JP, O’Malley BW. Reproductive functions of progesterone receptors. Recent Prog Horm Res 2002;57:339–55. [18] Hild-Petito S, Stouffer RL, Brenner RM. Immunocytochemical localization of estradiol and progesterone receptors in the monkey ovary throughout the menstrual cycle. Endocrinology 1988;123:2896– 905. [19] Revelli A, Paahioni D, Cassoni P, Bussolati G, Massobrio M. In situ hybridization study of messenger RNA for estrogen receptor and immunohistochemical detection of estrogen and progesterone receptors in the human ovary. Gynecol Endocrinol 1996;10:177–86. [20] Park O-K, Mayo KE. Transient expression of progesterone receptor messenger RNA in ovarian granulosa cells after the preovulatory luteinizing hormone surge. Mol Endocrinol 1991;5:967–78. [21] Park-Sarge O, Parmer T, Gu Y, Gibori G. Does the rat corpus luteum express the progesterone receptor gene? Endocrinology 1995;136: 1537–43. [22] Peluso J, Pappalardo A, Losel R, Wehling M. Progesterone membrane receptor component 1 expression in the immature rat ovary and its role in mediating progesterone’s antiapoptotic action. Endocrinology 2006;147:3133–40. [23] Meyer C, Schmid R, Schmieding K, Falkenstein E, Wehling M. Characterization of high affinity progesterone-binding membrane proteins by an anti-peptide antiserum. Steroids 1998;63:111–6. [24] Cahill MA. Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 2007;105:16–36. [25] McRae R, Johnston H, Mihm M, O’Shaughnessy P. Changes in mouse granulosa cell gene expression during early luteinization. Endocrinology 2005;146:309–17.
R.X. Lan et al. / Theriogenology 81 (2014) 1139–1147 [26] Cai Z, Stocco C. Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 2005;146:5522–32. [27] Sasson R, Rimon E, Dantes A, Cohen T, Shinder V, Land-Bracha A, et al. Gonadotrophin-induced gene regulation in human granulosa cells obtained from IVF patients. Modulation of steroidogenic genes, cytoskeletal genes and genes coding for apoptotic signalling and protein kinases. Mol Hum Reprod 2004;10:299–311. [28] Dode MAN, Dufort I, Massicotte L, Sirard MA. Quantitative expression of candidate genes for developmental competence in bovine two-cell embryos. Mol Reprod Dev 2006;73:288–97. [29] Wood JR, Dumesic DA, Abbott DH, Strauss JF. Molecular abnormalities in oocytes from women with polycystic ovary syndrome revealed by microarray analysis. J Clin Endocrinol Metab 2007;92:705–13. [30] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCT method. Methods 2001;25:402–8. [31] Hafez ESE. Reproduction in farm animals. Philadelphia, USA: Lea & Febiger; 1987. [32] Lussier J, Matton P, Dufour J. Growth rates of follicles in the ovary of the cow. J Reprod Fertil 1987;81:301–7. [33] Whitelaw P, Eidne K, Sellar R, Smyth C, Hillier S. Gonadotropinreleasing hormone receptor messenger ribonucleic acid expression in rat ovary. Endocrinology 1995;136:172–9. [34] Kogo H, Fujimoto T, Park M, Mori T. Gonadotropin-releasing hormone receptor mRNA expression in the ovaries of neonatal and adult rats. Cells Tissues Organs 1999;164:14–22. [35] Choi J-H, Gilks CB, Auersperg N, Leung PC. Immunolocalization of gonadotropin-releasing hormone (GnRH)-I, GnRH-II, and type I GnRH receptor during follicular development in the human ovary. J Clin Endocrinol Metab 2006;91:4562–70. [36] Kang SK, Tai C-J, Nathwani PS, Leung PC. Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid in human granulosa-luteal cells. Endocrinology 2001;142:182–92. [37] Wei S, Gong Z, Dong J, Ouyang X, Wei M, Xie K, et al. Effect of a GnRH agonist on the FSH receptors in prepubertal ewes. Small Ruminant Res 2012;105:237–43. [38] Peluso J, Fernandez G, Pappalardo A, White B. Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 2001;65:94–101.
1147
[39] Van den Hurk R, Abir R, Telfer E, Bevers M. Primate and bovine immature oocytes and follicles as sources of fertilizable oocytes. Hum Reprod Update 2000;6:457–74. [40] Campbell B, Baird D, Souza C, Webb R. The FecB (Booroola) gene acts at the ovary: in vivo evidence. Reproduction 2003;126:101–11. [41] Webb R, Nicholas B, Gong J, Campbell B, Gutierrez C, Garverick H, et al. Mechanisms regulating follicular development and selection of the dominant follicle. Reprod Suppl 2003;61:71–90. [42] Kumar TR, Wang Y, Lu N, Matzuk MM. Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 1997;15:201–4. [43] Abel MH, Wootton AN, Wilkins V, Huhtaniemi I, Knight PG, Charlton HM. The effect of a null mutation in the follicle-stimulating hormone receptor gene on mouse reproduction. Endocrinology 2000;141:1795–803. [44] Cattanach B, Iddon CA, Charlton H, CHIAPPA SA, Fink G. Gonadotrophin-releasing hormone deficiency in a mutant mouse with hypogonadism. Nature 1977;269:338–40. [45] Roy SK, Albee L. Requirement for follicle-stimulating hormone action in the formation of primordial follicles during perinatal ovarian development in the hamster. Endocrinology 2000;141: 4449–56. [46] Balla A, Danilovich N, Yang Y, Sairam MR. Dynamics of ovarian development in the FORKO immature mouse: Structural and functional implications for ovarian reserve. Biol Reprod 2003;69:1281– 93. [47] Luciano A, Corbani D, Lodde V, Tessaro I, Franciosi F, Peluso J, et al. Expression of progesterone receptor membrane component-1 in bovine reproductive system during estrous cycle. Eur J Histochem 2011;55:145–50. [48] Nousiainen M, Silljé HH, Sauer G, Nigg EA, Körner R. Phosphoproteome analysis of the human mitotic spindle. Proc Natl Acad Sci U.S. A 2006;103:5391–6. [49] Bayaa M, Booth RA, Sheng Y, Liu XJ. The classical progesterone receptor mediates Xenopus oocyte maturation through a nongenomic mechanism. Proc Natl Acad Sci U.S.A 2000;97:12607–12. [50] Eppig J, Koide SL. Effects of progesterone and oestradiol-17b on the spontaneous meiotic maturation of mouse oocytes. J Reprod Fertil 1978;53:99–101.