Improving the specific activity and thermo-stability of alkaline pectate lyase from Bacillus subtilis 168 for bioscouring

Biochemical Engineering Journal 129 (2018) 74–83

Contents lists available at ScienceDirect

Biochemical Engineering Journal journal homepage: www.elsevier.com/locate/bej

Full Length Article

Improving the specific activity and thermo-stability of alkaline pectate lyase from Bacillus subtilis 168 for bioscouring Xiaowen Wang 1 , Zhenghui Lu 1 , Ting Xu, Jonathan Nimal Selvaraj, Li Yi, Guimin Zhang ∗ Hubei Collaborative Innovation Center for Green Transformation of Bio-Resources, The College of Life Sciences, Hubei University, Wuhan, 430062, China

a r t i c l e

i n f o

Article history: Received 25 August 2017 Received in revised form 25 October 2017 Accepted 2 November 2017 Keywords: Pectate lyase Specific activity Rational design Directed evolution Bioscouring

a b s t r a c t Biocatalysts requires enzymes with high activity and stability under process conditions for efficient application. Several protein improvement strategies were used to improve pectate lyase PEL168 from Bacillus subtilis. Initially, a rationally designed mutant V132F obtained showed 1.7-fold increase in activity with wider pH stability. Meanwhile, highly advantageous mutant K47E selected from a random mutagenesis library displayed 1.8-fold increase in activity, and half-life increased by 2.0-fold at 50 ◦ C (T50 ). The additive effect of these two advantageous mutants K47E/V132F showed 2.2-fold increase in activity than PEL168. To identify beneficial substitution at 47th position, a smarter library was constructed by site-saturated mutagenesis of K47E/V132F, and generated K47D/V132F mutant having 3.9-fold improvement in specific activity than PEL168. Furthermore, R272W was introduced to K47D/V132F based on evolutionary trace analysis. The K47D/V132F/R272W specific activity reached to 5610 U/mg at 1 mM Ca2+ , showing highest activity of reported alkaline pectate lyases, with T50 extended to 330 min. Structure comparisons revealed that a much open catalytic clef and increased structure compactness of K47D/V132F/R272W were the main contributors for increased specific activity and stability, respectively. The bioscouring assay showed that K47D/V132F/R272W can significantly improve the wettability and softness of fabrics, suggesting its potential application in textile industry. © 2017 Elsevier B.V. All rights reserved.

1. Introduction The textile industry has played an important role in the economic growth of developing countries and continue to occupy an important place in terms of its contribution to national output, employment and exports. In today’s context, textile industry is facing huge challenges due to increase in stringent environmental standards and various environmental and health legislations, as several hazardous chemicals were used in the processing of textile fibers to produce the textile end product [1]. Techniques like degumming and scouring are commonly used for ramie fibers and cotton fibers processing in the textile industry, respectively. Degumming removes heavily coated, non-cellulosic gummy material from the cellulosic part of ramie fibers. Scouring is a process to remove undesirable non-cellulosic impurities like pectin and waxes selectively from the cotton fibers [2]. Traditionally, degum-

∗ Corresponding author at: The College of Life Sciences, Hubei University, No. 368 Youyi Road, Wuchang District 430062, Wuhan, China. E-mail addresses: [email protected], [email protected] (G. Zhang). 1 Xiaowen Wang and Zhenghui Lu contributed equally to this article. https://doi.org/10.1016/j.bej.2017.11.001 1369-703X/© 2017 Elsevier B.V. All rights reserved.

ming and scouring processes occurs under high alkaline and high temperature conditions (pH 10 and 95 ◦ C), which involves high energy consumption, and fiber damage, and the decontamination of alkali water waste after the processes by conventional sewage treatment is challenging and expensive [3]. Pectate lyase (Pels) (EC 4.2.2.2) belongs to pectin depolymerizing enzymes which involves in non-hydrolytic breakdown of pectates, cleaving ␣ (1-4)-linked galacturonate units of pectate by ␤-elimination, leading to unsaturated C-4-C-5 double bond at the non-reducing end of the newly formed oligo-galacturonate [4]. Pectate lyases are widely found expressed in bacteria [5], yeast [6], fungi [7] and actinomycetes [8]. During the last several decades, the use of pectinases in pectin based industries, such as coffee and tea fermentation, oil extraction, and treatment of industrial waste water containing pectinacious material, is highly prevalent [9]. It was known that using pectate lyase in degumming or scouring process have more advantages like generating high-quality fibers, energy efficiency in the process, and eco-friendly environment [10]. As alkaline condition is critical for effective degumming and fiber quality improvement, alkaline pectate lyase attracted both the academic and industrial communities, providing possibility for developing enzyme-based degumming and scouring in textile industry. In recent years, many alkaline Pels genes have been

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83 Table 1 Plasmids used in the study.

75

Table 2 Primers used in the study.

Plasmids

Illustration

Primers

Sequence(5 -3 )

pET28a pET28a-pel168 pET28a-pel168 V132F

Commercial plasmid pET28a carrying pel168 gene pET28a carrying pel168 gene with mutation V132F pET28a carrying pel168 gene with mutation K47E pET28a carrying pel168 gene with mutations K47E and V132F pET28a carrying pel168 gene with mutations K47D and V132F pET28a carrying pel168 gene with mutations K47D, V132F and R272W

eppel-F eppel-R V132F-F V132F-R K26E/A27D-F K26E/A27D-R L3F-F L3F-R K47E-F K47E-R R272W-F R272W-R R272Y-F R272Y-R 47BH1-F 47BH1-R 47BH2-F 47BH2-R 47BH3-F 47BH3-R 47BH4-F 47BH4-R

