Improved tryprostatin B production by heterologous gene expression in Aspergillus nidulans

Fungal Genetics and Biology 46 (2009) 436–440

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Improved tryprostatin B production by heterologous gene expression in Aspergillus nidulans Shubha Maiya a, Alexander Grundmann b, Shu-Ming Li b,1, Geoffrey Turner a,* a b

University of Sheffield, Department of Molecular Biology and Biotechnology, S10 2TN, Sheffield, UK Heinrich-Heine-Universität Düsseldorf, Institut für Pharmazeutische Biologie und Biotechnologie, Universitätsstr. 1, D-40225 Düsseldorf, Germany

a r t i c l e

i n f o

Article history: Received 23 December 2008 Accepted 27 January 2009 Available online 5 February 2009 Keywords: Aspergillus Secondary metabolism NRPS Tryprostatin Fumitremorgin Heterologous expression

a b s t r a c t Tryprostatin B, a prenylated diketopiperazine with anti-tubulin activity, has been overproduced in fungal culture by expression of genes of the fumitremorgin cluster from Aspergillus fumigatus in the naïve host Aspergillus nidulans using the alcA promoter. The products of the expressed genes catalyse the first two steps of fumitremorgin biosynthesis, namely the formation of brevianamide F and its conversion to tryprostatin B. Yields of tryprostatin B were up to 250 mg/l, a significant improvement in previously reported levels. This approach illustrates how the availability of fungal genome sequences and knowledge of gene function can be used to achieve the efficient production of biologically active secondary metabolites by genetic manipulation. Ó 2009 Elsevier Inc. All rights reserved.

1. Introduction Like many other filamentous fungi (Keller et al., 2005), Aspergillus fumigatus is able to produce a variety of secondary metabolites, and there is a significant literature on the fermentation conditions, biological activity, and chemical analyses of these products. In addition to the general chemical interest in these compounds and their synthesis, some of them have been viewed as potential lead compounds for drug development. Tryprostatins A and B (Scheme 1), diketopiperazines, were isolated from A. fumigatus BM939 cultures (Cui et al., 1995) during a screen for mammalian cell cycle inhibitors. It was reported that both of these novel compounds inhibited cell cycle progression of mouse tsFT210 cells in the M phase (Cui et al., 1996). Tryprostatin A was shown to block MAP2 (microtubule associated protein 2)-dependent assembly of microtubules (Usui et al., 1998). These compounds were purified from liquid culture of A. fumigatus strain BM939 with a yield of approximately 0.4 mg/l. These compounds are likely to be intermediates in the biosynthesis of the tremorgenic mycotoxin fumitremorgin B (Yamazaki et al., 1971) (Scheme 1). A gene cluster recently identified in the genome reference strain A. fumigatus Af293 (Grundmann and Li, 2005; Maiya et al., 2006) has been shown to include the genes ftmA and ftmB, encoding cyclo-L-trp-L-pro (brevianamide F) synthetase, a nonrib-

* Corresponding author. Fax: +44 114 222 2800. E-mail address: g.turner@sheffield.ac.uk (G. Turner). 1 Present address: Philipps-Universität Marburg, Institut fur Pharmazeutische Biologie, Deutschhausstr. 17a, D-35037 Marburg, Germany. 1087-1845/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2009.01.003

osomal peptide synthetase, and brevianamide F dimethylallyltransferase, respectively. Though strain Af293 did not produce detectable amounts of these compounds, and transcription of both ftmA and ftmB was weak, ftmA could be overexpressed in both A. fumigatus Af293 and in the genetic model and naïve host Aspergillus nidulans, to yield abundant brevianamide F (Maiya et al., 2006), and ftmB (ftmPT1) was expressed in Escherichia coli under the control of a T5 promoter, to give active prenyltransferase (Grundmann and Li, 2005). Here we demonstrate that co-expression of ftmA and ftmB in the naïve host A. nidulans, under the control of the strong promoter PalcA, can give a substantially improved yield of tryprostatin B compared to that reported previously from A. fumigatus cultures. 2. Materials and methods 2.1. Strains and plasmids All plasmids were propagated in E. coli DH5a (Bethesda Research Laboratories, USA). Transformation of E. coli, plasmid preparation and basic molecular biology techniques were as described (Sambrook and Russell, 2001). A. nidulans G191 (fwA pabaA1 pyrG89 uaY9) (Ballance and Turner, 1985; Kennedy and Turner, 1996) was used for heterologous expression. Plasmid pCR2.1 (Invitrogen, UK) and pBluescriptSK+ (Stratagene, UK) were used for cloning the A. fumigatus ftmA (NRPS, Afu8g00170) and ftmB (Afu8g00210). A. nidulans pyrG gene used as a selectable marker for fungal transformation was obtained from the plasmid pPL6 (Oakley et al., 1987).