GCGTCGACGAGCTGAT ATAAGAATGCGGCCGCTTAAT CTGCAAACACGACGATCTTCGGTTCAG CTTTAGCGTTAGTCCCTGAACCGAAGATC GCACGACAGGCGGATCACAAGACTCCTCC ATACACATTTGAGGAGGAGTCTTGTGATC GCTGATTTCGGCCACCAGACGTTG GATCCCAACGTCTGGTGGCCGAAATC GCTTGTCTCGGCATTAGGGGAGGAAAC GCGTTGTGTTCGTTTCCTCCCCTAATG AAATTACGCTGCATCATAACTGGTATAAA CGCGCTGGACAATATTTTTATACCAGTTA AAAATTACGCTGCATCATAACTATTATAAA CGCGCTGGACAATATTTTTATAATAGTTA GCTTGTCTCGGCATTAGGGVMAGAAACG GCGTTGTGTTCGTTTCTKBCCCTAATG AGCTTGTCTCGGCATTAGGGNDTGAAAC GGCGTTGTGTTCGTTTCAHNCCCTAATG GCTTGTCTCGGCATTAGGGATGGAAACG GGCGTTGTGTTCGTTTCCATCCCTAATG GTCTCGGCATTAGGGTGGGAAACGAAC TTGGCGTTGTGTTCGTTTCCCACCCTAA

pET28a-pel168 K47E pET28a-pel168 K47E/V132F pET28a-pel168 K47D/V132F pET28a-pel168 K47D/V132F/R272W

cloned from alkaliphilic microorganisms and metagenomic DNA from alkaline environment soils, and the enzymes were expressed in various hosts like Bacillus, Escherichia coli and Pichia pastoris [11–19]. However, few of these wild type enzymes can efficiently catalyze the process under natural conditions, which are industrially convenient and economically cost effective. Enzyme-based bioscouring is still in laboratory scale, which is not yet to be applied on industrial scale. But there is a need for pectinases with higher activity and stability at high temperatures and alkaline conditions [20]. Till date, protein engineering strategies like directed evolution and rational design have been utilized to improve Pels’ characteristics [21,22]. In our previous study, an alkaline pectate lyase PEL168 from Bacillus subtilis expressed in E. coli showed specific activity of 353 U/mg. Bio-degumming of ramie fiber by PEL168 could efficiently remove pectin from ramie and produce soft and white fibers [23]. But the enzyme activity and stability of PEL168 needs further improvement, so to reduce the costs and processing time in industrial application. In this study, different protein engineering strategies were applied to improve the activity and stability of PEL168, and the final engineered mutant exhibited significant improvement in specific activity, catalytic efficiency, thermal stability, and wider stable pH range. The final engineered mutant can significantly improve the wettability and softness of fabrics in the bioscouring assay, suggesting its potential future application in textile industry. 2. Materials and methods 2.1. Bacterial strains, plasmid and materials E. coli XL-Gold, Rosetta (DE3) were purchased from Invitrogen. The plasmid pET28a-pel168 was earlier constructed in our lab [23]. Restriction enzymes, DNA polymerases and T4 DNA ligase were purchased from Takara (Dalian, China). Polygalacturonic acid (PGA) and pectin were purchased from Sigma-Aldrich (St. Louis, USA). All chemicals were of analytical grade and obtained from commercial suppliers. The plasmids used in this study were displayed in Table 1.

Restriction sites were underlined. Mutation sites were in bold.

55 ◦ C for 1 min, and 72 ◦ C for 7 min, followed by a final extension step at 72 ◦ C for 5 min. The PCR products were digested by Dpn I at 37 ◦ C for 2 h and the enzyme was inactivated at 70 ◦ C for 15 min and transformed into E. coli Rosetta (DE3). Site-saturation mutagenesis steps were similar as described above, but with four pairs of primers separately and transformed into E. coli Rosetta (DE3) by electroporation. About 100 transformants were recovered, forming the site-saturation mutagenesis library. The clones were randomly picked and sequenced, and mutations at the indicated position were confirmed. DNA sequencing was performed by GenScript Co. Ltd. (Nanjing, China). 2.3. Construction of random mutagenesis library The random mutagenesis library was generated by the errorprone PCR (ep-PCR) method using the primers eppel-F and eppel-R (Table 2). PCR amplification was carried out using Ni-Taq DNA polymerase (NEWBIO industry, China), with an additional 5 mM MnCl2 , 50 mM MgCl2 , 10 mM dATP, 10 mM dCTP, 10 mM dGTP, 100 mM dTTP and 0.1 ␮g/␮L BSA in the reaction buffer, and pel168 was amplified from pET28a-pel168. The following PCR reaction was used: 1 cycle of 94 ◦ C for 5 min and 30 cycles of 91 ◦ C for 30 s, 55 ◦ C for 30 s, and 72 ◦ C for 1 min, followed by a final extension at 72 ◦ C for 5 min. The PCR product was purified and ligated into vector pET28a after digestion with Sal I and Not I, and transformed into E. coli Rosetta (DE3) by electroporation to establish random mutagenesis library. Randomly picked clones from this library were sequenced to calculate the efficiency of mutation. 2.4. Variants library screening

2.2. Site-directed mutagenesis Site-directed mutagenesis and site-saturation mutagenesis were performed according to the whole plasmid PCR method [24] with Pyrobest DNA polymerase according to the manufacturer’s instruction. Primers for site-directed mutagenesis containing the appropriate base substitutions and the primers for site-saturation mutagenesis were listed in Table 2. Site-directed mutagenesis were carried out by PCR with 50 ng plasmid as template (pET28a-pel168), 10 ␮mol primer pairs, 0.25 mM dNTPs, and 1 ␮L Pyrobest DNA polymerase to a final volume of 50 ␮L. The following PCR reaction steps were used: 1 cycle of 94 ◦ C for 5 min and 17 cycles of 94 ◦ C for 30 s,

The single colonies in the library were picked onto the LB plate (50 ␮g/mL kanamycin), 1% pectin and 0.5 mM IPTG, cultured at 37 ◦ C overnight. All the single colonies were replicated in another LB plate (50 ␮g/mL kanamycin) for backup. For observing the halo formation around the single colony, about 20 mL of 1% CTAB was added to the pectin plate. The single colony on the copied LB plates was picked with respect to the colony which forms the halo on the pectin plates and inoculated into 96-well plates with 200 ␮L LB medium (50 ␮g/mL kanamycin). The plates were incubated (37 ◦ C, 900g) for 12 h, and then induced by 0.5 mM IPTG. After 3 h of induction at 37 ◦ C, the cells were harvested by centrifugation (4000g,

76

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83

10 min, 4 ◦ C), and resuspended in lysis buffer (50 mM Tris–HCl buffer, 150 mM NaCl, 1% Triton X-100, 50 mg/mL lysozyme, pH 7.4), and incubated at 37 ◦ C for 2 h. After centrifugation (4000g, 10 min, 4 ◦ C), the supernatant was transferred into another 96 well plates and was assayed for enzymatic reactions. The reactions were performed in 96-wells plate. The diluted crude enzyme extract (10 ␮L) was incubated with 200 ␮L 0.2% PGA dissolved in 50 mM glycine/NaOH buffer (pH 9.5) at 55 ◦ C for 15 min, and the reaction was stopped by 100 ␮L 0.03 M phosphoric acid buffer. The products were measured by absorbance at 235 nm. The mutants with improved activities were selected for rescreening in shake flask cultures to confirm the enzyme activity improvement. 2.5. Expression and purification of PEL168 and mutants Each single colony of E. coli Rosetta (DE3) harboring a plasmid carrying the gene encoding wild-type or mutant was cultured in LB medium containing kanamycin (50 ␮g/mL) at 37 ◦ C and induced by 0.5 mM IPTG, when the OD600 reached 0.6–0.8. After cultivation at 18 ◦ C overnight, cells were harvested by centrifugation at 4000g for 10 min and disrupted by sonication in lysis buffer (0.5 M NaCl, 20 mM Tris–HCl, 5 mM imidazole, pH 7.9). Cell debris was removed by centrifugation at 12,000g, 4 ◦ C for 15 min. The supernatants were loaded onto a pre-equilibrated Ni superflow column (Clontech laboratories, Inc.), and the column was washed with washing buffer (25 mM Tris–HCl, 150 mM NaCl, 20 mM imidazole, pH 9.5). The bound protein was eluted by using elution buffer (25 mM Tris–HCl, 150 mM NaCl, 250 mM imidazole, pH 9.5). The protein solution was desalted using a desalting column (GE Healthcare BioSciences AB, Uppsala, Sweden) with 20 mM Tris-HCl buffer (pH 9.5). The protein concentration was measured by Bradford method, the purity of the proteins was assayed by SDS-PAGE (Fig. 1S). 2.6. Sequence alignment The DNAMAN was used to align the PEL168 protein sequence with the other known five thermostable alkaline pectate lyase sequences. The thermostable candidates included Bsp165PelA from Bacillus sp. N16-5 with higher specific activity of 1000 U/mg (GenBank accession number: ACY38198) [25], pectate lyase C from Erwinia chrysanthemi with specific activity of 622 U/mg (GenBank accession number: P11073) [18], pectate lyase from Thermotoga maritima MSB8 with specific activity of 422 U/mg at 90 ◦ C, pH 9.0 and also with a half-life at thermal inactivation for 2 h at 95 ◦ C (GenBank accession number: AAD35518) [26], pectate lyase 47 from Bacillus sp. TS-47 with optimal temperature at 70 ◦ C (GenBank accession number: BAB40336) [27] and pectate lyase from Bacillus sp. RN1 with optimal temperature at 90 ◦ C (GenBank accession number: BAG12908) [28]. 2.7. Enzyme assay and determination of kinetic parameters For the assay of PEL activity of forming unsaturated products, 20 ␮L of diluted purified enzyme was added into 2 mL of preheated 0.2% (w/v) PGA in 50 mM glycine-NaOH buffer (pH 9.5) and incubated at 55 ◦ C for 15 min and the reaction was stopped by addition of 3 mL of 0.03 M phosphoric acid buffer. Activity was determined by measuring the absorbance at 235 nm. One unit of enzyme activity was defined as the amount of enzyme capable of releasing 1 ␮mol unsaturated galacturonic acid from PGA per minute under the assay conditions, with a molar extinction coefficient of 4600 M−1 cm−1 . The kinetic parameters of PEL were determined at 55 ◦ C in 50 mM glycine–NaOH buffer (pH 9.5) and reactions were performed for 3 min with 0.1 ␮g/mL enzyme and the concentration of PGA

Fig. 1. (a) The three-dimensional structure of the wild-type pectate lyase PEL168. K26 and A27 were shown in yellow, V132 was shown in green, D170 and D173 were shown in red, E101 was shown in pink, the active sites (K247, R279, R284) were shown in gray; (b) The pH stability of PEL168 and mutant V132F. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

from 0.2 to 0.6 mg/mL, in which the enzyme activity remained linear (SHIMADZU UV2550). The Km and Vmax were calculated through Lineweaver-Burk, all data were averages of triplicate measurements. 2.8. Analysis the 3D structure The structure of wild-type PEL168 (PDB accession no. 1BN8) was described previously by Richard et al. [29]. To investigate the structural changes responsible for the improved specific activity and stability. The three-dimensional (3D) structure of the mutants were simulated using MODELLER [30]. The 3D structure comparison and analysis were performed using Discovery Studio clients (Accelrys Inc., San Diego, CA). 2.9. Bioscouring Bioscouring of fabric by the PEL was evaluated by measuring the wettability of gray cloth after enzymatic scouring. The process of enzymatic scouring was as follows: 8.0 cm × 8.0 cm of gray cloth was bathed in 150 mL of 50 mM glycine-NaOH buffer (pH 9.5) with purified enzymes and incubated at 50 ◦ C for 4 h. Similar size of gray cloth was bathed in 150 mL of 50 mM glycine-NaOH buffer (pH 9.5) without adding enzymes served as a control. After enzymatic treat-

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83

77

Table 3 Specific activity and kinetic parameters of PEL168 and its mutants. Mutant name

Specific activity (U mg−1 )

Km (g L−1 )

Kcat (s−1 )

Kcat /Km (L g−1 s−1 )

Wild-type/PEL168 V132F K47E K47E/V132F K47D/V132F K47D/V132F/R272W

353.6 ± 25.6 625.9 ± 34.2 640.8 ± 24.3 873.3 ± 65.3 1388.4 ± 33.6 1544.4 ± 45.7

0.47 ± 0.01 0.30 ± 0.01 0.31 ± 0.02 0.30 ± 0.02 0.30 ± 0.02 0.29 ± 0.03

241.4 ± 11.0 354.3 ± 21.1 356.4 ± 23.3 364.7 ± 42.5 389.9 ± 26.1 460.6 ± 31.2

513.4 ± 25.3 1179.4 ± 63.2 1144.2 ± 124.8 1216.5 ± 135.3 1318.6 ± 97.5 1567.7 ± 137.1

ment, gray clothes were washed and knead to remove residual gum from the surface of the gray clothes. Then the fabric was dried at a constant drying temperature at 105 ◦ C. To evaluate the wettability of gray cloth, 200 ␮L of water was dripped down vertically to the gray clothes at the same height, and the area of the wet circle was measured. Scanning electron microscopy (SEM) was used to observe the microstructure and surface morphology of untreated and enzymetreated gray clothes. The samples were coated with a 200-Å gold layer by using a vacuum sputter, and samples were then observed by SEM (JSM6510LV, Japan).

introduced by mutating both D170 and D173 to cysteine. However, the D170C/D173C mutant lost its activity completely, indicating the key roles of D170 and D173 in maintaining the functional structure of pectate lyase. Another attempt was performed by replacing E101 with proline to increase its structural flexibility, as E101 was located in the turn of a random coil [32]. Surprisingly, similar to the D170C/D173C mutant, the E101P mutation caused a dramatic decrease in enzyme’s activity.