S. Maiya et al. / Fungal Genetics and Biology 46 (2009) 436–440

437

Scheme 1. The roles of FtmA/B in the biosynthesis of fumitremorgin B.

2.2. Growth media and culture conditions Fungal strains were grown at 37 °C on Aspergillus complete medium (ACM) to obtain conidial suspensions, Aspergillus Minimal Medium (AMM) for transformation experiments, and YEPD (2% (w/v) yeast extract, 0.1% (w/v) peptone, and 2% (w/v) glucose) to grow cultures for the genomic DNA isolation (Ballance and Turner, 1985). All media were supplemented when required with uracil (0.22 g/100 ml) and uridine (2.44 mg/ml). For the isolation of metabolites from A. nidulans strains with the genes expressed under alcA promoter, basal minimal medium (1% (w/v) glucose) with tryptophan was used for repression of alcA expression, and for induction, glucose was replaced by glycerol (0.1 M) and threonine (0.1 M) (Kennedy and Turner, 1996; Felenbok et al., 2001). Cultures (250 ml in 1 l conical flasks) were incubated at 37 °C for a period of 1 week on a rotary shaker at 200 rpm. 2.3. Sequence analysis Genomic sequences of A. fumigatus were obtained from http:// www.tigr.org (Nierman et al., 2005) and the GenBank accession numbers are given for individual genes. Gene regions can also be viewed at http://www.cadre-genomes.org.uk.

Table 1 Oligonucleotide primer sequences. Primers were designed based on sequence data obtained from the A. fumigatus genome sequencing database (http://www.tigr.org). Bold and underlined text indicates added restriction sites. Primers

Sequence 50 —30

PSM07FP PSM08RP PSM14FP PSM15RP PSM16FP PSM17RP PSM40FP

AACACATATGTGGATCCCTTTTAGTCAATACCGTTACAC CACCGGACCGGCCGCAGACAATGCTCTCTATCCT CCCAGGTCCTCAAGCCTGATGAATTCTACAAATGGC GCTAGTACGAAAGACGAGCATCATCGCGTATGACGAGAAC TTCGAGTCAACGAGGAAGATACCGTGGAGA ACCCTCTTAGGTACTCATGGATTTGGGCGA BbvCI ATAGTTTAGCGGCCGCATTCTCCACGACTGGAACGATG BbvCI ATAGTTTAGCGGCCGCAGATGGATCGAGAACCCAGACT PshA1 GTTGTTGACTCGTGTCTGAAAAGCTGATTGTG Acc65I TAGGTGAGCTCTGGTACCTTTGAGGCGAGGTGATAGGAT AGGAAGGCTGGAAAGCTTACGA ATTACGCCAAGCGCGCAATTAACCCT BbvCI CTGATTCCTCAGCCATTTTGAGGCGAGGTGATAGG BbvCI CTGATTCCTCAGCTGAAAAGCTGATTGTGATAGTTCCC TTAATGCGCCGCTACAGG AAAGTGGCTGAGCTGAGACCT ACGGAGTCGCAGAAATCGACAAGA TGCAGGATGTACGGTCAGCAAGAT

PSM41RP PSM26FP PSM27RP PSM46FP PSM47RP PSM132FP PSM133RP PSM150FP PSM151RP PSM162FP PSM163RP

2.4. Construction of plasmids Genomic DNA was isolated from 40 to 50 mg of frozen mycelia ground in liquid nitrogen using the protocol for the isolation of genomic DNA from plant tissue (Wizard genomic DNA purification kit, Promega, UK). PCR reactions were performed using either the Expand High Fidelity PCR System (Roche, UK), Extensor Hi-Fidelity PCR master mix with buffer 1 or the ReddyMix version (ABgene, UK) following the manufacturer’s protocols. Primers used are given in Table 1. PCR products from each reaction were gel purified using a QIAGEN QIAquick kit and cloned. The A. nidulans pyrG gene (1.5 kb) was amplified using primers PSM07FP and PSM08RP from pPL6 plasmid (Oakley et al., 1987) with a hot start at 94 °C for 2 min followed by 30 amplification cycles (94 °C for 45 s, 58 °C for 30 s and 68 °C for 1 min 30 s) and cloned into pCR2.1 to give pPSM06. ftmA was amplified from the genomic DNA of A. fumigatus Af293. The entire 8.7 kb fragment of the ftmA with the 50 UTR (1.5 kb), CDS (6.6 kb) and the 30 UTR (657 bp) was cloned in two steps. The 50 end was amplified using primer PSM14FP and PSM15RP and the 30 end with PSM16FP and PSM17RP with a hot start at 94 °C for 2 min followed by 10 amplification cycles (94 °C for 15 s, 58 °C for 30 s and 68 °C for 3 min) then 20 amplification

cycles (94 °C for 15 s, 58 °C for 30 s and 68 °C for 3 min). The fragments were individually cloned in pCR2.1 to give pPSM01 and pPSM02, respectively, and sequenced to confirm sequence integrity. pPSM01 was digested with XbaI and HindIII and the resulting fragment was ligated into pBluescriptSK+ digested with the same enzymes to give pPSM09. pPSM02 was digested with HindIII and KpnI and the resulting HindIII–KpnI fragment was ligated into pPSM09 digested with same enzymes to give pPSM10. A. nidulans pyrG from pPSM06 was excised with SpeI–NotI and cloned into pPSM10 cut with XbaI–NotI to give pPSM11. A. nidulans alcA (438 bp) was amplified from pMZA1 (Zarrin et al., 2005) using the primers PSM26FP and PSM27RP (Table 1) and cloned into pCR2.1 to give pPSM13. These primers carry PshAI and Acc65I restriction sites on it for the ease of cloning alcA from pPSM13 into pPSM11 to replace native ftmA promoter to give pPSM14. ftmB was amplified from A. fumigatus Af293 genomic DNA using the primers PSM40FP and PSM41RP and cloned into pCR2.1 to give pPSM15. A. nidulans alcA was amplified using primers PSM132FP and PSM133RP from pMZA1 and cloned into pCR2.1 to get pPSM22. These primers have BbvCI restriction sites for the ease of cloning alcA from pPSM22 into pPSM15 at BbvCI site in the pro-

438

S. Maiya et al. / Fungal Genetics and Biology 46 (2009) 436–440

5 lm). For separation, the column was run with 10% (v/v) solvent B (CH3OH) in solvent A (H2O) for 5 min, followed by a gradient from 10% (v/v) to 100% B over 30 min. After washing with 100% B for 10 min, the column was equilibrated with 10% (v/v) B for 10 min. The flow rate was at 0.2 ml/min. 2.8. Spectral data of the isolated compounds

Fig. 1. pPSM24. Both ftmA and ftmB are under the control of an alcA promoter. pyrG is a selectable marker for fungal transformation.