3.2. Engineering PEL168 by random mutagenesis and high-throughput screening

3. Results 3.1. Construction and characterization of structure-based design of PEL168 mutants As PEL168 structure (PDB accession no. 1BN8) has been determined (Fig. 1a), four attempts were initially performed to improve the enzyme properties of PEL168 by rational protein engineering. First, the structure compactness, which is often correlated with protein thermo-stability, was increased by creating mutation K26E and A27D to form salt bridges with H5. However, the mutant K26E/A27D displayed very low enzyme activity. Then, the local hydrophobicity of PEL168 was engineered, the V132 was replaced with phenylalanine, which is one of the most hydrophobic amino acid. Enzymatic characterization showed that mutant V132F exhibited a 1.7-fold increase in specific activity (Table 3) and wider stable pH range from 7–10 to 3–10, compared to PEL168 (Fig. 1b). The results indicatd that both the PEL168 and mutant V132F exhibited good stability from 7 to 10. The kinetic analysis showed that mutant V132F holds higher affinity and catalytic efficiency for substrate PGA, with the decrease in Km value by 36.2% and increase in Kcat value by 46.8% compared to PEL168 (Table 3). In addition, guided by the software Disulfide by Design 2.0 [31], a disulfide bond was

Despite the availability of PEL168 structure, the complexity of structure/function relationship in enzymes has limited our ability to predict mutations’ effects on enzyme stability and activity. Therefore, random mutagenesis was chosen for finding targets or ‘weak spots’ to improve properties of PEL168 at the same time. A random mutagenesis library containing 11,000 colonies, with the mutation rate of 0.3% (calculated by sequencing for 15 randomly picked transformants), was constructed by error-prone PCR. A CTAB indicator plates were used to screen colonies with comparable halos with wild-type strain (Rosetta (DE3)/pET28a-pel) (Fig. 2S). Nearly 32% of the transformants were selected at the initial round screening and inoculated into 96-well plate for further analysis. Finally, five colonies showing higher PEL activity under the assay conditions were isolated and sequenced. Characterization of these six purified PEL168 variants showed that K47E is the most advantageous mutation resulting in a 1.8-fold increase in specific activity and a 2.0-fold increase in the half-life at 50 ◦ C, when compared to PEL168 (Table 3 and Fig. 2). Kinetic analysis showed that K47E has higher affinity and turnover number for substrate PGA compared to PEL168, indicated by a 34.0% decrease in Km value and a 47.6% increase in Kcat value (Table 3). The other four purified variants displayed lower specific activity than that of PEL168. The

Fig. 2. The thermo-stability of the wild-type PEL168 and mutants at 50 ◦ C.

78

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83

Fig. 3. The multiple alignment of protein sequences of thermostable alkaline pectate lyases with PEL168. Stars represent the conserved catalytic residues; Triangles represent the residues involved in calcium ion binding; Arrows represent the mutation site in this study.

specific activity of wild-type PEL168 and its mutants could be found in Supplementary Table 1S. 3.3. Combination of beneficial mutations derived from rational design and random mutagenesis It’s generally recognized that combination of individual mutations are additive as long as the mutated residues do not interact [33,34]. To check out whether these two beneficial mutations V132F and K47E are additive, site-directed mutagenesis was conducted to create the combinational mutant K47E/V132F, which displayed a 2.2-fold increase in specific activity compared to PEL168, 1.4-fold to V132F, and 1.4-fold to K47E (Table 3). The Km value of K47E/V132F decreased by 36.2% and the Kcat value increased by 51.1% compared with PEL168 (Table 3). These results demonstrated that the combinational mutant was superior than the individual mutants, namely mutation V132F and K47E are additive. 3.4. Targeted engineering of K47E/V132F via semi-rational approach In-depth understanding of structure/function relationships of enzymes is not quite often available, so the workload of screening random libraries increases exponentially with the number of mutation sites [35]. The knowledge of mutational process obtained from random mutagenesis becomes extremely valuable for identifying mutational ‘weak spots’ to guide further enzyme modification [36,37]. The mutant K47E exhibited the highest specific activity among mutants screened from the random mutagenesis library, indicating that position 47 is a mutational ‘weak spot’, which might play a role in enzyme activity. To find the most beneficial substitution at position 47, site-saturation mutagenesis at this site

in mutant K47E/V132F was conducted. The library was screened on CTAB indicator plates, and five clones were chosen based on the diameter of halos. These mutants were purified and characterized. K47D/V132F mutant displayed a 3.9-fold and 1.6-fold increase in specific activity when compared to PEL168 and K47E/V132F mutant, respectively (Table 3). The Km value of K47D/V132F was nearly similar with K47E/V132F, while the catalytic efficiency (Kcat /Km , L g−1 s−1 ) increased from 1216 to 1318 (Table 3). The specific activities of other four developed mutants were relatively lower than K47E/V132F (Table 2S).

3.5. Targeted mutation guided by evolutionary trace method The evolutionary trace method is a predictive technique based on mutational evolutionary analysis to pinpoint functionally important residues in proteins with known structure [38]. To generate an evolutionary trace, multiple sequence alignment of PEL168 with other characterized alkaline and thermo-stable homologs from thermophile bacteria was performed. This method identified 278K, 312R and 317R as the conserved catalytic triad in PELs, and three highly conserved residues 214D, 254D and 258D were involved in calcium ion binding (Fig. 3). The distinct variation in the trace between PEL168 and other homologs were located at site 305, where the neutral aromatic amino acid (W/Y) in the homologs was ‘mutated’ to a positively charged amino acid (R272) in PEL168. Structurally, R272 is located near the active center. We speculated that W/Y at position 272 is the functionally important residue to the thermo-stability of homologs. For confirmation, the R272 in K47D/V132F mutant was mutated to W and Y via site-directed mutagenesis to produce K47D/V132F/R272W and K47D/V132F/R272Y, respectively. Enzymatic characterization showed that mutation R227W have a positive effect on mutant

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83

79

Fig. 4. The effects of calcium ions on the wild-type and variants enzyme activities.

activity and stability. Compared with K47D/V132F, the specific activity and catalytic efficiency of K47D/V132F/R272W mutant was increased by 1.1-fold and 1.2-fold (Table 3), respectively, and T50 value was extended from 4.2 h to 5.6 h (Fig. 2). While mutation R272Y was detrimental to enzyme activity, and its properties were not further characterized.

sample were smoother than those of untreated, suggesting that most of gum-like materials were removed by the enzyme. These results demonstrated that K47D/V132F/R272W mutant could be efficiently applied in bioscouring.