moter region of ftmB to get pPSM23. The alcA–ftmB cassette from pPSM23 was released with NotI and ligated into linearised pPSM14 with NotI to give pPSM24 (Fig. 1), which was used to transform A. nidulans. 2.5. Transformation of A. nidulans Aspergillus transformation was carried out using 10–15 lg of DNA as described elsewhere (Punt and van den Hondel, 1992). Protoplasts were released from the mycelia using 1% (w/v) Glucanex 200G (Novozymes Switzerland AG) as the lysing enzyme. Genomic DNA was extracted from purified transformants using a mini beadbeater method and analysed by PCR as described by Wu et al. (2002). 2.6. Extraction and analysis of secondary metabolites After the incubation period, 175 ml ethyl acetate was added to each flask and mixed on a rotary shaker at 200 rpm for 5 min. After filtration through Mira cloth (Calbiochem, USA), the two phases were separated. The ethyl acetate phase was evaporated to dryness on a rotary evaporator at 40 °C and the residue was dissolved in 1 ml methanol. For quantification of brevianamide F and tryprostatin B, the solution obtained was diluted (1:10) with methanol and 15 ll were analysed by RP-HPLC. RP-HPLC analysis was carried out on an Agilent 1100 Series by using a RP-18 column (Agilent Eclipse XDB-C18, 5 lm, 150  4.6 mm) at a flow rate of 1 ml/min. The elution profile was as following: after 2 min with 15% (v/v) of solvent B in A (solvent A: water; B: acetonitrile; both containing 0.3% (w/v) trifluoroacetic acid), a linear gradient from 15% to 70% (v/v) of solvent B in 13 min was used. The column was then washed with 100% of solvent B for 5 min and subsequently equilibrated with 15% (v/v) of solvent B for 5 min. UV absorption of the secondary metabolites was monitored using a Diode Array Detector. 2.7. Spectroscopic data of the isolated compounds Approximately 5 mg of tryprostatin B and 0.5 mg of brevianamide F were used for NMR analysis. The 1H NMR spectra were taken on an Avance DRX 500 (Brucker) spectrometer using CDCl3 as solvent. Positive electrospray ionisation (ESI) mass spectra were obtained from a spectrometer with a ThermoFinnigan TSQ Quantum. The mass spectrometer was coupled with an Agilent HPLC series 1100 equipped with a RP18-column (5 lm, 2  250 mm,

2.8.1. Tryprostatin B 1 H NMR: dppm (CDCl3): 7.94 (br s, NH-1), 7.48 (d, J = 7.6 Hz, H-4), 7.32 (d, J = 7.9, H-7), 7.16 (td, J1 = 7.6, J2 = 1.2, H-6), 7.10 (td, J1 = 7.4, J2 = 1.0, H-5), 5.61 (br s, NH-12), 5.32 (br t, J = 7.3, H-20 ), 4.37 (dd, J1 = 11.5, J2 = 2.7, H-11), 4.06 (br t J = 7.4, H-14), 3.68 (m, H-10, H17), 3.59 (m, H-17), 3.50 (dd, J1 = 16.2, J2 = 7.9, H-10 ), 3.45 (dd, J1 = 16.2, J2 = 7.0, H-10 ), 2.96 (dd, J1 = 15.1, J2 = 11.4, H-10), 2.34 (m, H-19), 2.04 (m, H-18, H-19), 1.92 (m, H-18), 1.79 (s, H-40 ), 1.76 (s, H-50 ). Positive ESI-MS: m/z (intensity): 703 (22, 2M+1), 352 (100, M+1), 284 (15), 296 (27), 198 (60), 130 (25). These data corresponded well to those reported previously (Grundmann and Li, 2005; Cui et al., 1996). 2.8.2. Brevianamide F 1 H NMR: dppm (CDCl3): 8.23 (br s, NH-1), 7.59 (d, J = 7.9, H-4), 7.40 (d, J = 8.2, H-7), 7.24 (td, J1 = 7.9, J2 = 1.0, H-6), 7.15 (td, J1 = 7.9, J2 = 0.7, H-5), 7.11 (d, J = 2.2, H-2), 5.75 (br s, NH-12), 4.38 (dd, J1 = 11.0, J2 = 2.7, H-11), 4.07 (t, J = 7.4, H-14), 3.76 (ddd, J1 = 15.1, J2 = 3.8, J3 = 1.0, H-10), 3.65 (m, H-17), 3.59 (m, H-17), 2.97 (dd, J1 = 15.1, J2 = 11.0, H-10), 2.33 (m, H-19), 2.02 (m, H-18, H-19), 1.91 (m, H-18). Positive ESI-MS: m/z (intensity): 284 (77, M+1), 170 (10), 130 (100). These data corresponded well to those reported previously (Grundmann and Li, 2005; Caballero et al., 2003). 3. Results and discussion 3.1. Construction and analysis of transformant strains Wild-type A. fumigatus Af293 did not produce detectable amounts of fumitremorgins, nor any of the proposed pathway intermediates during prolonged culture on a variety of growth media (Maiya et al., 2006). Overexpression of the NRPS (FtmA) responsible for the first step of the fumitremorgin pathway resulted in the accumulation of brevianamide F (Maiya et al., 2006), but this was not further metabolized to tryprostatin B, despite the presence of a functional coding region for the brevianamide prenyltransferase gene ftmB (Grundmann and Li, 2005), suggesting negligible expression of the gene cluster in the wildtype strain. In order to achieve transcription of ftmA and ftmB, a vector pPSM24 was constructed (Fig. 1). This carries both ftmA and ftmB genes, each under the control of the A. nidulans alcA promoter, together with the selectable marker pyrG from A. nidulans. A. nidulans G191 was transformed, and transformants selected on minimal medium. Genomic DNA from 8 transformants was screened by PCR using diagnostic primers PSM162FP/ PSM163RP, amplifying 986 bp from A. nidulans pyrG and a short stretch of A. fumigatus 50 ftmB sequence, and primers PSM150FP/ PSM151RP amplifying 898 bp from the vector sequence and A. fumigatus 30 ftmB to check for the intact ftmB in the transformants. All A. nidulans transformants analysed showed the expected amplification. The transformants were further screened for intact ftmA using primers PSM46FP/ PSM15RP, which amplify 4595 bp of 50 ftmA and PSM16FP/ PSM47RP which amplify 4372 bp of 30 ftmA. Transformants PSM-An (355)-7, 8 and 10 showed good amplification

439

S. Maiya et al. / Fungal Genetics and Biology 46 (2009) 436–440

for both the set of primers indicating intact ftmA. These transformants were subjected to fermentation. 3.2. Analysis of secondary metabolite accumulation in the transformants After the incubation, the cultures were extracted with ethyl acetate and evaporated to dryness. Culture extracts were dissolved in methanol and were analysed by HPLC using reverse phase C18 column. Elution was carried out with a gradient of water–acetonitrile

containing 0.3% (w/v) trifluoroacetic acid. The HPLC chromatogram of the extracts of the recipient strain A. nidulans G191 did not show any peak corresponding to either brevianamide F or the tryprostatin B grown under repressed and induced conditions. In contrast, the extracts from PSM-An (355)-7, 8 and 10 (Fig. 2 and Table 2) showed a dominant peak at 13 min under induced condition corresponding to the standard tryprostatin B used which is expected to be accumulated by a successful co-expression of both ftmA and ftmB under PalcA. In addition, a further peak at 8 min corresponded to that of brevianamide F was also detected in the extracts of these transformants. Brevianamide F is the product of FtmA and substrate of FtmB (Scheme 1) and is expected after a successful expression of ftmA and an incomplete conversion to tryprostatin B by FtmB. For structural elucidation, the two peaks at 8 and 13 min were subsequently isolated and subjected to ESI-MS and NMR analysis. Comparison of the 1H NMR spectra of the isolated compounds with those of brevianamide F and tryprostatin B (Grundmann and Li, 2005; Cui et al., 1996; Caballero et al., 2003) proved unequivocally that the isolated compounds are indeed the expected brevianamide F and tryprostatin B. These results were also confirmed by ESI-MS analysis. The yields of tryprostatin B in PSM-An (355)-7, PSM-An (355)-8 and PSM-An (355)-10 under induced conditions were determined at 609.8, 749.9 and 538.4 lmol/L, respectively, corresponding 210 mg/L, 260 mg/L and 176 mg/L, respectively (Table 2). This means a 440 to 650-fold increasing of tryprostatin B production in comparison to that of A. fumigatus BM939 (Cui et al., 1995). Brevianamide F was clearly detectable in all of the transformants under induced conditions, but only 2.7%, 7.8% and 5.1% (molar fraction) of those of tryprostatin B in PSM-An (355)-7, PSM-An (355)-8 and PSM-An (355)-10, respectively. This indicates that the major produced brevianamide F was converted to tryprostatin B. When strains were cultured under conditions which repressed expression of the alcA promoter, no brevianamide F was detected. The detected tryprostatin B was only 0.5% of that produced under induced conditions, indicating tight repression of the promoter. A. nidulans thus provides a convenient naïve host for expression of secondary metabolic genes from other filamentous fungi provided that the precursor pathway(s) is present. This approach is useful for obtaining good yields of secondary metabolic intermediates for elucidation of biosynthetic pathways, and is also a convenient and cost effective way of providing material for pharmacological investigation. Our study shows that fungal genome information can be used effectively for enhancing the production of biologically active natural products, which expands the usefulness of genome sequences and provides a new strategy for drug discovery. This is even more important for genes and gene clusters which are expressed only weakly in their natural hosts, such that no corresponding second-