3.6. Effects of mutations on the relationship between activity and calcium concentration

White Biotechnology uses enzymes to conduct ‘green chemistry’ by replacing high energy consuming, hazardous and toxic chemical processes [37], which contributes substantially to the global economic growth and to establish an sustainable society. One best example of white biotechnology is the use of enzymes for fiber processing in textile industry, which could significantly reduce chemical pollutants and improve the final product quality. Alkaline pectate lyases is known for its potential application in developing the enzyme-based degumming and scouring process in textile industry. Actually, several pectate lyases coming from B. pumilus BK2, Clostridium thermocellum and B. subtilis WSHB04-02 have been well applied in bioscouring in the laboratory settings [13,40,41]. However, enzymes have been adapted to their natural evolution environment, which is in general dramatically different from conditions prevailing in the industrial applications. Despite all the research efforts, alkaline pectinase hasn’t been applied widely in bioscouring on industrial scale. Multiple strategies have been developed and utilized to improve enzyme stability and activity, which are two important parameters co-determining the economic feasibility of applying an enzyme in industrial processes, to enable enzymes to efficiently catalyze the reactions under conditions which are industrially convenient and economically advantageous [38,42,43]. In this study, several protein improvement strategies were used to improve properties of PEL168, which was found to be inefficient and instable in our previous study [23]. Despite the availability of PEL168 structure, the complexity of structure/function relationship in enzymes has limited our ability to predict mutations’ effects on enzyme stability and activity. Commonly, the success of rational design was hindered by such complexity. As reported elsewhere, most enzymes elaborated by rational design do not reach the preconceived catalytic performance [44–46]. Gåseidnes et al. designed 15 mutants to increase the kinetic stability of chitinase B from Serratia marcescens (ChiB), only three displayed obvious increase in thermal stability [47]. Jochens et al. designed 7 mutants to convert an esterase from Pseudomonas fluorescens into an epoxide

Most of pectate lyases are Ca2+ -dependent metalloenzyme. The activity of wild-type PEL168 is enhanced by 1 mM Ca2+ with relative activity of 180% [23]. To analyze the effects of mutations on the relationship of enzyme activity and calcium concentration, the relative activity of PEL168 and mutants in the presence of different calcium concentrations (0, 0.2, 0.5, 1, 2 and 5 mM) were assayed. As shown in Fig. 4, the activity of PEL168 peaked at 1 mM Ca2+ , and declined further with the increase in Ca2+ concentration and similar phenomena was also observed in mutants K47E and K47E/V132F, which suggested that they have a low tolerance to calcium. The activity of K47D/V132F/R272W mutant was significantly improved by about 400% in the presence of 1 mM Ca2+ reaching to 5610 U mg−1 , which is significantly higher than the earlier reported highest activity of alkaline pectate lyases pelN (2797 U mg−1 ) from Paenibacillus sp. 0602 [39]. More importantly, the activity of K47D/V132F/R272W remained constant with higher calcium concentrations tested (up to 5 mM). The improved calcium tolerance was also an important quality for bioscouring as discussed later. 3.7. Bioscouring of fabrics The mutant K47D/V132F/R272W has the optimal properties among all mutants, with a 4.4-fold improvement in activity and a 2.5-fold increase in T50 value compared to PEL168. The bioscouring efficiency of K47D/V132F/R272W on gray cloth was evaluated. First, the water drop penetration test was performed as shown in Fig. 5a. The untreated sample did not absorb the drop, while the wettability of bioscouring sample was significantly improved as a result of removing a certain portion of pectin and waxes from the fabrics by K47D/V132F/R272W mutant. Then, the surfaces of fibers were observed by scanning electron microscope (SEM). As shown in Fig. 5b, the fibers’ surfaces of enzyme-treated

4. Discussion

80

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83

Fig. 5. Effects of bioscouring in gray cloth. a, 1: gray cloth treated with mutant K47D/V132F/R272W, 2: gray cloth treated without enzyme (control); b, Scanning electron microscope imaging of bioscouring gray cloth, gray cloth treated with mutant: 1 (250×) and 3 (3000×), control: 2 (250×) and 4 (3000×).

hydrolase, among which only one mutant reached the aim [48]. In this study, only one out four rationally designed mutants possessing desired qualities. And we had failed in our attempt to increase the thermo-stability of PEL168 by improving the structure compactness, which caused significant decrease in activity. One possible explanation is the conformational flexibility plays an important role in catalytic efficiency of PEL168, as reported in other enzymes [38,49]. Directed evolution, without requiring an in-depth mastery of protein folding and dynamics, has become the most frequently utilized approach and has proven to be a powerful tool to manipulate enzyme properties [50,51]. Pectate lyase BpPel from B. pumilus was engineered by site-saturation and random mutagenesis, a mutant M3 exhibited a 3.4-fold higher specific activity and a dramatic increase in T50 from less than 10 min to 13 h [22]. The thermo-stability of BspPelA from Bacillus sp. strain N16-5 was engineered by two rounds of ep-PCR, the most advantageous combined mutant exhibited a 24-fold increase in T50 value (240 min)

and a 23.3% increase in specific activity (2305 U mg−1 ) [21]. On the other hand, several studies in protein engineering have shown that only some point mutations can significantly affect protein stability positively [49,52]. Similar pattern was observed in our result that a single mutation K47E of PEL168 leads to a 2-fold increase in T50 . From an evolutionary perspective, stability differences between homologous enzymes derived from an ancestry protein may be caused mostly by few naturally occurring mutations [46,53]. Concomitantly, the accumulated knowledge of natural hyper-stable proteins has attributed to our analysis of functionally important residues in stability. Therefore, an evolutionary trace of PEL168 with thermo-stable homologs was analyzed, the elevated stability and activity of mutant R272W demonstrated that the conserved residue W272 plays a role in thermos-stable homologs, which was conductive to the engineering of other pectinases. To understand the structural alteration responsible for the improved properties of K47D/V132F/R272W, the structure model

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83

81

Fig. 6. Analysis the 3D structure of the PEL168 mutations. (a) Location of the catalytic triad (K247, R279 and R284, shown in orange) and mutations (K47, V132 and R272, shown in blue); (b) The non-covalent bond between the catalytic triad and the surrounding amino acid of PEL168 (hydrogen bond is shown in green, hydrophobic interaction is shown in purple); (c) The non-covalent bond between the catalytic triad and the surrounding amino acid of K47D/V132F/R272W (hydrogen bond is shown in green, hydrophobic interaction is shown in purple); (d) The spatial distance between catalytic triad of PEL168 (6.960 Å, 4.482 Å and 11.118 Å); (e) The spatial distance between catalytic triad of K47D/V132F/R272W (9.731 Å, 5.597 Å and 12.030 Å); (f) The hydrogen bond on 47th site of PEL168; (g) The hydrogen bond on 47th site of K47E. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

82

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83

of K47D/V132F/R272W was obtained based on the PEL168 structure (PDB accession no. 1BN8) (Fig. 6a). Structure comparisons revealed that the hydrogen bond network and hydrophobic interaction of the catalytic triad were altered as shown in Fig. 6b and c. For example, two hydrogen bonds are newly formed between the catalytic residue K247 and Q255/H222, and a hydrophobic bond is formed between K47 and R279 in K47D/V132F/R272W. As a result, the distances between the catalytic triad were all increased from PEL168 (6.960 Å, 4.482 Å and 11.118 Å) to K47D/V132F/R272W (9.731 Å, 5.597 Å and 12.030 Å) (Fig. 6d and e), generating a much opener catalytic clef for binding substrate and releasing products, which may be mainly responsible for the improved activity. As reported in the benzoate ester hydrolase, a variant with increased catalytic efficiency was successfully constructed by rational design aiming at enlarging the catalytic clef [54]. On the other hand, the total number of hydrogen bonds in mutant was increased from 419 to 509. For example, the K47E substitution introduced two hydrogen bonds between L45 and E47, E47 and E48 (Fig. 6f and g). As hydrogen bond is one of the main determinants in protein thermal stability [55], the increased hydrogen bonds may be the main contributor for the improved stability. The improved calcium tolerance makes K47D/V132F/R272W an excellent candidate for bioscouring in textile industry, as there is no need to remove Ca2+ from the stream, which was added to maintain the full activity and stability of alkaline ␣-amylases that were used in the upstream desizing process [56]. And there is no need for exogenous Ca2+ , as the calcium present in the stream is enough to fully activate K47D/V132F/R272W. In addition, a combined process for desizing and bioscouring of cotton fabrics using amylase and pectate lyase was proposed for saving energy and water and reduce the production cost [57], one of the prerequisites to accomplish this technology is the good calcium tolerance of Pels as Ca2+ must be added to activate amylase. Using expensive enzyme as an industrial biocatalyst often requires its reuse in the repeated production process to lower the cost. For enzyme reuse, enzyme immobilization provides an effective solution that it endows advantages of improved stability, activity, and selectivity, and reduction of inhibition by the products. In fact, the immobilization of pectinases have been studied by different strategies. Nilay Demir et al. immobilized a commercial pectinase using ion exchange resin particles for mash treatment [58]. In addition, Haneef UrRehman et al. reported the immobilization of pectinase from Bacillus licheniformis KIBGE-IB21 in calcium alginate beads for degrading complex carbohydrate [59]. Besides, Mahesh et al. also reported the immobilization of pectinase from Aspergillus ibericus onto functionalized nanoporous activated carbon (FNAC) and investigated its application on the treatment of pectin containing wastewater [60]. It could be believed that with high activity of mutant K47D/V132F/R272W, its immobilization will expand its application yields.

5. Conclusions In conclusion, several protein improvement strategies were utilized to modify the properties of alkaline pectate lyase PEL168, the resultant mutant K47D/V132F/R272W exhibited a 4.4-fold increase in specific activity (from 353 to 1544 U mg−1 ) and a 2.5-fold increase in T50 value (from 2.2 to 5.6 h). The specific activity of K47D/V132F/R272W mutant was significantly activated by 3-fold at the presence of 1 mM Ca2+ , reaching to 5610 U mg−1 , which is the highest activity of alkaline pectate lyases reported by far. K47D/V132F/R272W could effectively soften the surfaces of fabrics and significantly improved the fabrics’ wettability. These properties endow K47D/V132F/R272W as an excellent candidate for bioscouring in textile industry. In the future work, we will