Table 2 Accumulation of brevianamide F and tryprostatin B in Aspergillus nidulans strains. Brevianamide F

Under induced conditions PSM-An (355)-8 PSM-An (355)-7 PSM-An (355)-10 G191 (wild type)

Fig. 2. HPLC analysis of secondary metabolites from A. nidulans cultures. Extracts of PSM-An(355)-8, recipient strain G191 under inducing conditions, compared with standards for brevianamide F and tryprostatin B.

Tryprostatin B

lmol/l

mg/l

lmol/l

mg/l

58.6 16.2 27.2 <0.1

16.6 4.6 7.7

749.9 609.8 538.4 <0.1

264.0 214.6 189.5

3.7 1.4 1.4 <0.1

1.3 0.5 0.5

Under repressed conditions PSM-An (355)-10 <0.1 PSM-An (355)-8 <0.1 PSM-An (355)-7 <0.1 G191 (wild type) <0.1

440

S. Maiya et al. / Fungal Genetics and Biology 46 (2009) 436–440

ary metabolites can be detected following fermentation. It was recently shown that expression from secondary metabolic clusters could also be improved by increasing expression of an associated pathway-specific transcription factor (Bergmann et al., 2007). However, many putative secondary metabolic clusters, including the fumitremorgin cluster, have no associated transcription factor, and increased expression can be achieved only by increasing the copy number (Maiya et al., 2006) or increasing the transcription of individual genes. Acknowledgments SM was supported by an ORS award from the University of Sheffield. This work was supported by a grant from the Deutsche Forschungsgemeinschaft to S.-M. Li. References Ballance, D.J., Turner, G., 1985. Development of a high-frequency transforming vector for Aspergillus nidulans. Gene 36, 321–331. Bergmann, S., Schumann, J., Scherlach, K., Lange, C., Brakhage, A.A., Hertweck, C., 2007. Genomics-driven discovery of PKS–NRPS hybrid metabolites from Aspergillus nidulans. Nat. Chem. Biol. 3, 213–217. Caballero, E., Avendañno, C., Menéndez, J.C., 2003. Brief total synthesis of the cell cycle inhibitor tryprostatin B and related preparation of its alanine analogue. J. Org. Chem. 68, 6944–6951. Cui, C.B., Kakeya, H., Okada, G., Onose, R., Ubukata, M., Takahashi, I., Isono, K., Osada, H., 1995. Tryprostatins A and B, novel mammalian cell cycle inhibitors produced by Aspergillus fumigatus. J Antibiot. 48, 1382–1384 (Tokyo). Cui, C.B., Kakeya, H., Osada, H., 1996. Novel mammalian cell cycle inhibitors, tryprostatins A, B and other diketopiperazines produced by Aspergillus fumigatus. II. Physicochemical properties and structures. J Antibiot. 49, 534–540 (Tokyo). Felenbok, B., Flipphi, M., Nikolaev, I., 2001. Ethanol catabolism in Aspergillus nidulans: a model system for studying gene regulation. Prog. Nucleic Acid Res. Mol. Biol. 69, 149–204. Grundmann, A., Li, S.M., 2005. Overproduction, purification and characterization of FtmPT1, a brevianamide F prenyltransferase from Aspergillus fumigatus. Microbiol. 151, 2199–2207.