continue to research further on the efficient expression and practical production of the mutant K47D/V132F/R272W, so that the K47D/V132F/R272W can be applied in the industrial scale in biosouring. Funding This work was supported by the National Natural Science Foundation of China (31670069) and Technical innovation special fund of Hubei Provience (2017ACA171). Conflict of interest All the authors declare that they have no conflict of interest. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at https://doi.org/10.1016/j.bej.2017.11.001. References [1] G.S. Hoondal, R.P. Tiwari, R. Tewari, N. Dahiya, Q.K. Beg, Microbial alkaline pectinases and their industrial applications: a review, Appl. Microbiol. Biotechnol. 59 (2002) 409–418. [2] R.S. Jayani, S. Saxena, R. Gupta, Microbial pectinolytic enzymes: a review, Process Biochem. 40 (2005) 2931–2944. [3] Q.K. Beg, B. Bhushan, M. Kapoor, G.S. Hoondal, Production and characterization of thermostable xylanase and pectinase from a Streptomyces sp. QG-11-3, J. Ind. Microbiol. Biotechnol. 24 (2000) 396–402. [4] T. Sakai, T. Sakamoto, J. Hallaert, E.J. Vandamme, Pectin, pectinase, and protopectinase, Prod. Prop. Appl. 39 (1993) 213–294. [5] D.R. Kashyap, S. Chandra, A. Kaul, R. Tewari, Production, purification and characterization of pectinase from a Bacillus sp. DT7, World J. Microbiol. Biotechnol. 16 (2000) 277–282. [6] P. Blanco, C. Sieiro, T.G. Villa, Production of pectic enzymes in yeasts, FEMS Microbiol. Lett. 175 (1999) 1–9. [7] L.K. Huang, R.R. Mahoney, Purification and characterization of an endo-polygalacturonase from Verticillum albo-atrum, J. Appl. Microbiol. 86 (1999) 145–156. [8] F. Bruhlmann, K.S. Kim, W. Zimmerman, A. Fiechter, Pectinolytic enzymes from actinomycetes for the degumming of ramie bast fibers, Appl. Environ. Microbiol. 60 (1994) 2107–2112. [9] P. Kohli, R. Gupta, Alkaline pectinases: a review, Biocatal. Agric. Biotechnol. 4 (2015) 279–285. [10] M. Zou, X. Li, J. Zhao, Y. Qu, Characteristics of polygalacturonate lyase C from Bacillus subtilis 7-3-3 and its synergistic action with PelA in enzymatic degumming, PLoS One 8 (2013) e79357. [11] W.E. Boland, E.D. Henriksen, J. Doran-Peterson, Characterization of two Paenibacillus amylolyticus strain 27C64 pectate lyases with activity on highly methylated pectin, Appl. Environ. Microbiol. 76 (2010) 6006–6009. [12] S.R. Chiliveri, V.R. Linga, A novel thermostable, alkaline pectate lyase from Bacillus tequilensis SV11 with potential in textile industry, Carbohydr. Polym. 111 (2014) 264–272. [13] B.G. Klug-Santner, W. Schnitzhofer, M. Vrsanska, J. Weber, P.B. Agrawal, V.A. Nierstrasz, G.M. Guebitz, Purification and characterization of a new bioscouring pectate lyase from Bacillus pumilus BK2, J. Biotechnol. 121 (2006) 390–401. [14] P. Yuan, K. Meng, P. Shi, H. Luo, H. Huang, T. Tu, P. Yang, B. Yao, An alkaline-active and alkali-stable pectate lyase from Streptomyces sp. S27 with potential in textile industry, J. Ind. Microbiol. Biotechnol. 39 (2012) 909–915. [15] S. Berensmeier, S.A. Singh, J. Meens, K. Buchholz, Cloning of the pelA gene from Bacillus licheniformis 14A and biochemical characterization of recombinant thermostable, high-alkaline pectate lyase, Appl. Microbiol. Biotechnol. 64 (2004) 560–567. [16] P. Yuan, K. Meng, Y. Wang, H. Luo, P. Shi, H. Huang, T. Tu, P. Yang, B. Yao, A low-temperature-active alkaline pectate lyase from Xanthomonas campestris ACCC 10048 with high activity over a wide pH range, Appl. Biochem. Biotechnol. 168 (2012) 1489–1500. [17] X. Li, H. Wang, C. Zhou, Y. Ma, J. Li, J. Song, Cloning, expression and characterization of a pectate lyase from Paenibacillus sp. 0602 in recombinant Escherichia coli, BMC Biotechnol. 14 (2014) 18–27. [18] F. Tardy, W. Nasser, J. Robert-Baudouy, N. Hugouvieux-Cotte-Pattat, Comparative analysis of the five major Erwinia chrysanthemi pectate lyases: enzyme characteristics and potential inhibitors, J. Bacteriol. 179 (1997) 2503–2511. [19] H. Wang, X. Li, Y. Ma, J. Song, Characterization and high-level expression of a metagenome-derived alkaline pectate lyase in recombinant Escherichia coli, Process Biochem. 49 (2014) 69–76.

X. Wang et al. / Biochemical Engineering Journal 129 (2018) 74–83 [20] R. Araujo, M. Casal, A. Cavaco-Paulo, Application of enzymes for textile fibres processing, Biocatal. Biotransfor. 26 (2008) 332–349. [21] C. Zhou, J. Ye, Y. Xue, Y. Ma, Directed evolution and structural analysis of alkaline pectate lyase from the alkaliphilic bacterium Bacillus sp. strain N16-5 to improve its thermostability for efficient ramie degumming, Appl. Environ. Microbiol. 81 (2015) 5714–5723. [22] C. Liang, X. Gui, C. Zhou, Y. Xue, Y. Ma, S.Y. Tang, Improving the thermoactivity and thermostability of pectate lyase from Bacillus pumilus for ramie degumming, Appl. Microbiol. Biotechnol. 99 (2015) 2673–2682. [23] C. Zhang, J. Yao, C. Zhou, L. Mao, G. Zhang, Y. Ma, The alkaline pectate lyase PEL168 of Bacillus subtilis heterologously expressed in Pichia pastoris is more stable and efficient for degumming ramie fiber, BMC Biotechnol. 13 (2013) 26. [24] W. Wang, B.A. Malcolm, Two-stage polymerase chain reaction protocol allowing introduction of multiple mutations, deletions, and insertions, using QuikChange TM site-directed mutagenesis, In Vitro Mutagenesis Protoc. (2002) 37–43. [25] G. Li, Cloning, expression, and characterization of a highly active alkaline pectate lyase from alkaliphilic Bacillus sp. N16-5, J. Microbiol. Biotechnol. 20 (2010) 670–677. [26] L.D. Kluskens, G.W.M. Alebeek, A.G.J. Voragen, W.M. Vos, J. Oost, Molecular and biochemical characterization of the thermoactive family 1 pectate lyase from the hyperthermophilic bacterium Thermotoga maritima, Biochem. J. 370 (2003) 651–659. [27] M. Takao, T. Nakaniwa, K. Yoshikawa, T. Terashita, T. Sakai, Molecular cloning DNA sequence, and expression of the gene encoding for thermostable pectate lyase of thermophilic Bacillus sp. TS 47, Biosci. Biotechnol. Biochem. 65 (2001) 322–329. [28] W. Sukhumsiirchart, S. Kawanishi, W. Deesukon, K. Chansiri, H. Kawasaki, T. Sakamoto, Purification characterization, and overexpression of thermophilic pectate lyase of Bacillus sp. RN1 isolated from a hot spring in Thailand, Biosci. Biotechnol. Biochem. 73 (2009) 268–273. [29] R. Pickersgill, J. Jenkins, G. Harris, W. Nasser, J. Robert-Baudouy, The sturcture of Bacillus subtilis pectate lyase in complex with the callcium, J. Struct. Biol. 1 (1994) 717–723. [30] B. Webb, A. Sali, Protein structure modeling with MODELLER, Protein Struct. Predict. 1137 (2014) 1–15. [31] D.B. Craig, A.A. Dombkowski, Disulfide by Design 2.0: a web-based tool for disulfide engineering in proteins, BMC Bioinf. 1 (2013) 346. [32] H. Yu, Y. Zhao, C. Guo, Y. Gan, H. Huang, The role of proline substitutions within flexible regions on thermostability of luciferase, Biochim. Biophys. Acta 1854 (2015) 65–72. [33] J.A. Wells, Additivity of mutational effects in proteins, Biochemistry 29 (1990) 8509–8517. [34] X.-J. Zhang, W.A. Baase, B.K. Shoichet, K.P. Wilson, B.W. Matthews, Enhancement of protein stability by the combination of point mutations in T4 lysozyme is additive, Protein Eng. 8 (1995) 1017–1022. [35] U. Bornscheuer, G. Huisman, R. Kazlauskas, S. Lutz, J. Moore, K. Robins, Engineering the third wave of biocatalysis, Nature 485 (2012) 185–194. [36] M.T. Reetz, S. Wilensek, D. Zha, K.E. Jaeger, Directed evolution of an enantioselective enzyme through combinatorial multiple-cassette mutagenesis, Angew. Chem. Int. Ed. 40 (2001) 3589–3591. [37] T. Drepper, T. Eggert, W. Hummel, C. Leggewie, M. Pohl, F. Rosenau, S. Wilhelm, K.E. Jaeger, Novel biocatalysts for white biotechnology, Biotechnol. J. 1 (2006) 777–786. [38] Z. Lu, Q. Wang, S. Jiang, G. Zhang, Y. Ma, Truncation of the unique N-terminal domain improved the thermos-stability and specific activity of alkaline alpha-amylase Amy703, Sci. Rep. 6 (2016) 22465. [39] Z. Zhou, Y. Liu, Z. Chang, H. Wang, A. Leier, T.T. Marquez-Lago, Y. Ma, J. Li, J. Song, Structure-based engineering of a pectate lyase with improved specific activity for ramie degumming, Appl. Microbiol. Biotechnol. 101 (2017) 2919–2929. [40] S. Chakraborty, T. Jagan Mohan Rao, A. Goyal, Immobilization of recombinant pectate lyase from Clostridium thermocellum ATCC-27405 on magnetic nanoparticles for bioscouring of cotton fabric, Biotechnol. Prog. 33 (2017) 236–244.