Keller, N.P., Turner, G., Bennett, J.W., 2005. Fungal secondary metabolism – from biochemistry to genomics. Nat. Rev. Microbiol. 3, 937–947. Kennedy, J., Turner, G., 1996. delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase is a rate limiting enzyme for penicillin production in Aspergillus nidulans. Mol. Gen. Genet. 253, 189–197. Maiya, S., Grundmann, A., Li, S.M., Turner, G., 2006. The fumitremorgin gene cluster of Aspergillus fumigatus: identification of a gene encoding brevianamide F synthetase. Chembiochem 7, 1062–1069. Nierman, W.C., Pain, A., Anderson, M.J., Wortman, J.R., Kim, H.S., Arroyo, J., Berriman, M., Abe, K., Archer, D.B., Bermejo, C., Bennett, J., Bowyer, P., Chen, D., Collins, M., Coulsen, R., Davies, R., Dyer, P.S., Farman, M., Fedorova, N., Feldblyum, T.V., Fischer, R., Fosker, N., Fraser, A., Garcia, J.L., Garcia, M.J., Goble, A., Goldman, G.H., Gomi, K., Griffith-Jones, S., Gwilliam, R., Haas, B., Haas, H., Harris, D., Horiuchi, H., Huang, J., Humphray, S., Jimenez, J., Keller, N., Khouri, H., Kitamoto, K., Kobayashi, T., Konzack, S., Kulkarni, R., Kumagai, T., Lafon, A., Latge, J.P., Li, W., Lord, A., Lu, C., Majoros, W.H., May, G.S., Miller, B.L., Mohamoud, Y., Molina, M., Monod, M., Mouyna, I., Mulligan, S., Murphy, L., O’Neil, S., Paulsen, I., Penalva, M.A., Pertea, M., Price, C., Pritchard, B.L., Quail, M.A., Rabbinowitsch, E., Rawlins, N., Rajandream, M.A., Reichard, U., Renauld, H., Robson, G.D., Rodriguez de Cordoba, S., Rodriguez-Pena, J.M., Ronning, C.M., Rutter, S., Salzberg, S.L., Sanchez, M., Sanchez-Ferrero, J.C., Saunders, D., Seeger, K., Squares, R., Squares, S., Takeuchi, M., Tekaia, F., Turner, G., Vazquez de Aldana, C.R., Weidman, J., White, O., Woodward, J., Yu, J.H., Fraser, C., Galagan, J.E., Asai, K., Machida, M., Hall, N., Barrell, B., Denning, D.W., 2005. Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 438, 1151– 1156. Oakley, B.R., Rinehart, J.E., Mitchell, B.L., Oakley, C.E., Carmona, C., Gray, G.L., May, G.S., 1987. Cloning, mapping and molecular analysis of the pyrG (orotidine-50 phosphate decarboxylase) gene of Aspergillus nidulans. Gene 61, 385–399. Punt, P.J., van den Hondel, C.A., 1992. Transformation of filamentous fungi based on hygromycin B and phleomycin resistance markers. Methods Enzymol. 216, 447–457. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, New York. Usui, T., Kondoh, M., Cui, C.B., Mayumi, T., Osada, H., 1998. Tryprostation A, a specific and novel inhibitor of microtubule assembly. Biochem. J. 333, 543–548. Wu, Z., Blomquist, G., Westermark, S.O., Wang, X.R., 2002. Application of PCR and probe hybridization techniques in detection of airborne fungal spores in environmental samples. J. Environ. Monit. 4, 673–678. Yamazaki, M., Suzuki, S., Miyaki, K., 1971. Tremorgenic toxins from Aspergillus fumigatus Fres. Chem. Pharm. Bull. 19, 1739–1740 (Tokyo). Zarrin, M., Leeder, A.C., Turner, G., 2005. A rapid method for promoter exchange in Aspergillus nidulans using recombinant PCR. Fungal Genet. Biol. 42, 1–8.