83

[41] Q. Wang, X.-R. Fan, Z.-Z. Hua, J. Chen, Optimizing bioscouring condition of cotton knitted fabrics with an alkaline pectinase from Bacillus subtilis WSHB04-02 by using response surface methodology, Biochem. Eng. J. 34 (2007) 107–113. [42] C.R. Evelyn, J. Biesiada, X. Duan, H. Tang, X. Shang, R. Papoian, W.L. Seibel, S. Nelson, J. Meller, Y. Zheng, Combined rational design and a high throughput screening platform for identifying chemical inhibitors of a Ras-activating enzyme, J. Biol. Chem. 290 (2015) 12879–12898. [43] P. Molina-Espeja, E. Garcia-Ruiz, D. Gonzalez-Perez, Directed evolution of unspecific peroxygenase from Agrocybe aegerita, Appl. Environ. Microb. 80 (2014) 3496–3507. [44] F. Cedrone, A. Ménez, E. Quéméneur, Tailoring new enzyme functions by rational redesign, Curr. Opin. Struct. Biol. 10 (2000) 405–410. [45] V. Lounnas, T. Ritschel, J. Kelder, R. McGuire, R.P. Bywater, N. Foloppe, Current progress in structure-based rational drug design marks a new mindset in drug discovery, J. Comput. Struct. Biotechnol. 5 (2013) e201302011. [46] V.G. Eijsink, A. Bjork, S. Gaseidnes, R. Sirevag, B. Synstad, B. van den Burg, G. Vriend, Rational engineering of enzyme stability, J. Biotechnol. 113 (2004) 105–120. [47] S. Gåseidnes, B. Synstad, X. Jia, H. Kjellesvik, G. Vriend, Stabilization of a chitinase from Serratia marcescens by Gly → Ala and Xxx → Pro mutations, Protein Eng. 16 (2003) 841–846. [48] H. Jochens, K. Stiba, C. Savile, R. Fujii, J.G. Yu, T. Gerassenkov, R.J. Kazlauskas, U.T. Bornscheuer, Converting an esterase into an epoxide hydrolase, Angew. Chem. Int. Ed. Engl. 48 (2009) 3532–3535. [49] A. Rogowski, A. Basle, C.S. Farinas, A. Solovyova, J.C. Mortimer, P. Dupree, H.J. Gilbert, D.N. Bolam, Evidence that GH115 alpha-glucuronidase activity which is required to degrade plant biomass, is dependent on conformational flexibility, J. Biol. Chem. 289 (2014) 53–64. [50] C.A. Denard, H. Ren, H. Zhao, Improving and repurposing biocatalysts via directed evolution, Curr. Opin. Chem. Biol. 25 (2015) 55–64. [51] A. Currin, N. Swainston, P.J. Day, Synthetic biology for the directed evolution of protein biocatalysts: navigating sequence space intelligently, Chem. Soc. Rev. 44 (2015) 1172–1239. [52] M. Sandgren, P.J. Gualfetti, A. Shaw, L.S. Gross, M. Saldajeno, A.G. Day, T.A. Jones, C. Mitchinson, Comparison of family 12 glycoside hydrolases and recruited substitutions important for thermal stability, Protein Sci. 12 (2003) 848–860. [53] O. Lichtarge, H.R. Bourne, F.E. Cohen, An evolutionary trace method defines binding surfaces common to protein families, J. Mol. Biol. 257 (1996) 342–358. [54] G.E. Host, B.H. Jonsson, Converting human carbonic anhydrase II into a benzoate ester hydrolase through rational redesign, Biochim. Biophys. Acta 1784 (2008) 811–815. [55] G. Vogt, S. Woell, P. Argos, Protein thermal stability hydrogen bonds, and ion pairs, J. Mol. Biol. 269 (1997) 631–643. [56] Z. Lu, C. Tian, A. Li, G. Zhang, Y. Ma, Identification and characterization of a novel alkaline alpha amylase Amy703 belonging to a new clade from Bacillus pseudofirmus, J. Ind. Microbiol. Biotechnol. 41 (2014) 783–793. [57] A.S. Aly, S.M. Sayed, M.K. Zahran, One-step process for enzymatic desizing and bioscouring of cotton fabrics, J. Nat. Fibers 7 (2010) 71–92. [58] N. Demir, J. Acar, K. Sarıo˘glu, M. Mutlu, The use of commercial pectinase in fruit juice industry. Part 3: Immobilized pectinase for mash treatment, J. Food Eng. 47 (2001) 275–280. [59] H.U. Rehman, A. Aman, A. Silipo, S.A. Qader, A. Molinaro, A. Ansari, Degradation of complex carbohydrate: immobilization of pectinase from Bacillus licheniformis KIBGE-IB21 using calcium alginate as a support, Food Chem. 139 (2013) 1081–1086. [60] M. Mahesh, K.V. Arivizhivendhan, P. Maharaja, R. Boopathy, V. Hamsavathani, G. Sekaran, Production, purification and immobilization of pectinase from Aspergillus ibericus onto functionalized nanoporous activated carbon (FNAC) and its application on treatment of pectin containing wastewater, J. Mol. Catal. B 133 (2016) 43–54.